Epithelial membrane protein 2: a novel biomarker for circulating tumor cell recovery in breast cancer.

PURPOSE: EpCAM is a common marker used in the detection of circulating tumor cells (CTC). Disseminated cancer cells display the characteristics of epithelial-to-mesenchymal transition events. The purpose of this study was to assess the potential of epithelial membrane protein 2 (EMP2) as a novel biomarker for CTC retrieval in breast cancer. METHODS: MCF7 and MDA-MB-231 cells were stained with either anti-EpCAM or anti-EMP2 mAbs, respectively, followed by flow cytometric assay to measure their expression levels. PBMCs isolated from healthy donors were used for breast cancer cell spiking. CD45-depleted PBMCs from breast cancer patients' blood were used for CTC capturing. Immunomagnetic separation was used to enrich breast cancer cells. Cytospin centrifugation was performed to concentrate the captured cells, followed by immunofluorescence staining with anti-CD45 mAb, anti-pan cytokeratin mAb and DAPI. Fluorescent images were taken using a confocal microscope for CTC counts. RESULT: MDA-MB-231 cells had 2.56 times higher EMP2 expression than MCF7 cells, and EMP2 had a significantly higher capture efficiency than EpCAM for MCF7 cells. Furthermore, anti-EMP2 was capable of capturing MCF7 cells that escaped in the flow-through of anti-EpCAM. Likewise, EMP2 had a significantly higher capture efficiency on MDA-MB-231 cells when compared to MCF7 cells. Most importantly, EMP2 biomarker was successfully used for CTC capture in patients with primary breast cancer. CONCLUSIONS: EMP2 is superior to EpCAM for capturing both MCF7 and MDA-MB-231 cells. Additionally, EMP2 is a novel biomarker and capable of capturing breast cancer cells in patient blood samples.

An assessment of the phylogenetic relationship among sugarcane and related taxa based on the nucleotide sequence of 5S rRNA intergenic spacers.

5S rRNA intergenic spacers were amplified from two elite sugarcane (Saccharum hybrids) cultivars and their related taxa by polymerase chain reaction (PCR) with 5S rDNA consensus primers. Resulting PCR products were uniform in length from each accession but exhibited some degree of length variation among the sugarcane accessions and related taxa. These PCR products did not always cross hybridize in Southern blot hybridization experiments. These PCR products were cloned into a commercial plasmid vector PCR 2.1 and sequenced. Direct sequencing of cloned PCR products revealed spacer length of 231-237 bp for S. officinarum, 233-237 for sugarcane cultivars, 228-238 bp for S. spontaneum, 239-252 bp for S. giganteum, 385-410 bp for Erianthus spp., 226-230 bp for Miscanthus sinensis Zebra, 206-207 bp for M. sinensis IMP 3057, 207-209 bp for Sorghum bicolor, and 247-249 bp for Zea mays. Nucleotide sequence polymorphism were found at both the segment and single nucleotide level. A consensus sequence for each taxon was obtained by Align X. Multiple sequences were aligned and phylogenetic trees constructed using Align X. CLUSTAL and DNAMAN programs. In general, accessions of the following taxa tended to group together to form distinct clusters: S. giganteum, Erianthus spp., M. sinensis, S. bicolor, and Z. mays. However, the two S. officinarum clones and two sugarcane cultivars did not form distinct clusters but interrelated within the S. spontaneum cluster. The disclosure of these 5S rRNA intergenic spacer sequences will facilitate marker-assisted breeding in sugarcane.

Development of Polymerase Chain Reaction Primers Highly Specific for Xanthomonas albilineans, the Causal Bacterium of Sugarcane Leaf Scald Disease.

New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5' CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5' GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.

A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease.

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

Assessing genetic diversity in a sugarcane germplasm collection using an automated AFLP analysis.

An assessment of genetic diversity within and between Saccharum, Old World Erianthus sect. Ripidium, and North American E.giganteus (S.giganteum) was conducted using Amplified Fragment Length Polymorphism (AFLP(TM)) markers. An automated gel scoring system (GelCompar(TM)) was successfully used to analyse the complex AFLP patterns obtained in sugarcane and its relatives. Similarity coefficient calculations and clustering revealed a genetic structure for Saccharum and Erianthus sect. Ripidium that was identical to the one previously obtained using other molecular marker types, showing the appropriateness of AFLP markers and the associated automated analysis in assessing genetic diversity in sugarcane. A genetic structure that correlated with cytotype (2n=30, 60, 90) was revealed within the North American species, E. giganteus (S.giganteum). Complex relationships among Saccharum, Erianthus sect. Ripidium, and North American E.giganteus were revealed and are discussed in the light of a similar study which involved RAPD markers.

Using genomic slot blot hybridization to assess intergeneric Saccharum x Erianthus hybrids (Andropogoneae - Saccharinae).

The use of genomic slot blot hybridization enabled the differentiation of hybrids from selfs in Saccharum x Erianthus intergeneric crosses in which Saccharum was used as the female parent. Based on the genomic in situ hybridization technique, slot blots of DNA from the parents and the progeny were blocked with the Saccharum parent DNA and hybridized with the labelled male Erianthus genomic DNA. This technique allowed a rapid screening for hybrids and was sensitive enough to detect a 1/20 dilution of Erianthus in Saccharum DNA, which should enable the detection of most partial hybrids. The genomic slot blot hybridization technique was shown to be potentially useful for assessing crosses involving Saccharum species with either Old World Erianthus section Ripidium or North American Erianthus (= Saccharum) species. The effectiveness of the technique was assessed on 144 progeny of a Saccharum officinarum x Erianthus arundinaceus cross, revealing that 43% of the progeny were selfs. The importance of this test as a tool to support intergeneric breeding programs is discussed.

A Polymerase Chain Reaction Protocol for the Detection of Xanthomonas albilineans, the Causal Agent of Sugarcane Leaf Scald Disease.

A polymerase chain reaction (PCR) protocol was developed that amplified a 360-bp DNA product unique to Xanthomonas albilineans (Xa), the causal agent of sugarcane leaf scald disease. The assay utilizes previously described PCR primers that target the intergenic transcribed spacer (ITS) region between the 16S and 23S rRNA genes. Primer pair Ala4/L1 allowed amplification of a 360-bp DNA fragment from 71 Xa strains including representatives of serovars I, II, and III. Fragments of different sizes were also amplified from three unidentified saprophytic bacteria from sugarcane. Xa could be detected at a lower bacterial concentration with the PCR protocol than with a serological dot blot assay. With PCR, as little as 1.25 pg of Xa genomic DNA (125 fg if followed by Southern blot hybridization), or as few as 0 to 5 CFU of Xa per reaction were detected from infected sugarcane sap and leaf diffusate. Five CFU of Xa per reaction were detected from suspension culture. The PCR protocol provides a rapid, reliable, and economical tool for routine detection and identification of Xa.