Replication of centromere II of Schizosaccharomyces pombe.

The centromeric DNAs of Schizosaccharomyces pombe chromosomes resemble those of higher eukaryotes in being large and composed predominantly of repeated sequences. To begin a detailed analysis of the mode of replication of a complex centromere, we examined whether any sequences within S. pombe centromere II (cen2) have the ability to mediate autonomous replication. We found a high density of segments with such activity, including at least eight different regions comprising most of the repeated and unique centromeric DNA elements. A physical mapping analysis using two-dimensional gels showed that autonomous replication initiated within the S. pombe sequences in each plasmid. A two-dimensional gel analysis of replication on the chromosomes revealed that the K and L repeat elements, which occur in multiple copies at all three centromeres and comprise approximately 70% of total centromeric DNA mass in S. pombe, are both sites of replication initiation. In contrast, the unique cen2 central core, which contains multiple segments that can support autonomous replication, appears to be repressed for initiation on the chromosome. We discuss the implications of these findings for our understanding of DNA replication and centromere function.

Physical mapping of origins of replication in the fission yeast Schizosaccharomyces pombe.

We isolated four fragments from the Schizosaccharomyces pombe genome that mediate autonomous replication. A two-dimensional gel analysis revealed that in each case initiation could be mapped to within the S. pombe sequences. In three of the fragments, initiation could be mapped to one discrete location. In the fourth fragment, subcloning and two-dimensional gel analysis suggested that two discrete origins of replication were located within 3 kb of each other. When in proximity, usually only one of these origins fired, suggesting origin interference. Two-dimensional gel analysis of the four origin fragments at their genomic locations demonstrated that each is used in the chromosomes, but in only a subset of cells or cell divisions. The S. pombe genome appears to contain many discrete origins, not all of which fire in any given cell and some of which are closely spaced. Not I/Sfi I mapping of the five origins from this and a previous study indicates that they are randomly distributed throughout the genome and appear to be representative of chromosomal origins of replication in this organism. We compare the features of S. pombe replication origins with those of S. cerevisiae and animal cells.

Specific initiation at an origin of replication from Schizosaccharomyces pombe.

Using a genetic assay for efficient autonomous replication, we have isolated from Schizosaccharomyces pombe a 6.2-kb fragment which shows the properties expected of an origin of DNA replication in S. pombe. A 2.8-kb subclone of the fragment has the same replication properties. Two-dimensional gel analysis of replication intermediates throughout plasmids carrying the 6.2- or 2.8-kb fragments shows that replication initiates only in a specific region, which can be localized to within several hundred base pairs, in the fragments. This region is also a site of replication initiation in the S. pombe chromosome where the fragments normally reside. These results provide strong evidence that initiation of replication in S. pombe is localized and mediated by specific DNA sequence signals.

The replication behavior of Saccharomyces cerevisiae DNA in human cells.

We studied the replication of random genomic DNA fragments from Saccharomyces cerevisiae in a long-term assay in human cells. Plasmids carrying large yeast DNA fragments were able to replicate autonomously in human cells. Efficiency of replication of yeast DNA fragments was comparable to that of similarly sized human DNA fragments and better than that of bacterial DNA. This result suggests that yeast genomic DNA contains sequence information needed for replication in human cells. To examine whether DNA replication in human cells would initiate specifically at a yeast origin of replication, we monitored initiation on a plasmid containing the yeast 2-micron autonomously replicating sequence (ARS) in yeast and human cells. We found that while replication initiates at the 2-micron ARS in yeast, it does not preferentially initiate at the ARS in human cells. This result suggests that the sequences that direct site specific replication initiation in yeast do not function in the same way in human cells, which initiate replication at a broader range of sequences.

Analysis of the autonomous replication behavior in human cells of the dihydrofolate reductase putative chromosomal origin of replication.

Chinese hamster genomic DNA sequences from the region downstream of the dihydrofolate reductase (DHFR) gene reported to contain a chromosomal origin of bidirectional DNA replication (OBR-1) were tested for their ability to support autonomous DNA replication in human cells. A 13.3 kilobase fragment containing OBR-1 and surrounding sequences supported replication in short-term and long-term replication assays, while a 4.5 kb fragment containing OBR-1 did not support substantial replication in either assay. These results are consistent with our previous observations that large fragments of human DNA support replication, while smaller fragments are less efficient. The replication activities of plasmids containing OBR-1 were no greater than those of randomly chosen human fragments of similar size. Furthermore, two-dimensional gel analysis of plasmids containing OBR-1 indicated that initiation does not preferentially occur within the OBR-1 region. These results suggest that in the context of autonomous replication, the DHFR sequences tested do not contain genetic information specifying site-specific replication initiation. Possible implications of these results for chromosomal replication are discussed.

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

RIP60, a mammalian origin-binding protein, enhances DNA bending near the dihydrofolate reductase origin of replication.

Replication of the Chinese hamster dihydrofolate (dhfr) gene initiates near a 281-bp HaeIII fragment of stably bent DNA that binds RIP60, a 60-kDa origin-specific DNA-binding protein that has been purified from HeLa cell nuclear extract (L. Dailey, M. S. Caddle, N. Heintz, and N. H. Heintz, Mol. Cell. Biol. 10:6225-6235, 1990). Circular permutation assays showed that stable DNA bending in the dhfr origin region fragment was due to the presence of five oligo (dA)3-4 tracts, designated bend elements B1 to B5, that are spaced 10 bp apart. DNA bending directed by elements B1 to B5, as assessed by anomolous migration of DNA fragments on polyacrylamide gels, was accentuated at 4 degrees C. Bend element B5, which is in inverse orientation relative to elements B1 to B4, overlaps an ATT-rich motif that comprises the RIP60 protein-binding site. Gel mobility shift assays with circularly permuted bent DNA fragments and purified RIP60 showed that RIP60 markedly enhanced DNA bending of the dhfr origin region sequences. These results suggest that, as in many plasmids, bacteriophages, and eucaryotic viruses, mammalian DNA-binding proteins may enhance DNA bending near origins of replication during initiation of DNA synthesis.

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.

Purification of RIP60 and RIP100, mammalian proteins with origin-specific DNA-binding and ATP-dependent DNA helicase activities.

Replication of the Chinese hamster dihydrofolate reductase gene (dhfr) initiates near a fragment of stably bent DNA that binds multiple cellular factors. Investigation of protein interactions with the dhfr bent DNA sequences revealed a novel nuclear protein that also binds to domain B of the yeast origin of replication, the autonomously replicating sequence ARS1. The origin-specific DNA-binding activity was purified 9,000-fold from HeLa cell nuclear extract in five chromatographic steps. Protein-DNA cross-linking experiments showed that a 60-kDa polypeptide, which we call RIP60, contained the origin-specific DNA-binding activity. Oligonucleotide displacement assays showed that highly purified fractions of RIP60 also contained an ATP-dependent DNA helicase activity. Covalent radiolabeling with ATP indicated that the DNA helicase activity resided in a 100-kDa polypeptide, RIP100. The cofractionation of an ATP-dependent DNA helicase with an origin-specific DNA-binding activity suggests that RIP60 and RIP100 may be involved in initiation of chromosomal DNA synthesis in mammalian cells.

Identification of an origin of bidirectional DNA replication in mammalian chromosomes.

Mechanistically, an origin of bidirectional DNA replication (OBR) can be defined by the transition from discontinuous to continuous DNA synthesis that must occur on each template strand at the site where replication forks originate. This results from synthesis of Okazaki fragments predominantly on the retrograde arms of forks. We have identified these transitions at a specific site within a 0.45 kb sequence approximately 17 kb downstream from the 3' end of the dihydrofolate reductase gene in Chinese hamster ovary chromosomes. At least 80% of the replication forks in a 27 kb region emanated from this OBR. Thus, initiation of DNA replication in mammalian chromosomes uses the same replication fork mechanism previously described in a variety of prokaryotic and eukaryotic genomes, suggesting that mammalian chromosomes also utilize specific cis-acting sequences as origins of DNA replication.

The replication timing of the amplified dihydrofolate reductase genes in the Chinese hamster ovary cell line CHOC 400.

We have examined the timing of replication of the amplified dihydrofolate reductase genes in the methotrexate-resistant Chinese hamster ovary cell line CHOC 400 using two synchronization procedures. DNA replicated in the presence of 5-bromodeoxyuridine was collected from cells of various times during the DNA synthesis phase and the extent of replication for defined sequences was determined by Southern blotting analysis of CsCl density gradient fractions. We report that under these conditions the DHFR gene replicates throughout the course of S phase in a mode similar to the bulk of the replicated genomic DNA. This contrasts with previous data that shows the non-amplified DHFR gene replicates during the first quarter of S phase. Therefore, we conclude that gene amplification alters the replication timing of the DHFR gene in CHOC 400 cells.

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.