Integrated Assays of Genome-Wide Association Study, Multi-Omics Co-Localization, and Machine Learning Associated Calcium Signaling Genes with Oilseed Rape Resistance to Sclerotinia sclerotiorum.

Sclerotinia sclerotiorum (Ss) is one of the most devastating fungal pathogens, causing huge yield loss in multiple economically important crops including oilseed rape. Plant resistance to Ss pertains to quantitative disease resistance (QDR) controlled by multiple minor genes. Genome-wide identification of genes involved in QDR to Ss is yet to be conducted. In this study, we integrated several assays including genome-wide association study (GWAS), multi-omics co-localization, and machine learning prediction to identify, on a genome-wide scale, genes involved in the oilseed rape QDR to Ss. Employing GWAS and multi-omics co-localization, we identified seven resistance-associated loci (RALs) associated with oilseed rape resistance to Ss. Furthermore, we developed a machine learning algorithm and named it Integrative Multi-Omics Analysis and Machine Learning for Target Gene Prediction (iMAP), which integrates multi-omics data to rapidly predict disease resistance-related genes within a broad chromosomal region. Through iMAP based on the identified RALs, we revealed multiple calcium signaling genes related to the QDR to Ss. Population-level analysis of selective sweeps and haplotypes of variants confirmed the positive selection of the predicted calcium signaling genes during evolution. Overall, this study has developed an algorithm that integrates multi-omics data and machine learning methods, providing a powerful tool for predicting target genes associated with specific traits. Furthermore, it makes a basis for further understanding the role and mechanisms of calcium signaling genes in the QDR to Ss.

Glutamate Receptor-like (GLR) Family in Brassica napus: Genome-Wide Identification and Functional Analysis in Resistance to Sclerotinia sclerotiorum.

Plant glutamate receptor-like channels (GLRs) are homologs of animal ionotropic glutamate receptors. GLRs are critical in various plant biological functions, yet their genomic features and functions in disease resistance remain largely unknown in many crop species. Here, we report the results on a thorough genome-wide study of the GLR family in oilseed rape (Brassica napus) and their role in resistance to the fungal pathogen Sclerotinia sclerotiorum. A total of 61 GLRs were identified in oilseed rape. They comprised three groups, as in Arabidopsis thaliana. Detailed computational analyses, including prediction of domain and motifs, cellular localization, cis-acting elements, PTM sites, and amino acid ligands and their binding pockets in BnGLR proteins, unveiled a set of group-specific characteristics of the BnGLR family, which included chromosomal distribution, motif composition, intron number and size, and methylation sites. Functional dissection employing virus-induced gene silencing of BnGLRs in oilseed rape and Arabidopsis mutants of BnGLR homologs demonstrated that BnGLR35/AtGLR2.5 positively, while BnGLR12/AtGLR1.2 and BnGLR53/AtGLR3.2 negatively, regulated plant resistance to S. sclerotiorum, indicating that GLR genes were differentially involved in this resistance. Our findings reveal the complex involvement of GLRs in B. napus resistance to S. sclerotiorum and provide clues for further functional characterization of BnGLRs.

RALF22 promotes plant immunity and amplifies the Pep3 immune signal.

Rapid alkalinization factors (RALFs) in plants have been reported to dampen pathogen-associated molecular pattern (PAMP)-triggered immunity via suppressing PAMP-induced complex formation between the pattern recognition receptor (PRR) and its co-receptor BAK1. However, the direct and positive role of RALFs in plant immunity remains largely unknown. Herein, we report the direct and positive roles of a typical RALF, RALF22, in plant immunity. RALF22 alone directly elicited a variety of typical immune responses and triggered resistance against the devastating necrotrophic fungal pathogen Sclerotinia sclerotiorum in a FERONIA (FER)-dependent manner. LORELEI (LRE)-like glycosylphosphatidylinositol (GPI)-anchored protein 1 (LLG1) and NADPH oxidase RBOHD were required for RALF22-elicited reactive oxygen species (ROS) generation. The mutation of cysteines conserved in the C terminus of RALFs abolished, while the constitutive formation of two disulfide bridges between these cysteines promoted the RALF22-elicited ROS production and resistance against S. sclerotiorum, demonstrating the requirement of these cysteines in the functions of RALF22 in plant immunity. Furthermore, RALF22 amplified the Pep3-induced immune signal by dramatically increasing the abundance of PROPEP3 transcript and protein. Supply with RALF22 induced resistance against S. sclerotiorum in Brassica crop plants. Collectively, our results reveal that RALF22 triggers immune responses and augments the Pep3-induced immune signal in a FER-dependent manner, and exhibits the potential to be exploited as an immune elicitor in crop protection.

Tomato LysM receptor kinase 4 mediates chitin-elicited fungal resistance in both leaves and fruit.

Fungal infection is a major cause of crop and fruit losses. Recognition of chitin, a component of fungal cell walls, endows plants with enhanced fungal resistance. Here, we found that mutation of tomato LysM receptor kinase 4 (SlLYK4) and chitin elicitor receptor kinase 1 (SlCERK1) impaired chitin-induced immune responses in tomato leaves. Compared with the wild type, sllyk4 and slcerk1 mutant leaves were more susceptible to Botrytis cinerea (gray mold). SlLYK4 extracellular domain showed strong binding affinity to chitin, and the binding of SlLYK4 induced SlLYK4-SlCERK1 association. Remarkably, qRT-PCR analysis indicated that SlLYK4 was highly expressed in tomato fruit, and ß-GLUCURONIDASE (GUS) expression driven by the SlLYK4 promoter was observed in tomato fruit. Furthermore, SlLYK4 overexpression enhanced disease resistance not only in leaves but also in fruit. Our study suggests that chitin-mediated immunity plays a role in fruit, providing a possible way to reduce fungal infection-related fruit losses by enhancing the chitin-induced immune responses.

Genome-Wide Identification of Rapid Alkalinization Factor Family in Brassica napus and Functional Analysis of BnRALF10 in Immunity to Sclerotinia sclerotiorum.

Rapid alkalinization factors (RALFs) were recently reported to be important players in plant immunity. Nevertheless, the signaling underlying RALF-triggered immunity in crop species against necrotrophic pathogens remains largely unknown. In this study, RALF family in the important oil crop oilseed rape (Brassica napus) was identified and functions of BnRALF10 in immunity against the devastating necrotrophic pathogen Sclerotinia sclerotiorum as well as the signaling underlying this immunity were revealed. The oilseed rape genome carried 61 RALFs, half of them were atypical, containing a less conserved YISY motif and lacking a RRXL motif or a pair of cysteines. Family-wide gene expression analyses demonstrated that patterns of expression in response to S. sclerotiorum infection and DAMP and PAMP treatments were generally RALF- and stimulus-specific. Most significantly responsive BnRALF genes were expressionally up-regulated by S. sclerotiorum, while in contrast, more BnRALF genes were down-regulated by BnPep5 and SsNLP1. These results indicate that members of BnRALF family are likely differentially involved in plant immunity. Functional analyses revealed that BnRALF10 provoked diverse immune responses in oilseed rape and stimulated resistance to S. sclerotiorum. These data support BnRALF10 to function as a DAMP to play a positive role in plant immunity. BnRALF10 interacted with BnFER. Silencing of BnFER decreased BnRALF10-induced reactive oxygen species (ROS) production and compromised rape resistance to S. sclerotiorum. These results back BnFER to be a receptor of BnRALF10. Furthermore, quantitative proteomic analysis identified dozens of BnRALF10-elicited defense (RED) proteins, which respond to BnRALF10 in protein abundance and play a role in defense. Our results revealed that BnRALF10 modulated the abundance of RED proteins to fine tune plant immunity. Collectively, our results provided some insights into the functions of oilseed rape RALFs and the signaling underlying BnRALF-triggered immunity.

Integrated miRNAome and Transcriptome Analysis Reveals Argonaute 2-Mediated Defense Responses Against the Devastating Phytopathogen Sclerotinia sclerotiorum.

Argonaute 2 (AGO2)-mediated role in plant defense against fungal pathogens remains largely unknown. In this study, integrated miRNAome and transcriptome analysis employing ago2 mutant was performed to reveal AGO2-associated miRNAs and defense responses against the devastating necrotrophic phytopathogen Sclerotinia sclerotiorum. Both miRNAome and transcriptomes of S. sclerotiorum-inoculated ago2-1 mutant (ago2-Ss) and wild-type (WT-Ss) as well as mock-inoculated ago2-1 mutant (ago2) and wild-type (WT) Arabidopsis plants, were analyzed by sRNA and mRNA deep sequencing. Differentially expressed genes (DEGs) and differentially expressed miRNAs (DEMs) of the comparisons WT-Ss/WT, ago2/WT, ago2-Ss/WT-Ss, and ago2-Ss/ago2 were identified. Furthermore, integration analysis for the DEMs and DEGs identified over 40 potential AGO2-dependent Sclerotinia sclerotiorum-responsive (ATSR) DEM-DEG pairs involving modulation of immune recognition, calcium flux, redox homeostasis, hormone accumulation and signaling, cell wall modification and metal ion homeostasis. Data-mining result indicated that most of the DEMs were bound with AGO2. Moreover, Arabidopsis mutant analysis demonstrated that three ROS and redox homeostatasis related DEGs of identified DEM-DEG pairs, GSTU2, GSTU5, and RBOHF contributed to the AGO2-mediated defense against S. sclerotiorum. This work provides genome-wide prediction of miRNA-target gene pairs that are potentially associated with the AGO2-dependent resistance against S. sclerotiorum.

Characterization of tomato protein kinases embedding guanylate cyclase catalytic center motif.

Guanylate cyclases (GCs) are enzymes that catalyze the reaction to produce cyclic GMP (cGMP), a key signaling molecule in eukaryotes. Nevertheless, systemic identification and functional analysis of GCs in crop plant species have not yet been conducted. In this study, we systematically identified GC genes in the economically important crop tomato (Solanum lycopersicum L.) and analyzed function of two putative tomato GC genes in disease resistance. Ninety-nine candidate GCs containing GC catalytic center (GC-CC) motif were identified in tomato genome. Intriguingly, all of them were putative protein kinases embedding a GC-CC motif within the protein kinase domain, which was thus tentatively named as GC-kinases here. Two homologs of Arabidopsis PEPRs, SlGC17 and SlGC18 exhibited in vitro GC activity. Co-silencing of SlGC17 and SlGC18 genes significantly reduced resistance to tobacco rattle virus, fungus Sclerotinia sclerotiorum, and bacterium Pseudomonas syringae pv. tomato (Pst) DC3000. Moreover, co-silencing of these two genes attenuated PAMP and DAMP-triggered immunity as shown by obvious decrease of flg22, chitin and AtPep1-elicited Ca2+ and H2O2 burst in SlGC-silenced plants. Additionally, silencing of these genes altered the expression of a set of Ca2+ signaling genes. Furthermore, co-silencing of these GC-kinase genes exhibited stronger effects on all above regulations in comparison with individual silencing. Collectively, our results suggest that GC-kinases might widely exist in tomato and the two SlPEPR-GC genes redundantly play a positive role in resistance to diverse pathogens and PAMP/DAMP-triggered immunity in tomato. Our results provide insights into composition and functions of GC-kinases in tomato.

Ubiquitin Extension Protein UEP1 Modulates Cell Death and Resistance to Various Pathogens in Tobacco.

Ubiquitin (Ub) extension proteins (UEPs) are fusion proteins of a Ub at the N terminus to a ribosomal protein. They are the main source of Ub and the only source of extension ribosomal protein. Although important roles of the Ub-26S proteasome system in various biological processes have been well established, direct evidence for the role of UEP genes in plant defense is rarely reported. In this study, we cloned a Ub-S27a-type UEP gene (NbUEP1) from Nicotiana benthamiana and demonstrated its function in cell death and disease resistance. Virus-induced gene silencing of NbUEP1 led to intensive cell death, culminating in whole-seedling withering. Transient RNA interference (RNAi) of NbUEP1 caused strong cell death in infiltrated areas, while stable NbUEP1-RNAi tobacco plants constitutively formed necrotic lesions in leaves. NbUEP1-RNAi plants exhibited increased resistance to the oomycete Pythium aphanidermatum and viruses Tobacco mosaic virus and Cucumber mosaic virus while displaying decreased resistance to the nematode Meloidogyne incognita compared with non-RNAi control plants. Transcription profiling analysis indicated that jasmonate and ethylene pathways, lipid metabolism, copper amine oxidase-mediated active species generation, glycine-rich proteins, vacuolar processing enzyme- and RD21-mediated cell death and defense regulation, and autophagy might be associated with NbUEP1-mediated cell death and resistance. Our results provided evidence for the important roles of plant UEPs in modulating plant cell death and disease resistance.

Glycolate oxidase gene family in Nicotiana benthamiana: genome-wide identification and functional analyses in disease resistance.

Glycolate oxidase (GOX)-dependent production of H2O2 in response to pathogens and its function in disease resistance are still poorly understood. In this study, we performed genome-wide identification of GOX gene family in Nicotiana benthamiana and analyzed their function in various types of disease resistance. Sixteen GOX genes were identified in N. benthamiana genome. They consisted of GOX and HAOX groups. All but two NbGOX proteins contained an alpha_hydroxyacid_oxid_FMN domain with extra 43-52 amino acids compared to that of FMN-dependent alpha-hydroxyacid oxidizing enzymes (NCBI-CDD cd02809). Silencing of three NbGOX family genes NbHAOX8, NbGOX1 and NbGOX4 differently affected resistance to various pathogens including Tobacco rattle virus, Xanthomonas oryzae pv. oryzae (Xoo) and Sclerotinia sclerotiorum. Effect of these genes on resistance to Xoo is well correlated with that on Xoo-responsive H2O2 accumulation. Additionally, silencing of these genes enhanced PAMP-triggered immunity as shown by increased flg22-elicited H2O2 accumulation in NbGOX-silenced plants. These NbGOX family genes were distinguishable in altering expression of defense genes. Analysis of mutual effect on gene expression indicated that NbGOX4 might function through repressing NbHAOX8 and NbGOX1. Collectively, our results reveal the important roles and functional complexity of GOX genes in disease resistance in N. benthamiana.

Leaf stage-associated resistance is correlated with phytohormones in a pathosystem-dependent manner.

It has been reported in several pathosystems that disease resistance can vary in leaves at different stages. However, how general this leaf stage-associated resistance is, and the molecular mechanism(s) underlying it, remain largely unknown. Here, we investigated the effect of leaf stage on basal resistance, effector-triggered immunity (ETI) and nonhost resistance, using eight pathosystems involving the hosts Arabidopsis thaliana, Nicotiana tabacum, and N. benthamiana and the pathogens Sclerotinia sclerotiorum, Pseudomonas syringae pv. tabaci, P. syringae pv. tomato DC3000, and Xanthomonas oryzae pv. oryzae (Xoo). We show evidence that leaf stage-associated resistance exists ubiquitously in plants, but with varying intensity at different stages in diverse pathosystems. Microarray expression profiling assays demonstrated that hundreds of genes involved in defense responses, phytohormone biosynthesis and signaling, and calcium signaling, were differentially expressed between leaves at different stages. The Arabidopsis mutants sid1, sid2-3, ein2, jar1-1, aba1 and aao3 lost leaf stage-associated resistance to S. sclerotiorum, and the mutants aba1 and sid2-3 were affected in leaf stage-associated RPS2/AvrRpt2+ -conferred ETI, whereas only the mutant sid2-3 influenced leaf stage-associated nonhost resistance to Xoo. Our results reveal that the phytohormones salicylic acid, ethylene, jasmonic acid and abscisic acid likely play an essential, but pathosystem-dependent, role in leaf stage-associated resistance.

SlCNGC1 and SlCNGC14 Suppress Xanthomonas oryzae pv. oryzicola-Induced Hypersensitive Response and Non-host Resistance in Tomato.

Mechanisms underlying plant non-host resistance to Xanthomonas oryzae pv. oryzicola (Xoc), the pathogen causing rice leaf streak disease, are largely unknown. Cyclic nucleotide-gated ion channels (CNGCs) are calcium-permeable channels that are involved in various biological processes including plant resistance. In this study, functions of two tomato CNGC genes SlCNGC1 and SlCNGC14 in non-host resistance to Xoc were analyzed. Silencing of SlCNGC1 and SlCNGC14 in tomato significantly enhanced Xoc-induced hypersensitive response (HR) and non-host resistance, demonstrating that both SlCNGC1 and SlCNGC14 negatively regulate non-host resistance related HR and non-host resistance to Xoc in tomato. Silencing of SlCNGC1 and SlCNGC14 strikingly increased Xoc-induced callose deposition and strongly promoted both Xoc-induced and flg22-elicited H2O2, indicating that these two SlCNGCs repress callose deposition and ROS accumulation to attenuate non-host resistance and PAMP-triggered immunity (PTI). Importantly, silencing of SlCNGC1 and SlCNGC14 apparently compromised cytosolic Ca2+ accumulation, implying that SlCNGC1 and SlCNGC14 function as Ca2+ channels and negatively regulate non-host resistance and PTI-related responses through modulating cytosolic Ca2+ accumulation. SlCNGC14 seemed to play a stronger regulatory role in the non-host resistance and PTI compared to SlCNGC1. Our results reveal the contribution of CNGCs and probably also Ca2+ signaling pathway to non-host resistance and PTI.

Artificial Agrobacterium tumefaciens strains exhibit diverse mechanisms to repress Xanthomonas oryzae pv. oryzae-induced hypersensitive response and non-host resistance in Nicotiana benthamiana.

Xanthomonas oryzae pv. oryzae (Xoo) rapidly triggers a hypersensitive response (HR) and non-host resistance in its non-host plant Nicotiana benthamiana. Here, we report that Agrobacterium tumefaciens strain GV3101 blocks Xoo-induced HR in N. benthamiana when pre-infiltrated or co-infiltrated, but not when post-infiltrated at 4 h after Xoo inoculation. This suppression by A. tumefaciens is local and highly efficient to Xoo. The HR-inhibiting efficiency of A. tumefaciens is strain dependent. Strain C58C1 has almost no effect on Xoo-induced HR, whereas strains GV3101, EHA105 and LBA4404 nearly completely block HR formation. Intriguingly, these three HR-inhibiting strains employ different strategies to repress HR. Strain GV3101 displays strong antibiotic activity and thus suppresses Xoo growth. Comparison of the genotype and Xoo antibiosis activity of wild-type A. tumefaciens strain C58 and a set of C58-derived strains reveals that this Xoo antibiosis activity of A. tumefaciens is negatively, but not solely, regulated by the transferred-DNA (T-DNA) of the Ti plasmid pTiC58. Unlike GV3101, strains LBA4404 and EHA105 exhibit no significant antibiotic effect on Xoo, but rather abolish hydrogen peroxide accumulation. In addition, expression assays indicate that strains LBA4404 and EHA105 may inhibit Xoo-induced HR by suppression of the expression of Xoo type III secretion system (T3SS) effector genes hpa1 and hrpD6. Collectively, our results unveil the multiple levels of effects of A. tumefaciens on Xoo in N. benthamiana and provide insights into the molecular mechanisms underlying the bacterial antibiosis of A. tumefaciens and the non-host resistance induced by Xoo.

Genome-Wide Identification of Dicer-Like, Argonaute, and RNA-Dependent RNA Polymerase Gene Families in Brassica Species and Functional Analyses of Their Arabidopsis Homologs in Resistance to Sclerotinia sclerotiorum.

RNA silencing is an important mechanism to regulate gene expression and antiviral defense in plants. Nevertheless, RNA silencing machinery in the important oil crop Brassica napus and function in resistance to the devastating fungal pathogen Sclerotinia sclerotiorum are not well-understood. In this study, gene families of RNA silencing machinery in B. napus were identified and their role in resistance to S. sclerotiorum was revealed. Genome of the allopolyploid species B. napus possessed 8 Dicer-like (DCL), 27 Argonaute (AGO), and 16 RNA-dependent RNA polymerase (RDR) genes, which included almost all copies from its progenitor species B. rapa and B. oleracea and three extra copies of RDR5 genes, indicating that the RDR5 group in B. napus appears to have undergone further expansion through duplication during evolution. Moreover, compared with Arabidopsis, some AGO and RDR genes such as AGO1, AGO4, AGO9, and RDR5 had significantly expanded in these Brassica species. Twenty-one out of 51 DCL, AGO, and RDR genes were predicted to contain calmodulin-binding transcription activators (CAMTA)-binding site (CGCG box). S. sclerotiorum inoculation strongly induced the expression of BnCAMTA3 genes while significantly suppressed that of some CGCG-containing RNA silencing component genes, suggesting that RNA silencing machinery might be targeted by CAMTA3. Furthermore, Arabidopsis mutant analyses demonstrated that dcl4-2, ago9-1, rdr1-1, rdr6-11, and rdr6-15 mutants were more susceptible to S. sclerotiorum, while dcl1-9 was more resistant. Our results reveal the importance of RNA silencing in plant resistance to S. sclerotiorum and imply a new mechanism of CAMTA function as well as RNA silencing regulation.

Tight regulation of the interaction between Brassica napus and Sclerotinia sclerotiorum at the microRNA level.

MicroRNAs (miRNAs) are multifunctional non-coding short nucleotide molecules. Nevertheless, the role of miRNAs in the interactions between plants and necrotrophic pathogens is largely unknown. Here, we report the identification of the miRNA repertoire of the economically important oil crop oilseed rape (Brassica napus) and those involved in interacting with its most devastating necrotrophic pathogen Sclerotinia sclerotiorum. We identified 280 B. napus miRNA candidates, including 53 novel candidates and 227 canonical members or variants of known miRNA families, by high-throughput deep sequencing of small RNAs from both normal and S. sclerotiorum-inoculated leaves. Target genes of 15 novel candidates and 222 known miRNAs were further identified by sequencing of degradomes from the two types of samples. MiRNA microarray analysis revealed that 68 miRNAs were differentially expressed between S. sclerotiorum-inoculated and uninoculated leaves. A set of these miRNAs target genes involved in plant defense to S. sclerotiorum and/or other pathogens such as nucleotide binding site-leucine-rich repeat (NBS-LRR) R genes and nitric oxygen and reactive oxygen species related genes. Additionally, three miRNAs target AGO1 and AGO2, key components of post-transcriptional gene silencing (PTGS). Expression of several viral PTGS suppressors reduced resistance to S. sclerotiorum. Arabidopsis mutants of AGO1 and AGO2 exhibited reduced resistance while transgenic lines over-expressing AGO1 displayed increased resistance to S. sclerotiorum in an AGO1 expression level-dependent manner. Moreover, transient over-expression of miRNAs targeting AGO1 and AGO2 decreased resistance to S. sclerotiorum in oilseed rape. Our results demonstrate that the interactions between B. napus and S. sclerotiorum are tightly regulated at miRNA level and probably involve PTGS.

Brassica napus Genome Possesses Extraordinary High Number of CAMTA Genes and CAMTA3 Contributes to PAMP Triggered Immunity and Resistance to Sclerotinia sclerotiorum.

Calmodulin-binding transcription activators (CAMTAs) play important roles in various plant biological processes including disease resistance and abiotic stress tolerance. Oilseed rape (Brassica napus L.) is one of the most important oil-producing crops worldwide. To date, compositon of CAMTAs in genomes of Brassica species and role of CAMTAs in resistance to the devastating necrotrophic fungal pathogen Sclerotinia sclerotiorum are still unknown. In this study, 18 CAMTA genes were identified in oilseed rape genome through bioinformatics analyses, which were inherited from the nine copies each in its progenitors Brassica rapa and Brassica oleracea and represented the highest number of CAMTAs in a given plant species identified so far. Gene structure, protein domain organization and phylogentic analyses showed that the oilseed rape CAMTAs were structurally similar and clustered into three major groups as other plant CAMTAs, but had expanded subgroups CAMTA3 and CAMTA4 genes uniquely in rosids species occurring before formation of oilseed rape. A large number of stress response-related cis-elements existed in the 1.5 kb promoter regions of the BnCAMTA genes. BnCAMTA genes were expressed differentially in various organs and in response to treatments with plant hormones and the toxin oxalic acid (OA) secreted by S. sclerotiorum as well as the pathogen inoculation. Remarkably, the expression of BnCAMTA3A1 and BnCAMTA3C1 was drastically induced in early phase of S. sclerotiorum infection, indicating their potential role in the interactions between oilseed rape and S. sclerotiorum. Furthermore, inoculation analyses using Arabidopsis camta mutants demonstrated that Atcamta3 mutant plants exhibited significantly smaller disease lesions than wild-type and other Atcamta mutant plants. In addition, compared with wild-type plants, Atcamta3 plants accumulated obviously more hydrogen peroxide in response to the PAMP chitin and exhibited much higher expression of the CGCG-box-containing genes BAK1 and JIN1, which are essential to the PAMP triggered immunity (PTI) and/or plant resistance to pathogens including S. sclerotiorum. Our results revealed that CAMTA3 negatively regulated PTI probably by directly targeting BAK1 and it also negatively regulated plant defense through suppressing JA signaling pathway probably via directly targeting JIN1.

Phylogeny of Plant CAMTAs and Role of AtCAMTAs in Nonhost Resistance to Xanthomonas oryzae pv. oryzae.

Calmodulin-binding transcription activator (CAMTA) constitutes one of the most important Ca(2+)/CaM-regulated transcription factor families in plants. Nevertheless, the phylogeny, protein interaction network, and role in nonhost resistance of plant CAMTAs are not well understood. In this study, 200 CAMTA genes were identified from 35 species representing four major plant lineages. The CAMTA genes were conserved in multicellular land plants but absent in unicellular eukaryotes, and were likely to emerge from the fusion of two separate genes encoding a CAMTA-like protein and an IQ/CaM binding motif containing protein, respectively, in the embryophyta lineage ancestor. Approximately one fourth of plant CAMTAs did not contain a TIG domain. This non-TIG class of CAMTAs seems to have newly evolved through mutation of some key amino acids in the TIG domain of flowering land plants after divergence from the non-flowering plants. Phylogenetic analysis classified CAMTA proteins into three major groups and nine distinct subgroups, a result supported by protein domain and motif conservation analyses. Most (59.0 and 21.5%) of the identified CAMTA genes contained 12 or 11 introns, respectively. Gene duplication, intron invasion, enlargement and turnover, as well as exon rearrangements and skipping have apparently occurred during evolution of the CAMTA family. Moreover, 38 potential interactors of six Arabidopsis CAMTAs were predicted and 10 predicted target genes of AtCAMTA3 exhibited changes in expression between Atcamta3 mutants and wild-type plants. The majority of predicted interactors are transcription factors and/or Ca(2+)/CaM-regulated proteins, suggesting that transcriptional regulation of the target genes might be the dominant functional mechanism of AtCAMTAs, and AtCAMTAs might act together with other Ca(2+) signaling components to regulate Ca(2+)-related biological processes. Furthermore, functional analyses employing Atcamta mutants revealed that AtCAMTA3 negatively regulated the immunity triggered by flg22 and nonhost resistance to Xanthomonas oryzae pv. oryzae via repressing accumulation of reactive oxygen species probably by targeting CBP60G, EDS1, and NDR1 and involving SA pathway.

TMT-based quantitative proteomics analyses reveal novel defense mechanisms of Brassica napus against the devastating necrotrophic pathogen Sclerotinia sclerotiorum.

UNLABELLED: The white mould disease, caused by Sclerotinia sclerotiorum, is one of the most important diseases in the vital oil crop Brassica napus. Nevertheless, the defense mechanisms of B. napus against S. sclerotiorum are poorly understood. In this study, we performed comparative quantitative proteomics analyses to reveal B. napus defense mechanisms against S. sclerotiorum. The proteomes of B. napus leaves inoculated with S. sclerotiorum wild-type strain 1980 and nonpathogenic mutant strain Ep-1PB as well as empty agar plug as the control were analyzed using TMT label-based quantitative analysis technique. A total of 79, 299 and 173 proteins consistently differentially expressed between Ep-1PB- and mock-inoculated leaves, 1980- and mock-inoculated leaves, as well as 1980- and Ep-1PB-inoculated leaves, respectively, were identified. The differential expression of 12 selected proteins was confirmed by qRT-PCR analyses. The Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction prediction analyses revealed that redox homeostasis, lipid signaling, calcium signaling, histone and DNA methylation-mediated transcription regulation and defense-related proteins such as defensin and defensin-like proteins and cyanate lyase, contribute to defense against S. sclerotiorum. Our results provide new insights into molecular mechanisms that may be involved in defense responses of B. napus to S. sclerotiorum. SIGNIFICANCE: The Sclerotinia white mould disease is one of the most important diseases in the significant oil crop Brassica napus. Nevertheless, the defense mechanisms of B. napus against S. sclerotiorum are still largely unknown to date. In this study, we addressed this issue by performing TMT label-based comparative quantitative analyses of the proteomes of B. napus leaves inoculated with S. sclerotiorum wild-type strain 1980 and nonpathogenic mutant strain Ep-1PB as well as empty agar plug as the control. Through comparative analyses on 79, 299, and 173 proteins that are consistently differentially expressed in between Ep-1PB-inoculated and the control leaves, 1980-inoculated and the control leaves, as well as 1980-inoculated and Ep-1PB-inoculated leaves, respectively, we revealed that redox homeostasis, lipid signaling, calcium signaling, histone and DNA methylation-mediated transcription regulation and defense-related proteins such as defensin and defensin-like proteins as well as cyanate lyase, contribute to B. napus defenses against S. sclerotiorum. Notably, the potential role of lipid signaling, calcium signaling, histone and DNA methylation-mediated transcription regulation and cyanate lyase in B. napus defense against S. sclerotiorum are not reported previously but rather unveiled for the first time in this study. The current study represents the most extensive analysis of the protein profile of B. napus in response to S. sclerotiorum inoculation and includes for the first time the results from comparison between plants inoculated with the wild-type strain and a nonpathogenic mutant strain of S. sclerotiorum. Collectively, our results provide new insights into the molecular mechanisms of interactions between B. napus and S. sclerotiorum.

Phi Class of Glutathione S-transferase Gene Superfamily Widely Exists in Nonplant Taxonomic Groups.

Glutathione S-transferases (GSTs) constitute a superfamily of enzymes involved in detoxification of noxious compounds and protection against oxidative damage. GST class Phi (GSTF), one of the important classes of plant GSTs, has long been considered as plant specific but was recently found in basidiomycete fungi. However, the range of nonplant taxonomic groups containing GSTFs remains unknown. In this study, the distribution and phylogenetic relationships of nonplant GSTFs were investigated. We identified GSTFs in ascomycete fungi, myxobacteria, and protists Naegleria gruberi and Aureococcus anophagefferens. GSTF occurrence in these bacteria and protists correlated with their genome sizes and habitats. While this link was missing across ascomycetes, the distribution and abundance of GSTFs among ascomycete genomes could be associated with their lifestyles to some extent. Sequence comparison, gene structure, and phylogenetic analyses indicated divergence among nonplant GSTFs, suggesting polyphyletic origins during evolution. Furthermore, in silico prediction of functional partners suggested functional diversification among nonplant GSTFs.

Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

Calcium-dependent protein kinase (CDPK) and CDPK-related kinase (CRK) gene families in tomato: genome-wide identification and functional analyses in disease resistance.

Calcium-dependent protein kinases (CDPKs) and CDPK-related kinases (CRKs) play multiple roles in plant. Nevertheless, genome-wide identification of these two families is limited to several plant species, and role of CRKs in disease resistance remains unclear. In this study, we identified the CDPK and CRK gene families in genome of the economically important crop tomato (Solanum lycopersicum L.) and analyzed their function in resistance to various pathogens. Twenty-nine CDPK and six CRK genes were identified in tomato genome. Both SlCDPK and SlCRK proteins harbored an STKc_CAMK type protein kinase domain, while only SlCDPKs contained EF-hand type Ca(2+) binding domain(s). Phylogenetic analysis revealed that plant CRK family diverged early from CDPKs, and shared a common ancestor gene with subgroup IV CDPKs. Subgroup IV SlCDPK proteins were basic and their genes contained 11 introns, which were distinguished from other subgroups but similar to CRKs. Subgroup I SlCDPKs generally did not carry an N-terminal myristoylation motif while those of the remaining subgroups and SlCRKs universally did. SlCDPK and SlCRK genes were differently responsive to pathogenic stimuli. Furthermore, silencing analyses demonstrated that SlCDPK18 and SlCDPK10 positively regulated nonhost resistance to Xanthomonas oryzae pv. oryzae and host resistance to Pseudomonas syringae pv. tomato (Pst) DC3000, respectively, while SlCRK6 positively regulated resistance to both Pst DC3000 and Sclerotinia sclerotiorum in tomato. In conclusion, CRKs apparently evolved from CDPK lineage, SlCDPK and SlCRK genes regulate a wide range of resistance and SlCRK6 is the first CRK gene proved to function in plant disease resistance.