NO2, BC and PM Exposure of Participants in the Polluscope Autumn 2019 Campaign in the Paris Region.

The Polluscope project aims to better understand the personal exposure to air pollutants in the Paris region. This article is based on one campaign from the project, which was conducted in the autumn of 2019 and involved 63 participants equipped with portable sensors (i.e., NO2, BC and PM) for one week. After a phase of data curation, analyses were performed on the results from all participants, as well as on individual participants' data for case studies. A machine learning algorithm was used to allocate the data to different environments (e.g., transportation, indoor, home, office, and outdoor). The results of the campaign showed that the participants' exposure to air pollutants depended very much on their lifestyle and the sources of pollution that may be present in the vicinity. Individuals' use of transportation was found to be associated with higher levels of pollutants, even when the time spent on transport was relatively short. In contrast, homes and offices were environments with the lowest concentrations of pollutants. However, some activities performed in indoor air (e.g., cooking) also showed a high levels of pollution over a relatively short period.

Síndrome del nevus melanocítico congénito. Serie de casos / Congenital Melanocytic Nevus Syndrome: A Case Series

El síndrome del nevus melanocítico congénito (SNMC) consiste en la proliferación anormal de melanocitos en la piel y el sistema nervioso central, y se debe a mutaciones de las células progenitoras durante el desarrollo embrionario. En muchas de estas células se han detectado mutaciones en el gen NRAS. Se exponen 5 casos de nevus melanocítico congénito gigante, 3 de ellos asociados al SNMC, en los que se ha estudiado dicha mutación. Hasta hace unos años la cirugía era el tratamiento de elección, sin embargo, sus resultados son insatisfactorios, con cirugías agresivas que no mejoran el aspecto estético y reducen mínimamente el riesgo de malignización. En el año 2013 se aprobó el trametinib en el uso del melanoma avanzado con mutaciones de NRAS. Dicho fármaco, que participa en la cascada intracelular de RAS-RAF-MEK-pERK-MAPK, podría ser útil en pacientes pediátricos con SNMC. El conocimiento más amplio de esta enfermedad permitirá crear nuevas estrategias (AU)

Congenital melanocytic nevus syndrome (CMNS) is the result of an abnormal proliferation of melanocytes in the skin and central nervous system caused by progenitor-cell mutations during embryonic development. Mutations in the NRAS gene have been detected in many of these cells. We present 5 cases of giant congenital melanocytic nevus, 3 of them associated with CMNS; NRAS gene mutation was studied in these 3 patients. Until a few years ago, surgery was the treatment of choice, but the results have proved unsatisfactory because aggressive interventions do not improve cosmetic appearance and only minimally reduce the risk of malignant change. In 2013, trametinib was approved for use in advanced melanoma associated with NRAS mutations. This drug, which acts on the intracellular RAS/RAF/MEK/pERK/MAPK cascade, could be useful in pediatric patients with CMNS. A better understanding of this disease will facilitate the development of new strategies (AU)

Congenital Melanocytic Nevus Syndrome: A Case Series. / Síndrome del nevus melanocítico congénito. Serie de casos.

Congenital melanocytic nevus syndrome (CMNS) is the result of an abnormal proliferation of melanocytes in the skin and central nervous system caused by progenitor-cell mutations during embryonic development. Mutations in the NRAS gene have been detected in many of these cells. We present 5 cases of giant congenital melanocytic nevus, 3 of them associated with CMNS; NRAS gene mutation was studied in these 3 patients. Until a few years ago, surgery was the treatment of choice, but the results have proved unsatisfactory because aggressive interventions do not improve cosmetic appearance and only minimally reduce the risk of malignant change. In 2013, trametinib was approved for use in advanced melanoma associated with NRAS mutations. This drug, which acts on the intracellular RAS/RAF/MEK/pERK/MAPK cascade, could be useful in pediatric patients with CMNS. A better understanding of this disease will facilitate the development of new strategies.

Tuberculosis cutánea: revisión del tema a propósito de dos casos / Cutaneous tuberculosis: two cases and literature review

La Tuberculosis Cutánea es una enfermedad infecciosa crónica causada por el Mycobacterium tuberculosis. Pese a ser una forma poco frecuente de presentación de la Tuberculosis, representa un gran desafío para los clínicos que se enfrentan a estos casos, debido principalmente a la gran diversidad de formas clínicas existentes. A continuación presentamos 2 casos clínicos de Tuberculosis Cutánea diagnosticados en el Hospital Regional de Talca y una revisión del tema basada en la clasificación, diagnóstico y tratamiento de la enfermedad.

Cutaneous Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis. Despite being a rare presentation of the disease, Cutaneous Tuberculosis is a major challenge for clinicians who face these cases, mainly due to the great diversity of clinical forms. We present 2 cases of Cutaneous Tuberculosis diagnosed in Hospital Regional de Talca and a review of the topic based in classification, diagnosis and treatment of the disease.

Estudo eletromiográfico do exercício supino executado em diferentes ângulos / Estudio electromiográfico del ejercicio press de banca en diferentes ángulos de ejecución / Electromyographic study of bench press exercise at different angles of execution

Objetivo: O objetivo do estudo foi comparar o pico de força máxima, e a ativação eletromiográfica (EMG) do músculo do peitoral maior porção clavicular (PMC), peitoral maior porção esternocostal (PME) e deltóide anterior (DA) em 3 diferentes ângulos do exercício supino. Método: Foram selecionados 11 indivíduos do sexo masculino (23,7 ± 3,2 anos; 75,1 ± 12,6 kg; 173,7 cm; 9,8 ± 3,6 %G), experientes em treinamento resistido (2,8 ± 1,5 anos; 3,2 ± 0,2 dias por semana; 70 ± 8,9 minutos por sessão). Os sujeitos foram submetidos aos testes de contração voluntária isométrica máxima (CVIM), no supino horizontal (SH: 90o), supino inclinado (SI: 45o) e supino declinado (SD: -30o), sendo as três coletas realizadas respeitando 48 horas de intervalo entre as mesmas. Resultados: Após a coleta encontramos os seguintes resultados na CVIM (162,65 ± 18,63 Kgf SH, 155,02 ± 11,97 Kgf SI e 163,90 ± 15,77 Kgf SD) e constatamos que, não existem diferenças estatisticamente significantes entre os exercícios. Ao verificar a EMG registramos diferenças para a musculatura do DA, nos exercícios de SI e SH, SI e SD. Conclusão: Os resultados suportam que, os diferentes ângulos do supino ativam a musculatura do peitoral maior em suas 2 porções, e que o SI provoca uma maior ativação do DA

Objetivo. El objetivo del estudio fue evaluar el pico de fuerza máxima, y la activación electromiográfica (EMG) del músculo pectoral mayor porción clavicular (PMC), pectoral mayor porción esternocostal (PME) y deltoides anterior (DA) en 3 diferentes ángulos del ejercicio press de banca. Método. Fueron seleccionados 11 sujetos del sexo masculino (23,7 ± 3,2 años; 75,1 ± 12,6 kg; 173,7 cm; 9,8 ± 3,6 %G), expertos en el entrenamiento de fuerza (2,8 ± 1,5 años; 3,2 ± 0,2 días de la semana; 70 ± 8,9 minutos por sesión). Los sujetos fueron sometidos a los tests de contracción voluntaria isométrica máxima (CVIM), en el ejercicio press de banca horizontal (PBH: 90º), press de banca inclinado (PBI: 45º) y press de banca declinado (PBD: - 30º), siendo hechas las tres evaluaciones respetando 48 horas de intervalo entre las mismas. Resultados. Después de las evaluaciones identificamos los siguientes resultados en la CVIM (162,65 ± 18,63 Kgf PBH, 155,02 ± 11,97 Kgf PBI y 163,90 ± 15,77 Kgf PBD), e identificamos que no hubo diferencias significativas entre los ejercicios. En la EMG registramos diferencias significativas en el músculo DA, en los ejercicio PBI y PBH, PBI y PBD. Conclusión. Los resultados soportan que, las 2 porciones del músculo pectoral mayor son similarmente activadas en los diferentes ángulos del press de banca, en cuanto que el PBI conlleva una mayor activación del DA (AU)

Objective. The objective of this was to evaluate of the peak maximum strength, and EMG activation (EMG) in the muscles clavicular portion of pectoralis major (CPPM), sternal portion of pectoralis major (SPPM), and anterior deltoid (AD) in the 3 different angles of the bench press. Method. They were selected 11 male subjects (23.7 ± 3.2 years, 75.1 ± 12.6 kg, 173.7 cm, 9.8 ± 3.6 % BF), experienced in strength training (2,8 ± 1.5 years, 3.2 ± 0.2 days of the week, 70 ± 8.9 minutes by session). The subjects were submitted to the tests of voluntary contraction maximum isometrics (CVIM), in the horizontal bench press (HBP: 90º), in the inclined bench press (IBP: 45º) and declined bench press (DBP: - 30º), being the three evaluations carried out respecting 48 hours of break between the same. Results. After the evaluations we identify the following results in the CVIM (162.65 ± 18.63 Kgf HPB, 155.02 ± 11.97 Kgf IPB and 163.90 ± 15.77 Kgf DPB) and we identify that do not statistically significant between exercises. When checking the differences recorded EMG to muscle the DA, in the exercises PBI and PBH, PBI and PBD. Conclusion. The results support, that the 2 portions of the greater pectoral muscle similarly are activated in the different angles of the press of banking, and that the IBP causes a greater activation of DA. © 2013 Revista Andaluza de Medicina del Deporte (AU)

Mild ocular myopathy associated with a novel mutation in mitochondrial twinkle helicase.

Autosomal dominant PEO is associated with mutations in a number of nuclear genes affecting the intergenomic communication with mitochondrial DNA. We report a Spanish family showing a mild phenotype characterized by autosomal dominant ocular myopathy and morphological signs of mitochondrial dysfunction, that harboured a novel c.1071G>C (p.R357P) mutation in the hot-spot linker region of the twinkle protein.

A novel mutation in the mitochondrial DNA tRNA Leu (UUR) gene associated with late-onset ocular myopathy.

We identified a novel G3283A transition in the mitochondrial DNA tRNA(Leu (UUR)) gene in a patient with ptosis, ophthalmoparesis and hyporeflexia. Muscle biopsy showed cytochrome oxidase positive ragged-red fibers, and defects of complexes I, III and IV of the mitochondrial respiratory chain. The mutation was heteroplasmic in muscle of the proband, being absent in her blood. Ragged-red fibers harbored greater levels of mutant genomes than normal fibers. The G3283A mutation affects a strictly conserved base pair in the TPsiC stem of the gene and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

Utilización de las nuevas tecnologíasen el diseño de un dispositivo ortopédico

En este trabajo se aborda la problemática del tratamiento de torsión tibial y la necesidad de un dispositivo ortopédico para su corrección. Se mencionan los elementos necesarios para el diseño de dicho dispositivo, así como las ventajas que proporcionan las nuevas técnicas de diseño, cuyosavances se muestran brevemente en este trabajo. Finalmente se muestra el modelo 3D del prototipo del dispositivo bajo la acción de las cargas lo que nos posibilita comprobar el diseño y decidir el modelo óptimo para su fabricación(AU)

In this paper a tibial torsion problem is described. The need of an orthopedic device for its treatment in Cuba is explained. The characteristics and properties of the orthopedic device are mentioned. The advantage in the use of new design technique is also mention. Finally, the 3D model of the prototype behavior under load effect is shown and how this results can help to select the optimal model for future manufacture(AU)

NARP-MILS syndrome caused by 8993 T>G mitochondrial DNA mutation: a clinical, genetic and neuropathological study.

The 8993 T>G mutation in mitochondrial DNA has been associated with variable syndromes of differing severity ranging from maternally inherited Leigh's syndrome (MILS) to neuropathy, ataxia, retinitis pigmentosa (NARP), depending on the mutation loads in affected patients. We report a kindred with several members in the same generation suffering NARP or Leigh's syndrome due to a 8993 T>G mutation. Post-mortem studies of the brain in one affected member clinically presenting with a neurological disorder intermediate between adult Leigh's syndrome and NARP showed symmetrical lesions of the basal ganglia and brainstem closely resembling those usually described in typical Leigh's syndrome. Analysis of mtDNA in different tissues showed a high proportion of mutant genome in brainstem, cerebral cortex, putamen, cerebellum and thalamus. These observations illustrate the continuum of clinical and neuropathological manifestations associated with the 8993 T>G mutation of the mtDNA.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Students' assessment of problems in a problem-based learning pharmacology course.

Problem-based learning has been widely employed in Medical Education. One of its main components is that students construct their knowledge working with problems. Therefore, in literature special attention has been given to the design of problems, while assessment has not received the same emphasis. To assess problems implies determining to which extent the resulting work fulfills the purposes that the designers of problems had planned, based on theoretical rationale. This study was developed to determine: if working with the problems allowed the students to carry out the expected learning activities; if the conditions in which they worked were suitable and if the problems were correctly structured. Participants were second-year medical students, enrolled in a problem-based learning pharmacology course. They were asked to assess each problem they used, by means of a questionnaire. The results suggest that when students worked with the problems they carried out activities related to elaboration of knowledge and activation of prior knowledge. They reported to have doubts after working with problems; this can probably be attributed to deficiencies in the students' prior knowledge. Furthermore, the type of problem in which students had low preference were those where they have to analyze tables and charts taken from pharmacological experiment reports; neither the time available to gather the information and to prepare the study issues was sufficient, nor was to study for other subjects. The information produced by assessment is useful for the designers of problems and as feedback to the educational process. The students' participation in the evaluation phase is a way to keep the congruence with a student-centered approach.

Four novel mutations in patients from the Middle East with the infantile form of GM1-gangliosidosis.

GM1-gangliosidosis is a lysosomal storage disorder caused by a deficiency of beta-galactosidase. It is mainly characterized by progressive neurodegeneration and in its most severe infantile form it leads to death before the age of four. We have performed molecular analysis of five patients with the infantile form of GM1-gangliosidosis originating from the Middle East (two from Saudi Arabia and three from the United Arab Emirates). We have identified four novel mutations and one previously reported mutation in the GLB1 gene. The first novel mutation found in the homoallelic state in a patient from Saudi Arabia, is a c.171C>G transversion in exon 2 which creates a premature stop codon. Northern blot analysis in fibroblasts from the patient showed no mRNA and expression studies in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The second novel mutation is a splicing error in intron 2, c.245+1G>A. This mutation was found in the heteroallelic state in a patient from Saudi Arabia, the second mutation being the previously described c.145C>T mutation. The third novel mutation is a missense mutation in exon 4, c.451G>T, found in the homoallelic state in a patient from the United Arab Emirates. Expression studies of this mutation in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The fourth novel mutation is a splicing mutation in intron 8, c.914+4A>G, found in the homoallelic state in two siblings from the United Arab Emirates. This study has revealed genetic heterogeneity of the beta-galactosidase deficiency in the Arabic population [corrected]

Single fiber electromyography (SFEMG) in mitochondrial diseases (MD).

Conventional EMG, nerve conduction studies and SFEMG were performed in 18 patients with various phenotypes of MD. 14 cases showed findings consistent with mild myopathy, 2 patients signs of sensory-motor axonal neuropathy and 2 cases a mixture of myopathy and axonal neuropathy. Motor unit fiber density was mild increased in 8 out of 13 tested cases. Jitter was abnormal in 10 out of 18 tested patients. Jitter abnormalities were not related to myopathic or neurogenic features in the EMG study, and may be observed in muscles without clinical weakness. The results suggest the existence of neuromuscular transmission disturbances in patients with MD.

[Multiple symmetric lipomatosis associated to polyneuropathology, atrophy of the cerebellum and mitochondrial cytopathy]. / Lipomatosis simétrica múltiple asociada a polineuropatía, atrofia de cerebelo y citopatía mitocondrial.

INTRODUCTION: Multiple symmetric lipomatosis (MSL), which is predominantly found in middle aged males, is characterised by accumulations of fat in the neck, shoulders and other parts of the trunk, and sometimes associated with different neurological manifestations, both central and peripheral. Although its aetiology is unknown, it has been described as associated with mitochondrial cytopathies. AIMS. To describe the case of a young female with MSL associated with mitochondrial encephalomyopathy. CASE REPORT: Girl aged 14 with MSL, ataxia, patellar hyperreflexia, bilateral Babinski sign, pes cavus, axonal peripheral neuropathy, involvement of the optic pathway, atrophy of the cerebellum, subsarcolemmal mitochondrial accumulations in the untrastructural examination of the vastus lateralis muscle and partial deficit of complex I in the mitochondrial respiratory chain. As regards molecular genetic aspects, the most frequent mutations of the ATPase 6 gene in lymphocytes, and mtDNA deletions and tRNALys and tRNALeu(UUR) mutations in muscles were excluded. CONCLUSIONS: Despite the fact that MSL is an entity normally found in adults, the possibility of its being diagnosed in the paediatric age must be taken into account. This case is probably the second time MSL has been observed associated with mitochondrial cytopathy in this age bracket.

Two pathogenic mutations in the mitochondrial DNA tRNA Leu(UUR) gene (T3258C and A3280G) resulting in variable clinical phenotypes.

We studied two patients with ragged-red fibers and combined defects of the mitochondrial respiratory chain in their muscle biopsy. One had mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes, and harbored a T3258C transition in the tRNA(Leu(UUR)) gene. The other showed myopathy plus cardiomyopathy and had an A3280G mutation in the same gene. Both mutations were heteroplasmic, abundant in muscle of the patients, less abundant in blood, and still less abundant in blood from their maternal relatives. In both patients, single muscle fiber analysis revealed greater abundance of mutant genomes in ragged-red fibers than in normal fibers, supporting the pathogenicity of both mutations.