Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation.

Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking alpha-satellite DNA. Using telomere-associated chromosome truncation, we have produced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome containing a previously characterized human NC. These MiCs range in size from approximately 0.7 to 1.8 Mb and contain single-copy intact genomic DNA from the 10q25 region. Two of these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is linear. All demonstrate stability in both structure and mitotic transmission in the absence of drug selection. Presence of a functional NC is shown by binding a host of key centromere-associated proteins. These NC-MiCs provide direct evidence for mitotic segregation function of the NC DNA and represent examples of stable mammalian MiCs lacking centromeric repeats.

Linkage disequilibrium of a type 1 diabetes susceptibility locus with a regulatory IL12B allele.

Type 1 diabetes (T1D; or insulin-dependent diabetes mellitus, IDDM) is an autoimmune disease with both genetic and environmental components. In addition to the human leukocyte antigen (HLA) complex, the single major genetic contributor of susceptibility, an unknown number of other unidentified genes are required to mediate disease. Although many loci conferring susceptibility to T1D have been mapped, their identification has proven problematic due to the complex nature of this disease. Our strategy for finding T1D susceptibility genes has been to test for human homologues of loci implicated in diabetes-prone NOD (non-obese diabetic) mice, together with application of biologically relevant stratification methods. We report here a new susceptibility locus, IDDM18, located near the interleukin-12 (IL-12)p40 gene, IL12B. Significant bias in transmission of IL12B alleles was observed in affected sibpairs and was confirmed in an independent cohort of simplex families. A single base change in the 3' UTR showed strong linkage disequilibrium with the T1D susceptibility locus. The IL12B 3' UTR alleles showed different levels of expression in cell lines. Variation in IL-12p40 production may influence T-cell responses crucial for either mediating or protecting against this and other autoimmune diseases.

Cloning and characterization of the genes encoding the ankyrin repeat and SOCS box-containing proteins Asb-1, Asb-2, Asb-3 and Asb-4.

Members of the suppressor of cytokine signalling (SOCS) family of proteins have been shown to inhibit cytokine signalling via direct interactions with JAK kinases or activated cytokine receptors. In addition to their novel amino-terminal regions and SH2 domains that mediate these interactions, the SOCS proteins also contain carboxy-terminal regions of homology called the SOCS box. The SOCS box serves to couple SOCS proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Several other families of proteins also contain SOCS boxes but differ from the SOCS proteins in the type of domain or motif they contain upstream of the SOCS box. We report here the cloning, characterization, mapping and expression analysis of four members of the ankyrin repeat and SOCS box-containing (Asb) protein family.

Initiation of apoptosis by granzyme B requires direct cleavage of bid, but not direct granzyme B-mediated caspase activation.

The essential upstream steps in granzyme B-mediated apoptosis remain undefined. Herein, we show that granzyme B triggers the mitochondrial apoptotic pathway through direct cleavage of Bid; however, cleavage of procaspases was stalled when mitochondrial disruption was blocked by Bcl-2. The sensitivity of granzyme B-resistant Bcl-2-overexpressing FDC-P1 cells was restored by coexpression of wild-type Bid, or Bid with a mutation of its caspase-8 cleavage site, and both types of Bid were cleaved. However, Bid with a mutated granzyme B cleavage site remained intact and did not restore apoptosis. Bid with a mutation preventing its interaction with Bcl-2 was cleaved but also failed to restore apoptosis. Rapid Bid cleavage by granzyme B (<2 min) was not delayed by Bcl-2 overexpression. These results clearly placed Bid cleavage upstream of mitochondrial Bcl-2. In granzyme B-treated Jurkat cells, endogenous Bid cleavage and loss of mitochondrial membrane depolarization occurred despite caspase inactivation with z-Val-Ala-Asp-fluoromethylketone or Asp-Glu-Val-Asp-fluoromethylketone. Initial partial processing of procaspase-3 and -8 was observed irrespective of Bcl-2 overexpression; however, later processing was completely abolished by Bcl-2. Overall, our results indicate that mitochondrial perturbation by Bid is necessary to achieve a lethal threshold of caspase activity and cell death due to granzyme B.

Mass spectrometry and immobilized enzymes for the screening of inhibitor libraries.

A technique has been developed to rapidly screen enzyme inhibitor candidates from complex mixtures, such as those created by combinatorial synthesis. Inhibitor libraries are screened by using immobilized enzyme technologies and electrospray ionization ion cyclotron resonance mass spectrometry. The library mixture is first sprayed into the mass spectrometer, and compounds are identified. The library is subsequently incubated with the immobilized enzyme of interest under the correct conditions (buffer, pH, temperature) by using an excess of enzyme to ensure a surplus of sites for ligand binding. The immobilized enzyme/inhibitor mixture is centrifuged, and an aliquot of supernatant is again analyzed by electrospray ionization mass spectrometry. Potential inhibitors are quickly identified by comparison of the spectra before and after incubation with the immobilized enzyme. Non-inhibitors show no change in ion intensity after incubation, whereas weak inhibitors exhibit a visible decrease in ion abundance. Once inhibitor candidates have been identified, the library is reinjected into the mass spectrometer, and tandem mass spectrometry is used to determine the structure of the inhibitor candidates as needed. This method has been successfully demonstrated by identifying inhibitors of the enzymes pepsin and glutathione S-transferase from a 19- and 17-component library, respectively. It is further shown that the immobilized enzyme can be recycled and reused for continuous screening of additional new libraries without adding additional enzyme.

Mass spectral characterization of lipooligosaccharides from Haemophilus influenzae 2019.

Lipooligosaccharide (LOS) glycoforms from Haemophilus influenzae 2019 were profiled using the high-resolution and accurate mass capabilities of Fourier transform ion cyclotron resonance (FT-ICR) mass spectrometry. Sequence and linkage for two previously unknown LOS glycoforms were subsequently obtained through MSn analyses on FT-ICR and quadrupole ion trap (qIT) instruments. MSn analysis of negative ion precursors confirmed structural details within the lipid moiety, while CID spectra of sodiated precursor ions provided monosaccharide sequence and linkage for the oligosaccharide portion of the molecule. Results obtained in this study indicate that extensive heterogeneity exists within the oligosaccharide moieties in LOS from H. influenzae 2019. More importantly, the data suggest that additional hexose moieties, which are added onto the LOS, are not simple extensions of one particular core structure but rather that structural isomers with different connectivities are present within the heterogeneous mixture.

Combined partial acid hydrolysis and electrospray ionization-mass spectrometry for the structural determination of oligosaccharides.

A general oligosaccharide acid hydrolysis method, amenable to electrospray ionization mass spectrometry (ESI-MS), is described that allows for hydrolysis of glycosidic bonds for both hexose- and N-acetylhexosamine-containing oligosaccharides. The partial acid hydrolysis of oligosaccharides is obtained by using an acid-exchange resin as the acid catalyst. A ladder sequence of the glycan is produced in solution that is directly analyzed by ESI tandem mass spectrometry, employing both ion trap and Fourier transform ion cyclotron resonance mass spectrometers, to provide sequence and linkage information. Unlike traditional acid hydrolysis procedures, there is minimal degradation of monosaccharide residues or deacetylation of N-acetylhexosamines by employing this technique. It is further demonstrated that the stereochemistry of the released monosaccharides and the anomeric configuration within disaccharides is determined by direct derivatization of the hydrolysate with Zn(dien)-Cl2 followed by ESI-MS/MS.

The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: further evidence for epigenetic modification.

We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has indicated that the 80-kb neocentromere (NC) DNA has a similar overall organization to the corresponding region on a normal chromosome 10 (HC) DNA, derived from a genetically unrelated CEPH individual. Here we report sequencing of the HC DNA and its comparison to the NC sequence. Single-base differences were observed at a maximum rate of 4.6 per kb; however, no deletions, insertions, or other structural rearrangements were detected. To investigate whether the observed changes, or subsets of these, might be de novo mutations involved in neocentromerization (i.e., in committing a region of a chromosome to neocentromere formation), the progenitor DNA (PnC) from which the NC DNA descended, was cloned and sequenced. Direct comparison of the PnC and NC sequences revealed 100% identity, suggesting that the differences between NC and HC DNA are single nucleotide polymorphisms (SNPs) and that formation of the 10q25.2 NC did not involve a change in DNA sequence in the core centromere protein-binding NC region. This is the first study in which a cloned NC DNA has been compared directly with its inactive progenitor DNA at the primary sequence level. The results form the basis for future sequence comparison outside the core protein-binding domain, and provide direct support for the involvement of an epigenetic mechanism in neocentromerization.

Complete primary structure, chromosomal localisation, and definition of polymorphisms of the gene encoding the human interleukin-12 p40 subunit.

Owing to the importance of interleukin (IL)-12 in regulating immune responses, we have determined the complete genomic sequence and organization of the gene encoding its p40 subunit. The genomic sequence was determined and was compared to cDNA sequences to derive exon/intron boundaries. Unusually, both the first and last of the eight exons of this gene are not translated. An extensive search identified several polymorphisms in IL-12p40, including repeat elements in introns 2 and 4 and a polymorphic Taql site in the 3'UTR. However, no polymorphisms were found which could result in amino acid substitutions. This finding places constraints on any preferential involvement of alleles of IL-12p40 in contributing to autoimmune, inflammatory or infectious diseases.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Fragmentation reactions in the mass spectrometry analysis of neutral oligosaccharides.

A method is described to obtain multicollision dissociation threshold (MCDT) values. These values provide relative reaction thresholds for dissociation in the three major gas-phase fragmentation reactions of oligosaccharides complexed to alkali metal ions. The quasimolecular ions are produced using matrix-assisted laser desorption/ionization Fourier transform mass spectrometry. The MCDTs for alkali metal ion dissociation and glycosidic bond and cross-ring cleavages were resolved from the kinetic energy dependence of collision-induced dissociation (CID) products. The relative strengths of alkali metal ion binding to N,N'-diacetylchitobiose (chitobiose) and N,N',N"-triacetylchitotriose (chitotriose) were probed using sustained off-resonance irradiation (SORI) CID. Experiments to evaluate MCDT values and the method for obtaining them were performed by studying alkali metal ion coordinated crown ethers. Molecular dynamic simulations were also performed to provide insight into the alkali metal ion binding of chitin-based oligosaccharides. The relative dissociation thresholds of glycosidic bond cleavages and cross-ring cleavages were determined for various alkali metal ion coordinated oligosaccharides. The activation barriers of glycosidic bond cleavages were found to depend on the size of the alkali metal ion. Cross-ring cleavages were found to be independent of the alkali metal ion but dependent on linkage type. The results suggest that glycosidic bond cleavages are charge-induced while cross-ring cleavages are charge-remote processes.

Sequence analysis of an 80 kb human neocentromere.

We previously described the cloning of an 80 kb DNA corresponding to the core protein-binding domain of a human chromosome 10-derived neocentromere. Here we report the complete sequence of this DNA (designated NC DNA) and its detailed structural analysis. The sequence is devoid of human centromeric alpha-satellite DNA and the pericentric beta- and gamma-satellites, the ATRS and 48 bp repeat DNA. One copy of a sequence that is related to the CENPB box motif is present, and a number of copies of other pericentric sequences including pJalpha and classical satellites I and III are present but both their relative sparsity and non-tandem organization suggest that each sequence, on its own, is unlikely to mimic any role the sequence may have in the normal centromere. The DNA-binding motifs of the architectural and regulatory proteins HMGI and topoII have a normal abundance and random distribution, implying that these sequences are not key functional elements. The total A + T content of the sequence is not notably different from that of the human genome, but an abundance of AT-rich islands and a biased distribution of these islands within the NC sequence are clearlydiscernible and may be functionally significant. Substantial amounts of transposable elements and low copy number tandem repeats, including several that are highly AT- and purine-rich, are also present and may act as functional elements. One of the AT-rich tandemrepeats (AT28) may form interesting structures and is described in detail. The defined features show only a loose resemblance to the structures of known centromeres, highlighting the possibility that, rather than a conserved primary sequence, it is the overallcomposition and distribution patterns of various unknown functional elements, or any 'ordinary' DNA under appropriate epigenetic influences, that determine centromere formation and function. This is the firstdetailed analysis of a neocentromere DNA and provides a basis for comparison against future sequences.

Anion dopant for oligosaccharides in matrix-assisted laser desorption/ionization mass spectrometry.

A new anion dopant for oligosaccharides is developed for use in matrix-assisted laser desorption/ionization mass spectrometry. Two types of sulfate-attached quasimolecular ions are formed in the negative ion mode when neutral oligosaccharides are doped with dilute H2SO4 solutions. Under mild conditions, i.e., low H2SO4 concentration (approximately 10(-3) M) and threshold laser fluence, a sulfate adduct [M + HSO4]- is formed. With more concentrated H2SO4 solutions (approximately 10(-2) M) and higher laser fluence, in situ derivatization of the oligosaccharides occurs to produce an ion whose m/z corresponds to a sulfate derivative [M + HSO4 - H2O]-. Hydrogen sulfate appears to be a general anion dopant because it forms complexes with a wide variety of neutral oligosaccharides. Conversely, anionic oligosaccharides form neither the adduct nor the derivative. The combination of complex formation (with neutral oligosaccharides) and the deprotonation of acidic oligosaccharides allows simultaneous detection of the respective mixture.

Oceanapiside, an antifungal bis-alpha,omega-amino alcohol glycoside from the marine sponge Oceanapia phillipensis.

The structure of oceanapiside, an antifungal alpha, omega-bis-aminohydroxylipid glycoside from the temperate marine sponge Oceanapia sp., was elucidated by a combination of 2D NMR, chemical degradation/correlation, and MALDI MS-MS spectrometry. Oceanapiside exhibits antifungal activity against Candida glabrata at 10 micrograms/mL (MIC).

Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.

CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.

Direct cloning of human 10q25 neocentromere DNA using transformation-associated recombination (TAR) in yeast.

The transformation-associated recombination (TAR) procedure allows rapid, site-directed cloning of specific human chromosomal regions as yeast artificial chromosomes (YACs). The procedure requires knowledge of only a single, relatively small genomic sequence that resides adjacent to the chromosomal region of interest. We applied this approach to the cloning of the neocentromere DNA of a marker chromosome that we have previously shown to have originated through the activation of a latent centromere at human chromosome 10q25. Using a unique 1.4-kb DNA fragment as a "hook" in TAR experiments, we achieved single-step isolation of the critical neocentromere DNA region as two stable, 110- and 80-kb circular YACs. For obtaining large quantities of highly purified DNA, these YACs were retrofitted with the yeast-bacteria-mammalian-cells shuttle vector BRV1, electroporated into Escherichia coli DH10B, and isolated as bacterial artificial chromosomes (BACs). Extensive characterization of these YACs and BACs by PCR and restriction analyses revealed that they are identical to the corresponding regions of the normal chromosome 10 and provided further support for the formation of the neocentromere within the marker chromosome through epigenetic activation.

Alkaline degradation of oligosaccharides coupled with matrix-assisted laser desorption/ionization Fourier transform mass spectrometry: a method for sequencing oligosaccharides.

A new technique for determining sequence and linkage information of underivatized oligosaccharides is developed using alkaline degradation and matrix-assisted laser desorption/ionization Fourier transform mass spectrometry (MALDI-FTMS). Alkaline degradation (also known as the "peeling" reaction) is a chemical degradation technique that only cleaves the glycosidic bond at the reducing end by beta-elimination to yield a new reducing end. The reaction products are sampled directly with minimal cleanup and monitored by MALDI-FTMS to elucidate the oligosaccharide sequence. Linkage information is provided by cross-ring cleavage fragmentation of the new reducing ends, created by either MALDI source fragmentation or sustained off-resonance irradiation collision-induced dissociation. This method is illustrated by the successful sequence and linkage determination of neutral, branched, fucosylated, and sialylated oligosaccharides. Experiments on differently linked disaccharides are also performed to determine the specificity of the cross-ring cleavage reactions. The power of this technique is enhanced by the Fourier transform mass analyzer, which provides high-resolution, exact mass, and facile tandem mass spectrometry experiments of MALDI-produced ions.

Specific isolation of human rDNA genes by TAR cloning.

Selective cloning of human DNA in YACs from monochromosomal human/rodent hybrid cells lines and radiation hybrids can be accomplished by transformation-associated recombination (TAR) between Alu-containing vector(s) and human DNA in yeast. We have expanded this approach to the specific isolation of repetitive genes from the human genome. Highly selective isolation of human rDNA was accomplished using total human DNA and a pair of differentially marked linear TAR cloning vectors where one contained a small fragment of a human rDNA repeat and the other had an Alu repeat as targeting sequences. About half the transformants that acquired both vectors markers had YACs with human rDNA inserts. These results suggest that TAR can be applied to the general isolation of gene families and amplified region from genomic DNAs.