First report of cucumber green mottle mosaic virus infecting Cynanchum rostellatum in China.

Cucumber green mottle mosaic virus (CGMMV) was first discovered on cucumber in the United Kingdom in 1935 (Ainsworth, 1935), and has spread worldwide except to Antarctica (Jones, 2021). Given its extensive damage, it is considered an important pathogen on global cucurbit plants and fruit crops. In China, CGMMV was first reported on pumpkin in Guangxi Province in 2003 (Qin et al., 2005), and occurred on 34 plants species across 23 provinces (Liu et al., 2016). Cynanchum rostellatum is a member of the family Apocynaceae. In July 2021, leaves of C. rostellatum exhibiting virus-like symptoms (yellowing, severe crinkling, deformation) were observed and collected in Liaoning Province, China. Aphids were also observed on the leaves and stems (Fig. S1) of the plants and were collected. Total RNA was extracted from diseased leaves following the CTAB method, followed by the depletion of ribosomal RNAs (rRNA) with TIANSeq rRNA Depletion Kit (Tiangen, China). The RNAs were, then processed into a DNBSEQ LncRNA-Seq library, and sequenced on the MGISEQ-2000 platform at BGI Genomics (Wuhan, China). A total of 106.98 M clean reads were obtained after data filtering using SOAPnuke software (BGI, China). The clean reads were assembled into contigs using CLC Genomics Workbench 11 (Qiagen, USA) and Trinity v2.0.6 (Haas et al., 2013). A contig (4,760 reads, average coverage:73.76) of 6,391 nucleotides was found to share the highest sequence identity (99.83%) with CGMMV isolate GDLZ (MK933286), irrespective of other virus-like contigs related to Polerovirus and Totivirus. Based on the genome of GDLZ isolate, seven specific primers (Table S1) were designed to amplify the full viral genomic sequences using a PrimeScriptTM One-Step RT-PCR Kit. Seven expected amplicons were obtained, cloned, and sequenced. The complete genome was determined to be 6,423 nucleotides (GenBank accession number OR854819) in length and designated as LNMJ isolate. LNMJ shared 96.8%-99.7% nucleotide sequence identities with CGMMV isolates from China. Phylogenetic analysis based on the complete genome sequences showed that LNMJ clustered together with CGMMV isolates hn (GenBank accession number KC851866), GDLZ (GenBank accession number MK933286), and JD8 (GenBank accession number KM873784) from China. The specific primers LM-TJ-3F/3R were designed to determine the virus-symptom association for LNMJ, and all twelve symptomatic C. rostellatum plants collected from fields tested positive for LNMJ. Two out of six randomly selected aphids from the diseased plants also tested positive. To further prove its infectivity, LNMJ was inoculated mechanically onto ten healthy Nicotiana benthamiana plants, and the results indicated a high infection rate of 80% (8/10), at 30 days post-inoculation despite no distinct symptoms observed. To our knowledge, this is the first report of the natural infection of C. rostellatum plants with CGMMV. C. rostellatum is a widespread herb in China (Wei et al., 2019) and more surveys are needed to determine the distribution of CGMMV. The habitats of C. rostellatum span diverse agroecological zones, and thus our study underscores the potential spillover of CGMMV to neighboring crops as a significant risk.

The complete genome sequence of a putative novel cytorhabdovirus identified in Chelidonium majus in China.

A new cytorhabdovirus, tentatively named "chelidonium yellow mottle associated virus" (CheYMaV), was identified in Chelidonium majus with yellow mottle symptoms by high-throughput sequencing and RT-PCR. Its genome is 12,121 nucleotides in length and contains eight open reading frames (ORFs) in the order 3'-N-P'-P-P3-M-G-P6-L-5'. Amino acid sequence comparisons between the putative proteins of CheYMaV and the corresponding proteins of other cytorhabdoviruses showed that it shares the highest sequence similarity with Trifolium pratense virus A (TpVA, MH982250) and Glehnia littoralis virus 1 (GllV1, BK014304), but with sequence identity values below the species demarcation threshold for cytorhabdoviruses (< 80%). Phylogenetic analysis showed that CheYMaV is most closely related to TpVA and GllV1. CheYMaV should therefore be considered a new member of the genus Cytorhabdovirus. This is the first report of a cytorhabdovirus identified in Chelidonium majus.

Conserved untranslated regions of multipartite viruses: Natural markers of novel viral genomic components and tags of viral evolution.

Viruses with split genomes are classified as being either segmented or multipartite based on whether their genomic segments occur within a single virion or across different virions. Despite variations in number and sequence during evolution, the genomic segments of many viruses are conserved within the untranslated regions (UTRs). In this study, we present a methodology that combines RNA sequencing with iterative BLASTn of UTRs (https://github.com/qq371260/Iterative-blast-v.1.0) to identify new viral genomic segments. Some novel multipartite-like viruses related to the phylum Kitrinoviricota were annotated using sequencing data from field plant samples and public databases. We identified potentially plant-infecting jingmen-related viruses (order Amarillovirales) and jivi-related viruses (order Martellivirales) with at least six genomic components. The number of RNA molecules associated with a genome of the novel viruses in the families Closteroviridae, Kitaviridae, and Virgaviridae within the order Martellivirales reached five. Several of these viruses seem to represent new taxa at the subgenus, genus, and family levels. The diversity of novel genomic components and the multiple duplication of proteins or protein domains within single or multiple genomic components emphasize the evolutionary roles of genetic recombination (horizontal gene transfer), reassortment, and deletion. The relatively conserved UTRs at the genome level might explain the relationships between monopartite and multipartite viruses, as well as how subviral agents such as defective RNAs and satellite viruses can coexist with their helper viruses.

First report of Hibiscus latent Singapore virus and Hibiscus latent Fort Pierce virus infecting Lantana camara in China.

Hibiscus latent Singapore virus (HLSV) and Hibiscus latent Fort Pierce virus (HLFPV) both belong to the genus Tobamovirus in the family Virgaviridae. The genomes of both HLSV and HLFPV consist of a linear positive sense single-stranded RNA of about 6.3 kb. HLSV is the causal agent of hibiscus leaf crinkle disease. Infections of HLSV in hibiscus (Hibiscus rosa-sinensis) have so far only been reported in Singapore, Japan and Malaysia (Srinivasan et al., 2002; Yoshida et al., 2018; Yusop et al., 2021). In 2017, leaf curling and chlorosis symptoms of lantana (Lantana camara) plants were found in Chenshan Botanical Garden, Shanghai, China. To detect potential virus(es) in these lantana samples, leaves from one lantana plant were collected and total RNA was extracted with RNAiso Plus (TaKaRa). A cDNA library was prepared by TruSeq RNA Sample Prep Kit (Illumina) after removing ribosomal RNA by Ribo-ZeroTM rRNA Removal Kit (Epicentre). The paired-end sequencing was then performed on an Illumina NovaSeq 6000. A total of 61,085,018 high quality reads were obtained and de novo assembly by StringTie revealed 124,516 contigs (greater than 50 bp, N50=719 bp) with an average length of 537 bp. BLASTx analyses in the National Center for Biotechnology Information (NCBI) database showed that 1 long contig of 6,305 bp, assembled of 1794 clean reads, shared significant nucleotide similarities with the genomic sequence of HLSV, and 1 contig of 6,271 bp, assembled of 3174 clean reads, shared significant similarities with the genomic sequence of HLFPV, yielding an average coverage of the whole genome at 42.65 and 75.83 per million reads, respectively. To obtain the complete genome of the viral RNA in this lantana sample, eleven overlapping regions covering the entire HLSV viral genome, and nine overlapping regions covering the entire HLFPV viral genome were amplified by reverse transcription-PCR (RT-PCR) and sequenced. In addition, the exact 5' and 3' ends of the genomic RNA of each virus were determined by rapid amplification of the cDNA ends (RACE) (Wang et al. 2020). The complete genome of the identified HLSV, deposited in GenBank: MZ020960, is 6,486 nt in length and shows 98.4% nucleotide sequence identity with HLSV Singapore isolate (GenBank: AF395898). Similar to other HLSV isolates, this virus isolate possesses an internal poly(A) tract of 87 nucleotides, which is crucial to virus replication (Niu et al., 2015). The complete genome of the Lantana HLFPV isolate is 6,463 nt (GenBank MZ020961) including a 73 nt internal poly(A) tract, and has 98.4% nt identity to HLFPV-Japan (AB917427). In two other lantana plants from the same site, the presence of HLSV and HLFPV was confirmed by RT-PCR using the primer pairs (5'-GCATCTGCATAACACGGTTG-3'/5'-ACGTTGTAGTAGACGTTGTTGTAG-3' and 5'-GGACCTTGCTAATCCGCTAAAGTTG-3'/5'-GGTCCATGTCCATCCAGATGCAATC-3'). In addition to the HLSV and HLFPV genomes, BLASTx analysis of three contigs of 3,006 bp, 2,845 bp and 2,200 bp, assembled of 1328, 352 and 2280 clean reads respectively, showed high identity to RNAs 1 (MG182148), 2 (DQ412731) and 3 (KY794710) of cucumber mosaic virus. To the best of our knowledge, this is the first report of L. camara as a new natural host of HLSV and HLFPV, and first identification of a mixed infection of HLSV and HLFPV.

Effects of RNA silencing during antagonism between citrus exocortis viroid and citrus bark cracking viroid in Etrog citron (Citrus medica).

Citrus exocortis viroid (CEVd) and citrus bark cracking viroid (CBCVd) are two important viroids that infect citrus plants and frequently occur as mixed infections in orchards. However, the mechanism of antagonism between the two viroids in mixed infections remains unclear. The CEVd/CBCVd-citron system and small RNA sequencing (sRNA-seq) were used to study the antagonism. When CBCVd was inoculated before CEVd, the CEVd titre was significantly reduced and the symptoms were attenuated. Viroid-derived sRNAs (vd-sRNAs) from CEVd and CBCVd were predominantly 21-nucleotide (nt) and 22-nt in length and had similar 5' base biases. Homologous sequences of the two viroids in the terminal right (TR) region are rich in vd-sRNAs, and the high frequency vd-sRNAs selected from the CBCVd TR region can be used to degrade the transcripts of CEVd in vivo directly. These results suggest that RNA silencing may play an important role in the antagonism of the two viroids, thus deepening our understanding of the molecular interaction of long noncoding RNAs in woody plants.

Detection and characterization of a putative emaravirus infecting Clematis brevicaudata DC. in China.

A novel emaravirus, tentatively named "clematis yellow mottle associated virus" (CYMaV), was identified through transcriptome sequencing and RT-PCR analysis of yellow-mottled leaf samples from Clematis brevicaudata DC. The genome of CYMaV consists of five viral RNAs: RNA1 (6591 nucleotides, nt), RNA2 (1982 nt), RNA3a (1301 nt), RNA3b (1397 nt), and RNA4 (1192 nt). The 13-nt sequences at the 5'- and 3'-termini of the CYMaV RNAs are conserved and have reverse complementary, as typically seen in emaraviruses. The proteins encoded by CYMaV shared the highest amino acid sequence similarity with those of the unclassified Karaka Okahu purepure emaravirus (KOPV), with 60.2% identity in the RNA-dependent RNA polymerase (RdRp), 44.4% in the glycoprotein precursor, and 46.9% in the nucleocapsid protein. A phylogenetic tree based on amino acid sequences of the RdRp revealed that CYMaV is most closely related to KOPV and clusters with ChMaV (chrysanthemum mosaic-associated virus, LC576445) and PCLSaV (pear chlorotic leaf spot-associated virus, MK602177) in one distinct clade. Transmission electron microscopy observation of negatively stained samples from C. brevicaudata revealed spherical virus-like particles (VLPs) approximately 100 nm in diameter. Five primers, specific for each viral RNA, were used to detect CYMaV in 11 symptomatic and two asymptomatic C. brevicaudata samples, but the results failed to show a consistent association of viral infection with symptoms. CYMaV can be considered a putative new member in the genus Emaravirus, and this marks the first report of an emaravirus found infecting C. brevicaudata plants.

The Identification of Viral Pathogens in a Physostegia virginiana Plant Using High-Throughput RNA Sequencing.

Physostegia virginiana is an important ornamental and cut-flower plant in China. Its commonly used method of clonal propagation leads to virus accumulation in this plant. However, which viruses can infect the Physostegia virginiana plant remains to be illuminated. In this work, five viral pathogens in a Physostegia virginiana plant with virus-like symptoms of yellow, shriveled, and curled leaves were identified using RNA-seq, bioinformatics, and molecular biological techniques. These techniques allowed us to identify five viruses comprising one known alfalfa mosaic virus (AMV) and four novel viruses. The novel viruses include a virus belonging to the genus Fabavirus, temporarily named Physostegia virginiana crinkle-associated virus 1 (PVCaV1); two viruses belonging to the genus Caulimovirus, temporarily named Physostegia virginiana caulimovirus 1 and 2 (PVCV1 and PVCV2); and a virus belonging to the genus Fijivirus, temporarily named Physostegia virginiana fijivirus (PVFV). The genome sequences of PVCaV1, PVCV1, and PVCV2, and the partial genome sequence of PVFV were identified. Genome organizations and genetic evolutionary relationships of all four novel viruses were analyzed. PVCaV1 has a relatively close evolutionary relationship with five analyzed fabiviruses. PVCV1 and PVCV2 have separately a closest evolutionary relationship with lamium leaf distortion-associated virus (LLDAV) and figwort mosaic virus (FMV), and PVFV has a close evolutionary relationship with the five analyzed fijiviruses. Additionally, PVCaV1 can infect Nicotiana benthamiana plants via friction inoculation. The findings enrich our understanding of Physostegia virginiana viruses and contribute to the prevention and control of Physostegia virginiana viral diseases.

Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota).

In April 2023, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by one new family, 14 new genera, and 140 new species. Two genera and 538 species were renamed. One species was moved, and four were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

Molecular characterization of a novel amalgavirus infecting lilium spp. in China.

A novel plant virus with a double-stranded (ds) RNA genome was detected in Lilium spp. in China by high-throughput sequencing and tentatively named "lily amalgavirus 2" (LAV2). The genomic RNA of LAV2 is 3432 nucleotides (nt) in length and contains two open reading frames (ORFs) that putatively encode a '1 + 2' fusion protein of 1053 amino acids (aa), generated by a '+1' programmed ribosomal frameshift (PRF). ORF1 encodes a putative 386-aa protein of unknown function, and ORF2 overlaps ORF1 by 350 nt and encodes a putative 783-aa protein with conserved RNA-dependent RNA polymerase (RdRp) motifs. The '+1' ribosomal frameshifting motif, UUU_CGN, which is highly conserved among amalgaviruses, is also found in LAV2. Sequence analysis showed that the complete genome shared 46.04%-51.59% nucleotide sequence identity with those of members of the genus Amalgavirus and had the most similarity (51.59% sequence identity) to lily amalgavirus 1 (accession no. OM782323). Phylogenetic analysis based on RdRp amino acid sequences showed that LAV2 clustered with members of the genus Amalgavirus. Overall, our data suggest that LAV2 is a new member of the genus Amalgavirus.

Viromic approach reveals differences in the composition, diversity and relative abundance of pumpkin viruses across main growing regions of China.

China is the leading country for pumpkin production in the world. As other cucurbits, diseases caused by viruses are among the serious threats to pumpkin production, but our knowledge on the virus species infecting pumpkin plants is fragmentary. To understand the occurrence of viral diseases on pumpkin, we determined the geographical distribution characteristics, relative abundance and evolutionary relationship of pumpkin infected viruses by meta-transcriptome sequencing (RNA-seq) and viromic analysis of 159 samples exhibited typical viral symptoms collected across China in this study. Totally, 11 known and 3 new viruses were identified. Interestingly, 3 new viruses identified in this study should be positive-sense single-stranded RNA virus whose hosts are prokaryotes. The viruses identified in different sampling locations exhibit significant variations in term of virus species and relative abundance. Here, the results provide valuable information for understanding the virus species and their diversity in cultivated pumpkin across major growing regions of China.

Identification and molecular characterization of a novel cytorhabdovirus from rose plants (Rosa chinensis Jacq.).

A novel negative-sense single-stranded RNA virus, tentatively named "rose-associated cytorhabdovirus" (RaCV), was identified by high-throughput sequencing. RaCV is 16,067 nucleotides in length and contains eight open reading frames (ORFs 1-8) encoding a nucleocapsid protein (N), a putative phosphoprotein (P), a putative P3 protein (P3), a putative P4 protein (P4), a putative matrix protein (M), a glycoprotein (G), a putative P7 protein (P7), and an RNA-dependent RNA polymerase (L), respectively. The coding genes are flanked by a 3' leader sequence (228 nt) and a 5' trailer sequence (251 nt) and are separated by conserved intergenic junctions (3'-AUUCUUUUUG(N)nCUN-5'). Phylogenetic analysis showed that RaCV clustered with yerba mate virus A (YmVA) within the cytorhabdovirus clade, and it exhibited low a degree of nt sequence similarity (<40% identity) to other rhabdoviruses. Amino acid sequence comparisons between the putative proteins of RaCV and the corresponding proteins of other cytorhabdoviruses showed that the sequence identity levels were far below the species demarcation cutoff of 80% for cytorhabdoviruses. These results suggest that RaCV should be classified as a new member of the genus Cytorhabdovirus.

Characterization of a putative novel higrevirus infecting Phellodendron amurense Rupr. in China.

Phellodendron-associated higre-like virus (PaHLV) was identified in Phellodendron amurense Rupr. in China. Three near-full-length sequences of the viral genomic RNAs (RNA1-RNA3) were first obtained by RNA-seq, and their complete sequences were then determined by RT-PCR, 5'-RACE, and 3'-RACE. RNA1-3 of PaHLV were determined to be 8,183, 3,062, and 3,998 nucleotides (nt) in length, respectively, excluding the poly(A) tail. All of the viral proteins encoded by PaHLV shared the highest amino acid sequence identity (44.8-78.1%) with the unclassified kitavirid pistachio virus X (PiVX, MT334618-MT334620) from Iranian pistachio. Sequence comparisons and phylogenetic analysis also showed PiVX to be the closest relative of PaHLV and supported their inclusion in the genus Higrevirus, family Kitaviridae. Thus, PaHLV is proposed to be a member of a new species in this genus, for which we suggest the binomial name "Higrevirus amur".

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

Mixed infection of an emaravirus, a crinivirus, and a begomovirus in Pueraria lobata (Willd) Ohwi.

Pueraria lobata (Willd) (Pueraria montana var. lobata (Willd.) Maesen & S. M. Almeida ex Sanjappa & Predeep) is an important herbal medicine used in many countries. In P. lobata plants showing symptoms of mosaic, yellow spots, and mottling, mixed infection of new viruses provisionally named Pueraria lobata-associated emaravirus (PloAEV, genus Emaravirus), Pueraria lobata-associated crinivirus (PloACV, genus Crinivirus), and isolate CQ of the previously reported kudzu mosaic virus (KuMV-CQ, genus Begomovirus) was confirmed through high-throughput sequencing. PloAEV has five RNA segments, encoding a putative RNA-dependent RNA polymerase, glycoprotein precursor, nucleocapsid protein, movement protein, and P5, respectively. PloACV has two RNA segments, encoding 11 putative proteins. Only PloAEV could be mechanically transmitted from mixed infected symptomatic kudzu to Nicotiana benthamiana plants. All three viruses were detected in 35 symptomatic samples collected from five different growing areas, whereas no viruses were detected in 21 non-symptomatic plants, suggesting a high association between these three viruses. Thus, this study provides new knowledge on the diversity and molecular characteristics of viruses in P. lobata plants affected by the viral disease.

Complete genome sequence of Edgeworthia chrysantha mosaic-associated virus, a tentative new member of the genus Coguvirus (family Phenuiviridae).

A new negative-strand RNA (nsRNA) virus genome was discovered in Edgeworthia chrysantha Lindl. This virus, tentatively named "Edgeworthia chrysantha mosaic-associated virus" (ECMaV), has a bipartite genome that comprises (i) a nsRNA1, encoding the viral RNA-dependent RNA polymerase (RdRp), and (ii) an ambisense RNA2, coding for the putative movement protein (MP) and nucleocapsid protein (NP), with the open reading frames separated by a long AU-rich intergenic region (IR). Sequence comparisons and phylogenetic analysis showed that the RdRp is closely related to those of other recently discovered plant-infecting nsRNA viruses in the new genus Coguvirus and that ECMaV can be classified as a member of a novel species.

A putative new emaravirus isolated from Ailanthus altissima (Mill.) Swingle with severe crinkle symptoms in China.

A putative new emaravirus, named "ailanthus crinkle leaf-associated emaravirus" (ACrLaV), was detected in Ailanthus altissima with severe crinkle symptoms by RNA-Seq and RT-PCR. Four viral segments associated with ACrLaV were identified and fully sequenced, except for a few nucleotides at the genomic termini. The RNA-dependent RNA polymerase (RNA1), glycoprotein (RNA2), nucleocapsid protein (RNA3), and movement protein (RNA4), showed 26.5%-57%, 17%-49.9%, 14.4%-40.4%, and 14.1%-65.9% amino acid sequence identity, respectively, to those of known emaraviruses. All four ACrLaV genomic RNA segments are most closely related to those of common oak ringspot-associated virus from Germany, as supported by sequence comparisons and phylogenetic analysis. ACrLaV is considered a distinct member of the genus Emaravirus, and this is the first report of an emaravirus in A. altissima.