Clinical Manifestations and Gene Expression in Patients with Conventional Papillary Thyroid Carcinoma Carrying the BRAF(V600E) Mutation and BRAF Pseudogene.

BACKGROUND: The association of BRAF(V600E) with the clinical manifestations of papillary thyroid carcinoma (PTC) remains controversial. Recent studies have shown that the BRAF pseudogene can activate the MAPK pathway and induce tumorigenesis. This study investigated the association of BRAF(V600E), the BRAF pseudogene, and their mRNA levels with clinical features and thyroid-specific gene expression in conventional PTCs. MATERIALS AND METHODS: A total of 78 specimens were collected from patients with conventional PTCs. RNA was isolated, and quantitative polymerase chain reaction was used to measure the mRNA levels of BRAF, the BRAF pseudogene, and thyroid-specific and tumor-related genes. Immunohistochemical (IHC) staining of BRAF, ERK, sodium-iodide symporter (NIS), thyrotropin receptor, glucose transporter 1, and Ki67 was also performed. RESULTS: BRAF(V600E) and the BRAF pseudogene were detected in 73.0% (57/78) and 91.7% (44/48), respectively, of the conventional PTCs. The presence of BRAF(V600E) was not associated with the multiple clinical features assessed or the recurrence rate during 76.9 ± 47.2 months of follow-up. Neither was it associated with IHC staining or tumor-related/thyroid-specific gene expression, except for decreased NIS gene expression. The BRAF pseudogene was not associated with clinical characteristics or thyroid-specific gene expression, except for decreased decoy receptor 3 (DCR3) expression. High BRAF mRNA levels were associated with bilateral and multifocal lesions, and BRAF-pseudogene mRNA levels were positively correlated with BRAF mRNA levels (r = 0.415, p = 0.009). CONCLUSION: These results do not support the use of the BRAF(V600E) mutation as a prognostic marker of conventional PTC. However, the association of high BRAF mRNA levels with more advanced clinical features suggests that BRAF mRNA levels might be a more useful clinical marker of PTCs, independent of the BRAF(V600E) mutation status. The correlation between BRAF-pseudogene mRNA levels and BRAF mRNA levels in PTCs is in agreement with the hypothesis that the BRAF pseudogene regulates BRAF expression during tumorigenesis by acting as competitive noncoding RNA. However, additional studies with larger sample sizes are required to confirm these findings.

Iodine status of adults in Taiwan 2005-2008, 5 years after the cessation of mandatory salt iodization.

BACKGROUND/PURPOSE: Iodine deficiency causes a broad spectrum of disorders across all ages. Mandatory salt iodization in Taiwan successfully reduced the goiter rate from 21.6% to 4.3% in schoolchildren surveyed in 1971. The program continued until 2003 when salt iodization was changed from mandatory to voluntary. The purpose of this study was to investigate the iodine status of Taiwanese individuals after the change in the iodine policy. METHODS: Urinary iodine (UI) was measured in samples from adults in the Nutrition and Health Survey in Taiwan 2005-2008. RESULTS: The median UI level was 100 µg/L, and the percentage of populations with UI levels below 100 µg/L and 50 µg/L was 50.1% and 15.1%, respectively, indicating that the iodine status was borderline adequate. Men had a higher UI level than women (102 µg/L vs. 98 µg/L, p = 0.003), and older individuals (age > 60 years) had a lower UI level than younger people, particularly in women. The iodine status of the population < 50 years was sufficient, but it was insufficient in older groups. Mild iodine insufficiency was noted in all areas of Taiwan except the Southern area and Penghu islands, with the lowest UI level of 79 µg/L in the Mountain area. Although the UI level of women of childbearing age (19-44 years) was 103 µg/L, there may be a risk of iodine deficiency during pregnancy. CONCLUSION: The iodine nutrition of the Taiwanese population in 2005-2008 was borderline adequate, with insufficiency in some subgroups. Further monitoring of the iodine status is necessary.

Iodine status of Taiwanese children before the change in national salt iodization policy: a retrospective study of the nutrition and health survey in Taiwan 2001-2002.

Taiwan was an iodine deficiency area and endemic goiter was common in 1940's. Mandatory salt iodization started in 1967, and a 1971 survey indicated that goiter rates in children decreased from 21.6% to 4.3%. To understand iodine status before the change of national salt iodization program in 2003, from mandatory to voluntary salt iodization, we retrospectively measured urinary iodine concentrations of samples collected from children in the Nutrition and Health Survey in Taiwan 2001-2002. The median UI level for children aged 6-12 years was 123 µg/L (no differences between males and females). Females aged 10-12 years had the lowest urinary iodine levels. The percentages of this population with urinary iodine levels below 100, 50, and 20 µg/L were 35.2% ± 1.0%, 4.4% ± 0.4%, and 0.2% ± 0.1%, respectively. Older children were more likely to have low urinary iodine levels. People living in different areas of Taiwan had a median urinary iodine levels ranged from 113 µg/L to 164 µg/L (males: 113-153 µg/L; females: 105-174 µg/L), with the highest level in Penghu islands, and the lowest level in the eastern and southern (Southern area 2) areas. According to international criteria, iodine status in 2001-2002 was adequate, comparable to the surveyed goiter rates (4.3%, classified as iodine sufficiency) in 1971, inferring that iodine nutrition remained adequate and stable during this period. The present study is of great importance in documenting the iodine status of Taiwan before the change from mandatory to voluntary salt iodization to serve as a baseline data for future trend analysis in iodine nutrition.

Complex karyotypes confer a poor survival in adult acute myeloid leukemia with unfavorable cytogenetic abnormalities.

Cytogenetics represents the most valuable predictor for a poor outcome in patients with acute myeloid leukemia (AML), but it encompasses a heterogeneous patient population who might have diverse pathogenesis and clinical courses. In particular, the significance of complex chromosome aberrations within this cohort has seldom been addressed before. We analyzed 48 AML patients with adverse-risk cytogenetics in this study. The complex karyotype (three or more numerical/structural cytogenetic changes; 29 patients) was found to occur more frequently among the elderly than a noncomplex adverse karyotype (19 patients; median age, 71 vs. 48; P = 0.005). The patients' performance status was the sole independent factor determining the complete remission rate among patients receiving standard induction chemotherapy. On survival analysis, two factors independently predicted a longer overall survival: noncomplex karyotypes [vs. complex karyotypes, hazard ratio (HR) 0.434, 95% confidence interval (CI) 0.189-0.994, P = 0.048] and achievement of complete remission [(CR) vs. CR not reached, HR 0.170, 95% CI 0.051-0.572, P = 0.004)]. In conclusion, among AML patients with adverse cytogenetics, complex chromosomal aberrations occurred more frequently among the elderly and predicted a poor outcome. These patients should be considered as a unique entity and be separated from those with a noncomplex adverse cytogenetic change. Exploring the underlying mechanisms of leukemogenesis could improve the therapeutic outcome for this group of patients.

Combined treatment with splenectomy and cladribine in hairy cell leukemia in Taiwan: a clinicopathologic study of 5 cases.

BACKGROUND: Hairy cell leukemia (HCL) is a rare B-cell lymphoid malignancy that is characterized by the presence of hairy cells in the peripheral blood and bone marrow, pancytopenia and various degrees of splenomegaly. Very few reports have explored the clinicopathologic features and treatment outcome of HCL in Taiwan. METHODS: Of 33 patients with malignant lymphoma who underwent splenectomy over a 10-year period (1996-2005), 5 cases of HCL were retrospectively studied. RESULTS: All cases presented with various degrees of splenomegaly. Pancytopenia was noted in 3 cases, and lymphadenopathy in 1. Typical hairy cells with positive tartrate-resistant acid phosphatase stain were noted in 2 cases. Only 3 cases could be diagnosed with HCL based solely on bone marrow findings. In contrast, all spleen specimens had characteristic pathologic features. All patients underwent splenectomy uneventfully, and cladribine was given at a median time of 2 months after splenectomy without significant side effects. Complete remission with durable response was documented in 4 patients (80%) with a median follow-up of 29 months (range, 4-96 months). The last patient experienced partial remission but was only followed up for 4 months. CONCLUSION: For the HCL patients in this study, splenectomy had a role not only in improving cytopenia but in aiding diagnosis. Cladribine is safe and highly effective for Taiwanese patients and should be considered as first-line treatment for HCL.

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.

Influence of methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, B vitamins and other factors on plasma homocysteine and risk of thromboembolic disease in Chinese.

BACKGROUND: Thromboembolic disease is a major cause of morbidity and mortality in many countries. Our previous study found that Chinese subjects carried the same polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene as described in Western studies. The aim of the present study was to determine the influence of MTHFR polymorphism, B vitamins and other factors on plasma homocysteine (Hcy) levels and risk of thromboembolic disease in Chinese. METHODS: One hundred and six subjects were enrolled into the study. They were categorized into 4 groups: healthy individuals (n = 42); those with diabetes mellitus (n = 20); those with deep vein thrombosis (DVT) (n = 11); and those with coronary artery disease (CAD) (n = 33). Plasma levels of folic acid, vitamins B6 and B12, Hcy, and fasting blood sugar were measured; total cholesterol, triglycerides, complete blood count, and 677 C-->T mutation in MTHFR were determined. RESULTS: Plasma Hcy was lowest in the healthy subjects, higher in diabetics, followed by patients with DVT, and highest in patients with CAD (p < 0.001, ANOVA). MTHFR C677T polymorphism was the common factor affecting plasma logHcy levels in all 4 groups of subjects. Triglycerides affected plasma logHcy in the CAD patients. For the 4 groups as a whole, MTHFR polymorphism, triglycerides, and vitamin B12 were the most significant factors influencing plasma Hcy. CONCLUSION: We suggest that high plasma Hcy is an important risk factor for CAD. Other factors including MTHFR polymorphism, vitamin B12, triglycerides, total cholesterol, and gender might affect Hcy levels in different diseases and conditions.

Plasma antigen levels of thrombin-activatable fibrinolysis inhibitor did not differ in patients with or without disseminated intravascular coagulation.

Thrombin-activatable fibrinolysis inhibitor (TAFI) is a carboxypeptidase that downregulates fibrinolysis and might play some roles in the pathogenesis of disseminated intravascular coagulation (DIC). We prospectively examined the plasma TAFI antigen levels in patients highly suspected to be suffering from DIC. Patients were subdivided into overt DIC and non-DIC groups according to a DIC scoring system. The Sepsis-related Organ Failure Assessment (SOFA) scores were concurrently calculated on patients with sepsis. Overall, there were 23 non-DIC patients and 20 patients with overt DIC. Their baseline characteristics were similar, but patients with overt DIC had much more aberrant coagulation tests and higher lactate dehydrogenase levels. However, there was no significant difference between overt DIC and non-DIC patients regarding their TAFI antigen levels [median/interquartile range (IQR) 74.41/13.98 and 75.29/15.16, respectively, p=0.543]. On regression analysis, TAFI antigen levels were not correlated with either C-reactive protein levels or various coagulation test results. In patients with sepsis (n=31), TAFI levels among three risk groups stratified by low (or=11) SOFA scores were not statistically disparate (median/IQR 65.24/15.14, 74.63/13.79, and 75.29/21.51, respectively, p=0.684), either. Our result indicated that plasma TAFI antigen levels did not vary significantly between patients with or without DIC. Further, they did not possess any correlation with the severity of organ injury in patients with sepsis. The role of TAFI antigen in the pathogenesis of DIC needs further elucidation by future studies.

Predictive risk factors and prevalence of malignancy in patients with iron deficiency anemia in Taiwan.

Gastrointestinal (GI) tract malignancy is one of the important causes of chronic iron deficiency anemia (IDA). The present study was designed to find out the prevalence and the predictive risk factors of malignancy in the IDA patients. We performed a prospective study in 148 patients with chronic IDA. A series of examinations to explore the GI tract were performed either by radiology and/or endoscopy. A Tc-RBC GI bleeding study was also performed, and prevalence and risk factors of malignancy were calculated. Totally 148 patients were enrolled, with mean age 66.2 years; 88 were male. Eighteen patients (12.2%) were found to have malignant tumors. Ten (6.8%) had benign tumors, and 96 (64.9%) had other benign conditions. No lesions could be detected in 24 patients (16.2%). Clinical symptoms and presence of fecal occult blood could not predict malignancy or any GI lesions. Multivariate logistic regression analysis showed serum ferritin < or =10 microg/L, LDH >250 U/L, and aging as the risk factors of malignancy in the IDA patients (P = 0.003, 0.002, and 0.027; and OR = 7.614, 8.955, and 1.062, respectively). An IDA patient with both serum ferritin < or =10 microg/L and LDH >250 U/L ran a 74.33-times higher risk of malignancy than the patient without (95% CI: 7.115-776.479). Malignancy was an important cause of IDA. High LDH, low serum ferritin, and aging were the risk factors of malignancy in the IDA patients.

Donor lymphocyte infusion induced acute hepatitis.

Hepatic graft-versus-host disease (GVHD) post allogeneic hematopoietic stem cell transplantation generally presents as cholestatic jaundice and increased serum alkaline phosphatase (ALK-P). Currently accepted standards for evaluating the clinical severity of hepatic GVHD are not based on serum aminotransferase levels but on the serum bilirubin levels. We describe a 25-year-old female who initially had no liver damage at all after an allogeneic peripheral blood stem cell transplantation (allo-PBSCT) from her HLA-indentical sister. Markedly elevated aminotransferases, without hyperbilirubinemia, however, developed 7 and 9 weeks after the first and second donor lymphocyte infusion (DLI), respectively. Liver biopsies performed in both events revealed lymphocytic infiltration of the portal tracts and pericentral necrosis of the lobuli. There was also a picture of periductal lymphocytic infiltration and vacuolization of the biliary epithelial cells, which was compatible with the diagnosis of GVHD of cholangiohepatitic type. These findings indicate that hepatic GVHD may present as acute hepatitis and should be included in the differential diagnosis for patients with increased aminotransferases after DLI.

Primary hypothalamic lymphoma with panhypopituitarism presenting as stiff-man syndrome.

We report an unusual case of primary hypothalamic lymphoma with hypopituitarism presenting as Stiff-man syndrome (SMS). A 64-year-old man was hospitalized due to a 3-week history of general weakness, anorexia, vomiting, weight loss, and muscle pain and spasms precipitated by motion and tactile stimuli resulting in muscle stiffness and difficulty in mobility. Physical examination revealed normal sensorimotor function and reflexes, except for bitemporal visual field defect. Routine laboratory and gastrointestinal examinations provided no remarkable clues. Endocrine assessment revealed low levels of morning cortisol, thyroxine, and anterior pituitary hormones but an increase in prolactin level. The patient's muscle pain and stiffness improved dramatically within 2 days after hydrocortisone therapy and thyroxine replacement. Magnetic resonance imaging (MRI) of the brain confirmed an 18-mm enhancing hypothalamic tumor with optic chiasm involvement, which proved to be a B-cell lymphoma. The results of the extensive studies for systemic lymphoma were negative, suggesting a primary hypothalamic lymphoma. The tumor regressed completely and was invisible on MRI scan after adjuvant radiotherapy. The patient's condition was satisfactory and there was no recurrence of SMS during the 2-year follow-up period. This case demonstrated that primary hypothalamic lymphoma complicated with adrenal insufficiency may manifest as SMS. Early diagnosis and prompt intervention can lead to a favorable outcome and reduce morbidity.

Rapid detection of intron 22 inversions of the factor VIII gene in Chinese patients with severe hemophilia A.

BACKGROUND: Hemophilia A is caused by mutations in the gene for coagulation factor VIII. Recently, it has been reported that about half of the patients with severe hemophilia A have a large genomic inversion of the factor VIII gene. We tried to use a rapid method to detect this important mutation in the Chinese hemophiliacs. METHODS: Based on amplification of the leaky mRNA of factor VIII gene in peripheral blood lymphocytes, a reverse-transcription polymerase chain reaction (RT-PCR) method was applied to detect the inversion of intron 22 in the Chinese patients with severe hemophilia A. RESULTS: This mutation was detected in 7 of 20 (35%) severe hemophilia A patients from unrelated families. The mutation was not found in 3 patients of non-severe hemophilia A and 4 normal controls. Family history of bleeding tendency could not be traced in 3 of the 7 patients with intron 22 inversion. CONCLUSIONS: Intron 22 inversion of the factor VIII gene is the major genetic mutation for severe hemophilia A in Taiwan. There is a high probability of de novo mutation for this genetic change. The results were consistent with the concept that intron 22 inversion will always result in severe deficiency of factor VIII. Rapid detection of this common mutation can helpfully guide the direction of molecular study in genetic counselling.

Aggressive undifferentiated carcinoma of unknown primary site complicated by lactic acidosis after bleeding: a case report.

Undifferentiated carcinoma of unknown primary site complicated by lactic acidosis has not been documented. We describe a young female with undifferentiated carcinoma of unknown primary site manifested by widespread lymph node and hepatic infiltration, hyperuricemia and very high levels of lactate dehydrogenase. She developed lactic acidosis suddenly after an episode of bleeding following nasal biopsy. The bleeding episode is likely to have caused subclinical hepatic hypoperfusion and hypoxemia, thereby aggravating lactate overproduction by tumor cells and clearance impairment due to diffuse hepatic infiltration to result in rapidly fatal acidosis before cytotoxic agents could be instituted. Although uncommon, when a critical event occurs in aggressive malignancies with massive hepatic involvement, the clinician should be alert for the development of lactic acidosis because the life-threatening metabolic complication is best avoided by prompt and effective cytoreduction therapy.