Cytokines, chemokines and growth factors profile in human aqueous humor in idiopathic uveitis.

To investigate which cytokines, chemokines and growth factors are involved in the immunopathogenesis of idiopathic uveitis, and whether cytokine profiles are associated with. Serum and aqueous humor (AH) samples of 75 patients with idiopathic uveitis were analyzed by multiplex immunoassay. Infectious controls consisted of 16 patients with ocular toxoplasmosis all confirmed by intraocular fluid analyses. Noninfectious controls consisted of 7 patients with Behçet disease related uveitis and 15 patients with sarcoidosis related uveitis. The control group consisted of AH and serum samples from 47 noninflammatory control patients with age-related cataract. In each sample, 27 immune mediators ± IL-21 and IL-23 were measured. In idiopathic uveitis, 13 of the 29 mediators, including most proinflammatory and vascular mediators such as IL-6, IL-8, IL-12, G-CSF, GM-CSF, MCP-1, IP-10, TNF-α and VEGF, were significantly elevated in the aqueous humor when compared to all controls. Moreover, IL-17, IP-10, and IL-21, were significantly elevated in the serum when compared to all controls. We clustered 4 subgroups of idiopathic uveitis using a statistical analysis of hierarchical unsupervised classification, characterized by the order of magnitude of concentrations of intraocular cytokines. The pathogenesis of idiopathic uveitis is characterized by the presence of predominantly proinflammatory cytokines and chemokines and vascular endothelial growth factor with high expression levels as compared to other causes of uveitis. There are indications for obvious Th-1/ IL21-Th17 pathways but also IL9-Th9 and increased IFN-γ-inducing cytokine (IL12) and IFN-γ-inducible CXC chemokine (IP-10). The combined data suggest that immune mediator expression is different among idiopathic uveitis. This study suggests various clusters among the idiopathic uveitis group rather than one specific uveitis entity.

Increase in Ocular Syphilis Cases at Ophthalmologic Reference Center, France, 2012-2015.

We describe the frequency, demographic and clinical features, and visual outcomes of ocular syphilis infections observed during 2012-2015 at a tertiary reference center in Paris, France. Twenty-one cases (29 eyes) were identified. The occurrence of ocular syphilis increased from 1 case in 2012 to 5 cases in 2013, 6 cases in 2014, and 9 cases in 2015 (2.22-25.21/1,000 individual patients/year for the period). Among case-patients, an annual 20%-33% were co-infected with HIV. Seventy-six percent of ocular syphilis infections occurred in men who have sex with men. Seventy-five percent of case-patients had a good final visual outcome (best-corrected visual acuity >0.3 logMAR score). Visual outcome was worse for HIV-positive patients than for HIV-negative patients (p = 0.0139). At follow-up, the best visual outcomes were observed in patients whose mean time from first ocular symptom to consultation was 15 days (SD +19 days).

Imported pythium insidiosum keratitis after a swim in Thailand by a contact lens-wearing traveler.

A 30-year-old woman with a history of contact lens wear and exposure to swimming pool water in Thailand presented with a non-responsive, progressive corneal ulcer of the right eye. Confocal microscopy evidenced septate linear branching structures, raising suspicion of fungal keratitis. She was promptly treated with topical antibiotics and both topical and intravenous caspofungin plus voriconazole. Worsening of the clinical picture after 1 month of intensive medical therapy led to a large therapeutic penetrating keratoplasty being performed. Corneal cultures grew a mold-like organism, which was identified by sequencing as Pythium insidiosum, an aquatic oomycete. After 4 years of follow-up, the graft exhibits no infection relapse, but graft transparency has been lost after two rejection episodes. Keratoplasty combined with antifungal treatment may offer a cure to P. insidiosum keratitis, although long-term preservation of corneal transparency is difficult to obtain.

Enzymatic treatment of specimens before DNA extraction directly influences molecular detection of infectious agents.

INTRODUCTION: Biological samples, pharmaceuticals or food contain proteins, lipids, polymers, ammoniums and macromolecules that alter the detection of infectious agents by DNA amplification techniques (PCR). Moreover the targeted DNA has to be released from the complex cell walls and the compact nucleoprotein matrixes and cleared from potential inhibitors. The goal of the present work was to assess the efficiency of enzymatic pretreatments on infectious agents to make DNA available for further extraction and amplification. METHODS: Staphylococcus epidermidis, Streptococcus mitis, Propionibacterium acnes, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Fusarium solani were mixed with an internal control virus and treated with: 1) proteinase K; 2) lyticase and 3) lyticase followed by proteinase K. DNAs was manually extracted using the QIAmp DNA Mini kit or the MagNA Pure Compact automate. DNA extraction yields and the inhibitors were assessed with a phocid Herpesvirus. Bacterial detection was performed using TaqMan real-time PCR and yeasts and filamentous Fungi with HRM (real-time PCR followed by high-resolution melting analysis). RESULTS: Viral DNA was released, extracted and detected using manual and automatic methods without pre enzymatic treatments. Either the manual or the automatic DNA extraction systems did not meet the sensitivity expectations if enzymatic treatments were not performed before: lyticase for Fungi and Proteinase K for Bacteria. The addition of lyticase and proteinase K did not improve results. For Fungi the detection after lyticase was higher than for Proteinase K, for which melting analysis did not allow fungal specification. DISCUSSION: Columns and magnetic beads allowed collecting DNA and separate PCR inhibitors. Detection rates cannot be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Findings in detection of Herpesviridae by polymerase chain reaction and intraocular antibody production in a case series of anterior uveitis.

PURPOSE: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests. RESULTS: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes). CONCLUSIONS: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus etiology.

Contributions to the Improvement of Living Conditions among Neglected Populations with Trachoma.

OBJECTIVE: Trachoma (Chlamydia-triggered blinding infection) provoked irreversible visual impairment in about 8 million people in 2011, and the prevalence among children with dirty faces is more than three fold that among children with clean faces. In 250 villages with a high prevalence of trachoma (Kolofata district, Far North Region, Cameroon), the lack of water for facial cleanliness was reported during trachoma awareness campaigns. The objective of this study was to determine if the lack of water was linked with the absence of means to dig wells. METHODS: Wells, waterholes, motorcycles, irrigation pumps, electricity, goats and oxen, cell phones and distance from waterholes were recorded in January 2011 in 50 randomized villages of Kolofata's district. RESULTS: The number of villages with <25 goats and <5 oxen was 0 and the number of adults owning <1 goat was 0. The cost of a pail of water was 0.01 USD. Motorcycles, cell phones and televisions have been reported in more than 66% of villages. The cost for the construction of lined shaft wells ranged between 15-35 goats and 0.5-3 oxen; the cost for drinking water wells ranged between 50-200 goats and 3-30 oxen. DISCUSSION: No link between the means for digging wells at the village level and access to water was found. Social solidarity, which refers to a social debt owed by each person to his/her group, should be added to training guides to gauge its ability to release people from the dead end of having to wait for external assistance to gain access to water.

Clinical and microbiological assessment of trachoma in the kolofata health district, far north region, cameroon.

BACKGROUND AND AIMS: Trachoma is a sight-threatening process triggered by the infection of the conjunctiva with Chlamydiae. Blindness associated with trachoma was reported in Sahelian areas of Cameroon. However, data on the prevalence of this neglected infection in the Far North Region are not available. The aim of this study was a) to assess clinical trachoma and b) to detect Chlamydia in the conjunctiva of trachomatous populations living in the Far North Regions of Cameroon. METHODS: A total of 2,423 randomly selected children (1-10 years) and 1,590 women over 14 from randomly selected villages from the Kolofata Health District (115,000 inhabitants) were included in a cross-sectional study in February 2009. Trained staff examined and obtained conjunctival swabs from trachomatous subjects. DNA was extracted and amplified to detect Chlamydia DNA by real-time PCR. The quality of sampling was assessed by quantifying the number of epithelial cells. RESULTS: Children (2,397 or 98.9% of the predicted number) and women (1,543; 97.0%) were examined. The prevalence of follicular trachoma (TF) in children was 21% (95% CI 17.8-24.5) and of intense inflammatory trachoma (TI) 5.2% (95% CI 3.6-7.3). Among the women, trichiasis (TT) was observed in 3.4% (95% CI 2.4-4.7), corneal opacities (CO) in 1.4% (95% CI 0.8-2.3) and trachoma-related blindness in 0.9% (95% CI 0.4-1.8). Conditions related to income, illiteracy, latrines, water supply and animals wandering close to dwellings were similar in all the villages. PCR was positive in 35% of children with active trachoma and in 6% of adult females presenting TT and/or related corneal opacities. CONCLUSION: The prevalence of trachoma and the severe trachoma sequelae found during this survey underline the urgent need to implement efficient blindness prevention interventions to improve the visual future of the people in the Sahelian region.

Rapid detection and simultaneous molecular profile characterization of Acanthamoeba infections.

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/µL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).

New strategy for rapid diagnosis and characterization of fungal infections: the example of corneal scrapings.

PURPOSE: The prognosis of people infected with Fungi especially immunocompromised depends on rapid and accurate diagnosis to capitalize on time administration of specific treatments. However, cultures produce false negative results and nucleic-acid amplification techniques require complex post-amplification procedures to differentiate relevant fungal types. The objective of this work was to develop a new diagnostic strategy based on real-time polymerase-chain reaction high-resolution melting analysis (PCR-HRM) that a) detects yeasts and filamentous Fungi, b) differentiates yeasts from filamentous Fungi, and c) discriminates among relevant species of yeasts. METHODS: PCR-HRM detection limits and specificity were assessed with a) isolated strains; b) human blood samples experimentally infected with Fungi; c) blood experimentally infected with other infectious agents; d) corneal scrapings from patients with suspected fungal keratitis (culture positive and negative) and e) scrapings from patients with suspected bacterial, viral or Acanthamoeba infections. The DNAs were extracted and mixed with primers diluted in the MeltDoctor® HRM Master Mix in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn (5'TCCTCCGCTT ATTGATATGCT) and the second for filamentous Fungi, containing the forward primer FilamUn (5'TGCCTGTCCGAGCGTCAT) and FungUn. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were systematically monitored. RESULTS: PCR-HRM detected 0.1 Colony Forming Units (CFU)/µl of yeasts and filamentous Fungi, differentiated filamentous Fungi from yeasts and discriminated among relevant species of yeasts. PCR-HRM performances were higher than haemoculture and sensitivity and specificity was 100% for culture positive samples, detecting and characterizing Fungi in 7 out 10 culture negative suspected fungal keratitis. CONCLUSIONS: PCR-HRM appears as a new, sensitive, specific and inexpensive test that detects Fungi and differentiates filamentous Fungi from yeasts. It allows direct fungal detection from clinical samples and experimentally infected blood in less than 2.30 h after DNA extraction.

Effects of isoproterenol and cholera toxin on human limbal epithelial cell cultures.

PURPOSE: Cholera toxin and isoproterenol (ß-adrenergic receptor agonist) are largely used to enhance cell proliferation. The aim of the study was to assess the effects of cholera toxin and isoproterenol on growth and differentiation of cells cultured from human superficial limbal explants. METHODS: Limbal epithelial cells were cultured from superficial limbal explantsin basal medium either supplemented with cholera toxin or isoproterenol for 3 weeks. Growth kinetics and morphometry were studied by light and confocal microscopy. Progenitor and differentiated epithelial cell markers were studied by immunocytochemistry, flow cytometry, Colony Formation Assay, and reverse transcription and polymerase chain reaction. RESULTS: Cell proliferation was significantly higher with 0.5 µg/ml (p = 0.049), 1 µg/ml (p = 0.005), and 2 µg/ml (p = 0.008) isoproterenol whereas, cholera toxin and 4 µg/ml isoproterenol did not significantly increase cell proliferation. Multilayered epithelial cell sheets were obtained in all culture conditions. Addition of isoproterenol resulted in smaller cell size (p < 0.05) 14 days after cells were cultured, whereas cholera toxin had no effects. Strong expression of cytokeratins 3 and 4/5/6/8/10/13/18 and lower expression of cytokeratin 19, vimentin, and Delta N p63α were observed after 3 weeks of culture with no significant differences in the percentage of positive cells according to culture medium. Colony-forming efficiencies were observed after 2 weeks in all culture condition but not after 3 weeks. CONCLUSION: Isoproterenol was more efficient than cholera toxin for enhancing cell proliferation and resulted in smaller cell size. It appears to be useful and safe for growing human limbal epithelial progenitors from limbal explants with no feeders before transplantation to patients with limbal deficiency.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Association of anti-herpes simplex virus IgG in tears and serum with clinical presentation in patients with presumed herpetic simplex keratitis.

PURPOSE: To assess the clinical relevance of tear anti-herpes simplex virus (HSV) antibody measurement for the diagnosis of herpes simplex keratitis. METHODS: Records of 364 patients clinically suspect of HSV-related keratitis who had tear anti-HSV IgG assessment (tear-quantified anti-HSV IgG/filtrated IgG ratio) in our institution between January 2000 and August 2008 were retrospectively analyzed. Patients were classified into 4 groups as follows: group 1, anti-HSV IgG negative in serum and tears; group 2, anti-HSV IgG negative in tears and positive in serum; group 3, anti-HSV IgG nonsignificantly positive in tears and positive in serum; and group 4, anti-HSV IgG significantly positive in serum and tears. Randomly selected patient charts from each group were reviewed for clinical data. RESULTS: The prevalence of anti-HSV IgG in blood increased with age from >70% before 20 years to 95% after 70 years. The prevalence of anti-HSV IgG in tears increased with age from 20% before 20 years to >50% after 70 years. The presence (either significant or not) of anti-HSV IgG in tears was significantly associated with decreased corneal sensation, presence of stromal opacities, and with neurotrophic keratitis. Logistic regression showed no significant association between age and clinical signs except for herpetic ulcers and herpetic necrotizing keratitis. CONCLUSIONS: Tear production of anti-HSV IgG increases with age, and it is associated with sequelae of herpes simplex keratitis. Conversely, it is poorly associated with clinical signs of acute herpes simplex keratitis.

Real-time polymerase chain reaction and intraocular antibody production for the diagnosis of viral versus toxoplasmic infectious posterior uveitis.

PURPOSE: The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV). RESULTS: When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001). CONCLUSIONS: For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.

Outbreak of contact lens-related Fusarium keratitis in France.

BACKGROUND/AIMS: In the context of a recent series of Fusarium keratitis cases in Singapore and the United States, we describe an outbreak of fungal keratitis attributable to Fusarium species among contact lens wearers in France. METHODS: Hospital-based case series. All cases of Fusarium keratitis diagnosed in Department of Ophthalmology of the Centre Hospitalier National d'Ophtalmologie des Quinze-Vingts in Paris were reviewed from January 2004 through November 2006. A standardized telephone interview was conducted to obtain additional clinical information for research and the analysis of risk factors. RESULTS: During the study period, 17 patients (18 affected eyes) were diagnosed with Fusarium keratitis. The vast majority (14 patients, 82%) wore contact lenses. Six patients (43% of contact lens wearers) reported using ReNu with MoistureLoc. Eight patients reported using others brands of contact lens cleaning solution. The final best corrected visual acuity ranged from 20/20 to light perception; 5 patients (29.5%) required emergency therapeutic or tectonic corneal transplantation. No specific differences including Fusarium species or severity of keratitis were found between keratitis with ReNu MoistureLoc and keratitis without ReNu MoistureLoc. CONCLUSIONS: This series reports the first outbreak of Fusarium keratitis in Europe. Once again, ReNu with MoistureLoc, a multipurpose lens disinfecting solutions seems to be related with Fusarium keratitis.

Clinical and microbiological diagnosis of trachoma in children living in rural areas in the district of Attock, Punjab, Pakistan.

BACKGROUND: Trachoma is a sight-threatening process triggered by infection of the conjunctiva with Chlamydiae. When this infection becomes chronic and is associated with poverty it triggers trachoma, the prime cause of infectious blindness in the world. Since the 1958 report indicating that the highest incidence of trachoma in Pakistan was found in the province of Punjab, no new trials have been published. In the present study, we assessed the prevalence of trachoma in 3968 children living in 11 rural villages in the district of Attock, Punjab, Pakistan. The children with trachoma were sampled to detect C. trachomatis by PCR. METHODS: Children in rural villages in the district of Attock were examined for trachoma in February 2004. Samples were obtained by scraping, and DNA was extracted (MagnaPure-LC Robot) and amplified to detect C. trachomatis (Amplicor-Roche). The quality of sampling was assessed by quantifying the number of cells by real-time PCR. RESULTS: The prevalence of trachoma was 3.7% (0 to 6.2%). PCR was positive in 20% of samples from trachomatous children and the number of cells was always > 100/sample. The income levels, illiteracy, use of latrines, water supply, and the presence of animals close to dwellings were similar in all the villages. In Sujjenda, the prevalence was doubled in the warmest season. CONCLUSIONS: Trachoma was diagnosed in 3.7% of the children aged < 10 years. The low rates for positive PCR may be due to loss of the plasmid, the involvement of other Chlamydiae, or their absence in chronic infections. The results obtained here underestimate the prevalence of trachoma because most of the mothers (and babies) were not tested in the district of Attock.

Heidelberg retina tomograph II findings of Acanthamoeba keratitis.

PURPOSE: Heidelberg retina tomograph II (HRTII) examination was performed with cornea module in one patient with Acanthamoeba keratitis (AK) to provide images detailing characteristic findings of the disease. METHODS: A 34-year-old woman presented with clinical signs and symptoms of AK. HRTII with cornea module was performed and the patient underwent laboratory investigations. RESULTS: HRTII examination with cornea module revealed numerous 20-26-micro m diameter high-contrast round particles within the corneal epithelium and anterior stroma, resembling Acanthamoeba cysts. Stellate cells as well as ovoid irregular objects, possibly inflammatory cells, trophozoites, altered cysts, or activated keratocytes, were also present in the area of stromal infiltrates. Laboratory investigations confirmed the diagnosis of AK. CONCLUSIONS: HRTII cornea module can be helpful in the diagnosis of AK by identifying acanthamoeba cyst-like structures in the cornea. This technique also has potential uses in monitoring the efficiency of anti-infective treatment.

Early bacterial keratitis after laser-assisted subepithelial keratectomy.

We report a case of bacterial keratitis that occurred after laser-assisted subepithelial keratectomy. The patient presented with a decrease in visual acuity and pain 2 days after the procedure. Culture was positive for Staphylococcus haemolyticus. The infiltrate slowly resolved with topical antibiotics, and the best corrected visual acuity improved to 20/20. Although bacterial keratitis occurs rarely after refractive surgery, patients should be informed of the potential risk for visual loss caused by this infection.

[Amniotic membrane transplantation for the treatment severe acanthamoeba keratitis]. / Intérêt de la greffe de membrane amniotique dans le traitement des kératites amibiennes sévères.

BACKGROUND: It is now possible to treat ocular surface disorders by means of amniotic membrane transplantation. We performed a study to determine the efficacy of this technique in the treatment of severe Acanthamoeba keratitis. METHODS: We studied six patients with severe, painful, nonhealing Acanthamoeba keratitis who underwent one or two amniotic membrane transplantation procedures between February 2001 and January 2003. Histopathological analysis of the corneal buttons was performed in four cases. RESULTS: Eight amniotic membrane transplantation procedures were performed. The mean length of follow-up was 14 (range 3-21) months. The mean interval between institution of medical treatment and the procedure was 3.6 months. All patients had progressive stromal lesions caused by an inflammatory reaction. Complete reepithelialization occurred in four cases, and partial healing in two cases. Ocular inflammation and tissue destruction were decreased in all cases, pain was lessened in five cases, and corneal neovascularization was decreased in four cases. No postoperative complications were observed. Amniotic membrane was observed under dysplastic corneal epithelium on histologic examination. INTERPRETATION: Amniotic membrane transplantation may be a safe and effective treatment of severe Acanthamoeba keratitis, particularly during the inflammation phase. It may permit penetrating keratoplasty to be delayed.

Culture-proven herpetic keratitis after penetrating keratoplasty in patients with no previous history of herpes disease.

OBJECTIVE: To report three cases of herpetic infection in recipients of organ-cultured donor corneas among 586 consecutive corneal transplantation procedures. METHODS: Three patients with no history of symptomatic herpes infection underwent corneal transplantation for keratoconus (2 patients) and Fuchs dystrophy (1 patient). Two patients developed keratouveitis and primary graft failure. The third patient developed dendritic keratitis in the graft. Culture of corneal scrapings and the patient's bandage contact lens were positive for herpes simplex virus type 1 (HSV-1). Donor and recipient sera were tested for HSV serology by EIA. Recipient corneal buttons were studied by means of transmission electron microscopy and immunohistochemistry. The three HSV-1 strains were genotyped by sequencing part of a variable antigenic domain of glycoprotein B (gB). RESULTS: None of the donor corneas showed endothelial cell necrosis after organ culture. All keratoplasties performed with the three mate donor corneas had an uncomplicated course. All three donor sera were positive for HSV. Preoperative recipient sera were positive for HSV. Analysis of the recipient corneal buttons showed no evidence of herpetic infection. Sequence analysis revealed three different gB genotypes. CONCLUSION: Ascertaining that a postoperative herpetic infection in a corneal transplant originates from the donor tissue is still difficult. Although some features of the reported cases suggest donor-to-host transmission of herpes simplex virus, the recipients could have been the source of the virus.