Detection of Prostate Cancer Antigen 3 and Prostate Cancer Susceptibility Candidate in Non-DRE Urine Improves Diagnosis of Prostate Cancer in Chinese Population.

Although prostate biopsy is the gold standard for the diagnosis of prostate cancer, it also leads to high incidence of negative biopsies and the diagnosis of clinically low-risk prostate cancer and the subsequent overtreatment. It remains an unmet need to discover new biomarkers in order to defer the unnecessary biopsies in clinical practice. In this study, we described a new method, LBXexo score, to measure the urine exosomal PCA3/PRAC expression from non-DRE urine as a noninvasive diagnosis to improve the detection rate in Chinese population with a low serum PSA level. First-voided urine samples were collected to isolate exosomes, and exosomal RNAs of PCA3 and PRAC were measured by quantitative reverse transcription PCR. A significant increase in exoPCA3/PRAC was observed in both any-grade and high-grade prostate cancer groups when compared with the biopsy-negative group. Receiver-operating characteristic curve analyses showed that the LBXexo score significantly improved diagnostic performance in predicting biopsy results, with AUCs of 0.723 (p=0.017) and 0.736 (p=0.038) for any-grade and high-grade (GS ≥ 7) prostate cancer, respectively. For high-grade cancer, LBXexo had the negative and positive predictive values of 100% and 27.59%, respectively, and could potentially avoid unnecessary biopsy. This is the first report in Chinese population that demonstrates the predictive value of the exosomal expression of PCA3 and PRAC derived from non-DRE urine in predicting prostate biopsy outcomes. It could be used in clinical practice to make a better informed biopsy decision and avoid unnecessary biopsies in Chinese population.

[Molecular and Genetic Mechanism of Three Cases of Para-Bombay Blood Group].

OBJECTIVE: To explore molecular and genetic mechanism of 3 cases of para-Bombay blood group. METHODS: The bood samples of proband and family members were selected to identify their blood groups with conventional serologic methods, and salivary components carrying the ABH antigens were detected. The coding regions of FUT1 as well as exon 6 and 7 of the ABO gene were amplified using polymerase chain reaction(PCR), and the FUT1 gene was directly sequenced. RESULTS: All the 3 cases of proband were confirmed as para-Bombay blood group. Direct sequencing revealed h new2 (nt328G→A) and h1(nt 547 ΔAG) in FUT1 gene of the proband 1, and FUT1 genotype was h1/h new2. However, the genotypes of his parents were H/h1 and H/h new2, which were non-Bombay individuals. The FUT1 genotypes of proband 2 and 3 were h1h2 (nt 547 ΔAG) and h1h2 (nt 880 ΔTT), respectively. CONCLUSION: The technology of molecular biology can be used to detect the base deletion mutations in FUT1 gene, which contributes to the analysis of molecular and genetic mechanism of para-Bombay blood group.

[Two novel mutations of FBN1 gene in the patients with MFS among Han population].

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

[Two gene mutations in fibrillin 1 of Marfan syndrome].

OBJECTIVE: To detect novel mutations in the fibrillin 1 (FBN1) and transforming growth factor beta receptor type II (TGFBR2) genes by screening the genes from 14 patients with Marfan syndrome. METHODS: Denaturing high performance liquid chromatography (DHPLC) was introduced to screen for FBN1 and TGFBR2 mutations exon-by-exon. The DNA amplification fragments which DHPLC elution profiles showed different from the corresponding normal elution profile were sequenced to identify the positions and types of mutations. Restriction fragment length polymorphism (RFLP) was employed to further prove the mutations when needed. RESULTS: Two gene mutations of the FBN1 were found in the patients with Marfan syndrome. They were a novel substitutional mutation (Intron29 +4A > T) of FBN1 and a recurrent nonsense mutation (8080C >T) of FBN1. CONCLUSION: Intron29 +4A > T and 8080C > T of FBN1 are possibly the pathogenesis of the MFS patients.