Least-Squares Support Vector Machine Approach to Viral Replication Origin Prediction.

Replication of their DNA genomes is a central step in the reproduction of many viruses. Procedures to find replication origins, which are initiation sites of the DNA replication process, are therefore of great importance for controlling the growth and spread of such viruses. Existing computational methods for viral replication origin prediction have mostly been tested within the family of herpesviruses. This paper proposes a new approach by least-squares support vector machines (LS-SVMs) and tests its performance not only on the herpes family but also on a collection of caudoviruses coming from three viral families under the order of caudovirales. The LS-SVM approach provides sensitivities and positive predictive values superior or comparable to those given by the previous methods. When suitably combined with previous methods, the LS-SVM approach further improves the prediction accuracy for the herpesvirus replication origins. Furthermore, by recursive feature elimination, the LS-SVM has also helped find the most significant features of the data sets. The results suggest that the LS-SVMs will be a highly useful addition to the set of computational tools for viral replication origin prediction and illustrate the value of optimization-based computing techniques in biomedical applications.

AT excursion: a new approach to predict replication origins in viral genomes by locating AT-rich regions.

BACKGROUND: Replication origins are considered important sites for understanding the molecular mechanisms involved in DNA replication. Many computational methods have been developed for predicting their locations in archaeal, bacterial and eukaryotic genomes. However, a prediction method designed for a particular kind of genomes might not work well for another. In this paper, we propose the AT excursion method, which is a score-based approach, to quantify local AT abundance in genomic sequences and use the identified high scoring segments for predicting replication origins. This method has the advantages of requiring no preset window size and having rigorous criteria to evaluate statistical significance of high scoring segments. RESULTS: We have evaluated the AT excursion method by checking its predictions against known replication origins in herpesviruses and comparing its performance with an existing base weighted score method (BWS1). Out of 43 known origins, 39 are predicted by either one or the other method and 26 origins are predicted by both. The excursion method identifies six origins not predicted by BWS1, showing that the AT excursion method is a valuable complement to BWS1. We have also applied the AT excursion method to two other families of double stranded DNA viruses, the poxviruses and iridoviruses, of which very few replication origins are documented in the public domain. The prediction results are made available as supplementary materials at 1. Preliminary investigation shows that the proposed method works well on some larger genomes too. CONCLUSION: The AT excursion method will be a useful computational tool for identifying replication origins in a variety of genomic sequences.

Scoring schemes of palindrome clusters for more sensitive prediction of replication origins in herpesviruses.

Many empirical studies show that there are unusual clusters of palindromes, closely spaced direct and inverted repeats around the replication origins of herpesviruses. In this paper, we introduce two new scoring schemes to quantify the spatial abundance of palindromes in a genomic sequence. Based on these scoring schemes, a computational method to predict the locations of replication origins is developed. When our predictions are compared with 39 known or annotated replication origins in 19 herpesviruses, close to 80% of the replication origins are located within 2% of the genome length. A list of predicted locations of replication origins in all the known herpesviruses with complete genome sequences is reported.

Palindromes in SARS and Other Coronaviruses.

With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.