Sentinel plot surveillance of cotton leaf curl disease in Pakistan- a case study at the cultivated cotton-wild host plant interface.

A sentinel plot case study was carried out to identify and map the distribution of begomovirus-betasatellite complexes in sentinel plots and commercial cotton fields over a four-year period using molecular and high-throughput DNA 'discovery' sequencing approaches. Samples were collected from 15 study sites in the two major cotton-producing areas of Pakistan. Whitefly- and leafhopper-transmitted geminiviruses were detected in previously unreported host plant species and locations. The most prevalent begomovirus was cotton leaf curl Kokhran virus-Burewala (CLCuKoV-Bu). Unexpectedly, a recently recognized recombinant, cotton leaf curl Multan virus-Rajasthan (CLCuMuV-Ra) was prevalent in five of 15 sites. cotton leaf curl Alabad virus (CLCuAlV) and cotton leaf curl Kokhran virus-Kokhran, 'core' members of CLCuD-begomoviruses that co-occurred with CLCuMuV in the 'Multan' epidemic were detected in one of 15 sentinel plots. Also identified were chickpea chlorotic dwarf virus and 'non-core' CLCuD-begomoviruses, okra enation leaf curl virus, squash leaf curl virus, and tomato leaf curl New Delhi virus. Cotton leaf curl Multan betasatellite (CLCuMuB) was the most prevalent CLCuD-betasatellite, and less commonly, two 'non-core' betasatellites. Recombination analysis revealed previously uncharacterized recombinants among helper virus-betasatellite complexes consisting of CLCuKoV, CLCuMuV, CLCuAlV and CLCuMuB. Population analyses provided early evidence for CLCuMuV-Ra expansion and displacement of CLCuKoV-Bu in India and Pakistan from 2012-2017. Identification of 'core' and non-core CLCuD-species/strains in cotton and other potential reservoirs, and presence of the now predominant CLCuMuV-Ra strain are indicative of ongoing diversification. Investigating the phylodynamics of geminivirus emergence in cotton-vegetable cropping systems offers an opportunity to understand the driving forces underlying disease outbreaks and reconcile viral evolution with epidemiological relationships that also capture pathogen population shifts.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State.

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.

A Complex of Badnavirus Species Infecting Cacao Reveals Mixed Infections, Extensive Genomic Variability, and Interspecific Recombination.

The incidence of cacao swollen shoot disease (CSSD) in cacao (Theobroma cacao L.) has increased in West Africa since ~2000. To investigate the genomic and species diversity of the CSSD-badnaviruses infecting cacao in Côte d'Ivoire and Ghana, symptomatic leaves were subjected to high-throughput sequencing. Among the 30 newly determined genomes, three badnaviruses were identified, Cacao swollen shoot Togo B virus (CSSTBV), Cacao swollen shoot CD virus, and Cacao swollen shoot CE virus (CSSCEV). The phylogenetic trees reconstructed for the reverse transcriptase (RT) and ribonuclease H (RNase H) sequences were incongruent with the complete viral genomes, which had the most robust statistical support. Recombination seems to be involved in the CSSD-badnavirus diversification. The genomic diversity varied among different CSSD-badnaviruses, with CSSTBV showing the lowest nucleotide diversity (π = 0.06236), and CSSCEV exhibiting the greatest variability (π = 0.21911). Evidence of strong purifying selection was found in the coding regions of the CSSTBV isolates.

The Previously Unidentified, Divergent Badnavirus Species Cacao red vein-banding virus is Associated with Cacao Swollen Shoot Disease in Nigeria.

Cacao swollen shoot disease (CSSD) of Theobroma cacao was reported in Nigeria in 1944; however, no badnaviral genome sequences have been found associated with the symptomatic trees. In 2017, leaf samples (n = 18) were collected from cacao trees from Osun and Oyo, Nigeria showing foliar symptoms that included red vein-banding and shoot swelling, and variable secondary mosaic, mottling, and fern-like pattern symptoms. Abutting primers designed around previously determined 500-bp intergenic region sequences were used for polymerase chain reaction (PCR) amplification. Of the 18 samples, 9 yielded an approximately 7,000-bp, apparently genome-size product. The nine genomes were sequenced and found to encode four open reading frames, and to share 86 to 99% nucleotide identity. Pairwise analysis of the Nigerian genomes with 21 previously reported CSSD badnaviruses, at the complete genome and reverse-transcription ribonuclease H (1,230 bp) sequence levels, indicated 71 to 75 and 72 to 76% nucleotide identity, respectively. Phylogenetic analysis of the nine complete genomes indicated that the closest relatives of the divergent Nigerian isolates were previously described West African CSSD badnaviruses. Based on pairwise comparisons and phylogenetic analyses, the Nigerian CSSD isolates constitute a previously unrecognized Badnavirus sp., herein named Cacao red vein-banding virus (CRVBV). Primers designed based on the CRVBV genome sequences amplified a 1,068-bp fragment from 16 of 18 field samples tested by PCR, suggesting the possible existence of additional CRVBV variants.

The proposed new species, cacao red vein virus, and three previously recognized badnavirus species are associated with cacao swollen shoot disease.

BACKGROUND: Cacao swollen shoot virus (CSSV), Cacao swollen shoot CD virus (CSSCDV), and Cacao swollen shoot Togo A virus (CSSTAV) cause cacao swollen shoot disease (CSSD) in West Africa. During 2000-2003, leaf and shoot-swelling symptoms and rapid tree death were observed in cacao in Cote d'Ivoire and Ghana. Molecular tests showed positive infection in only ~50-60% of symptomatic trees, suggesting the possible emergence of an unknown badnavirus. METHODS: The DNA virome was determined from symptomatic cacao samples using Illumina-Hi Seq, and sequence accuracy was verified by Sanger sequencing. The resultant 14, and seven previously known, full-length badnaviral genomic and RT-RNase H sequences were analyzed by pairwise distance analysis to resolve species relationships, and by Maximum likelihood (ML) to reconstruct phylogenetic relationships. The viral coding and non-coding sequences, genome organization, and predicted conserved protein domains (CPDs) were identified and characterized at the species level. RESULTS: The 21 CSSD-badnaviral genomes and RT-RNase H sequences shared 70-100% and 72-100% identity, respectively. The RT-RNase H analysis predicted four species, based on an ≥80% species cutoff. The ML genome sequence tree resolved three well-supported clades, with ≥70% bootstrap, whereas, the RT-RNase H phylogeny was poorly resolved, however, both trees grouped CSSD isolates within one large clade, including the newly discovered Cacao red vein virus (CRVV) proposed species. The genome arrangement of the four species consists of four, five, or six predicted open reading frames (ORFs), and the CPDs have similar architectures. By comparison, two New World cacao-infecting badnaviruses encode four ORFs, and harbor CPDs like the West African species. CONCLUSIONS: Three previously recognized West African cacao-infecting badnaviral species were identified, and a fourth, previously unidentified species, CRVV, is described for the first time. The CRVV is a suspect causal agent of the rapid decline phenotype, however Koch's Postulates have not been proven. To reconcile viral evolutionary with epidemiology considerations, more detailed information about CSSD-genomic variability is essential. Also, the functional basis for the multiple genome arrangements and subtly distinct CPD architectures among cacao-infecting badnaviruses is poorly understood. New knowledge about functional relationships may help explain the diverse symptomatologies observed in affected cacao trees.

Molecular characterization of previously elusive badnaviruses associated with symptomatic cacao in the New World.

Suspected virus-like symptoms were observed in cacao plants in Trinidad during 1943, and the viruses associated with these symptoms were designated as strains A and B of cacao Trinidad virus (CTV). However, viral etiology has not been demonstrated for either phenotype. Total DNA was isolated from symptomatic cacao leaves exhibiting the CTV A and B phenotypes and subjected to Illumina HiSeq and Sanger DNA sequencing. Based on de novo assembly, two apparently full-length badnavirus genomes of 7,533 and 7,454 nucleotides (nt) were associated with CTV strain A and B, respectively. The Trinidad badnaviral genomes contained four open reading frames, three of which are characteristic of other known badnaviruses, and a fourth that is present in only some badnaviruses. Both badnaviral genomes harbored hallmark caulimovirus-like features, including a tRNAMet priming site, a TATA box, and a polyadenylation-like signal. Pairwise comparisons of the RT-RNase H region indicated that the Trinidad isolates share 57-71% nt sequence identity with other known badnaviruses. Based on the system for badnavirus species demarcation in which viruses with less than 80% nt sequence identity in the RT-RNase gene are considered members of separate species, these isolates represent two previously unidentified badnaviruses, herein named cacao mild mosaic virus and cacao yellow vein banding virus, making them the first cacao-infecting badnaviruses identified thus far in the Western Hemisphere.