FragTracer: Real-Time Fragmentation Monitoring Tool for F2FS File System.

Emerging hardware devices (e.g., NVMe SSD, RISC-V, etc.) open new opportunities for improving the overall performance of computer systems. In addition, the applications try to fully utilize hardware resources to keep up with those improvements. However, these trends can cause significant file system overheads (i.e., fragmentation issues). In this paper, we first study the reason for the fragmentation issues on an F2FS file system and present a new tool, called FragTracer, which helps to analyze the ratio of fragmentation in real-time. For user-friendly usage, we designed FragTracer with three main modules, monitoring, pre-processing, and visualization, which automatically runs without any user intervention. We also optimized FragTracer in terms of performance to hide its overhead in tracking and analyzing fragmentation issues on-the-fly. We evaluated FragTracer with three real-world databases on the F2FS file system, so as to study the fragmentation characteristics caused by databases, and we compared the overhead of FragTracer. Our evaluation results clearly show that the overhead of FragTracer is negligible when running on commodity computing environments.

Microphysiological Engineering of Self-Assembled and Perfusable Microvascular Beds for the Production of Vascularized Three-Dimensional Human Microtissues.

The vasculature is an essential component of the circulatory system that plays a vital role in the development, homeostasis, and disease of various organs in the human body. The ability to emulate the architecture and transport function of blood vessels in the integrated context of their associated organs represents an important requirement for studying a wide range of physiological processes. Traditional in vitro models of the vasculature, however, largely fail to offer such capabilities. Here we combine microfluidic three-dimensional (3D) cell culture with the principle of vasculogenic self-assembly to engineer perfusable 3D microvascular beds in vitro. Our system is created in a micropatterned hydrogel construct housed in an elastomeric microdevice that enables coculture of primary human vascular endothelial cells and fibroblasts to achieve de novo formation, anastomosis, and controlled perfusion of 3D vascular networks. An open-top chamber design adopted in this hybrid platform also makes it possible to integrate the microengineered 3D vasculature with other cell types to recapitulate organ-specific cellular heterogeneity and structural organization of vascularized human tissues. Using these capabilities, we developed stem cell-derived microphysiological models of vascularized human adipose tissue and the blood-retinal barrier. Our approach was also leveraged to construct a 3D organotypic model of vascularized human lung adenocarcinoma as a high-content drug screening platform to simulate intravascular delivery, tumor-killing effects, and vascular toxicity of a clinical chemotherapeutic agent. Furthermore, we demonstrated the potential of our platform for applications in nanomedicine by creating microengineered models of vascular inflammation to evaluate a nanoengineered drug delivery system based on active targeting liposomal nanocarriers. These results represent a significant improvement in our ability to model the complexity of native human tissues and may provide a basis for developing predictive preclinical models for biopharmaceutical applications.

A microengineered model of RBC transfusion-induced pulmonary vascular injury.

Red blood cell (RBC) transfusion poses significant risks to critically ill patients by increasing their susceptibility to acute respiratory distress syndrome. While the underlying mechanisms of this life-threatening syndrome remain elusive, studies suggest that RBC-induced microvascular injury in the distal lung plays a central role in the development of lung injury following blood transfusion. Here we present a novel microengineering strategy to model and investigate this key disease process. Specifically, we created a microdevice for culturing primary human lung endothelial cells under physiological flow conditions to recapitulate the morphology and hemodynamic environment of the pulmonary microvascular endothelium in vivo. Perfusion of the microengineered vessel with human RBCs resulted in abnormal cytoskeletal rearrangement and release of intracellular molecules associated with regulated necrotic cell death, replicating the characteristics of acute endothelial injury in transfused lungs in vivo. Our data also revealed the significant effect of hemodynamic shear stress on RBC-induced microvascular injury. Furthermore, we integrated the microfluidic endothelium with a computer-controlled mechanical stretching system to show that breathing-induced physiological deformation of the pulmonary microvasculature may exacerbate vascular injury during RBC transfusion. Our biomimetic microsystem provides an enabling platform to mechanistically study transfusion-associated pulmonary vascular complications in susceptible patient populations.

Array-based discovery of aptamer pairs.

Affinity reagent pairs that recognize distinct epitopes on a target protein can greatly improve the sensitivity and specificity of molecular detection. Importantly, such pairs can be conjugated to generate reagents that achieve two-site "bidentate" target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because conventional selection methods preferentially yield aptamers that recognize a dominant "hot spot" epitope. Our array-based discovery platform for multivalent aptamers (AD-MAP) overcomes this problem to achieve efficient discovery of aptamer pairs. We use microfluidic selection and high-throughput sequencing to obtain an enriched pool of aptamer sequences. Next, we synthesize a custom array based on these sequences, and perform parallel affinity measurements to identify the highest-affinity aptamer for the target protein. We use this aptamer to form complexes that block the primary binding site on the target, and then screen the same array with these complexes to identify aptamers that bind secondary epitopes. We used AD-MAP to discover DNA aptamer pairs that bind distinct sites on human angiopoietin-2 with high affinities, even in undiluted serum. To the best of our knowledge, this is the first work to discover new aptamer pairs using arrays. We subsequently conjugated these aptamers with a flexible linker to construct ultra-high-affinity bidentate reagents, with equilibrium dissociation constants as low as 97 pM: >200-fold better than either component aptamer. Functional studies confirm that both aptamers critically contribute to this ultrahigh affinity, highlighting the promise of such reagents for research and clinical use.

Quantitative selection and parallel characterization of aptamers.

Aptamers are promising affinity reagents that are potentially well suited for high-throughput discovery, as they are chemically synthesized and discovered via completely in vitro selection processes. Recent advancements in selection, sequencing, and the use of modified bases have improved aptamer quality, but the overall process of aptamer generation remains laborious and low-throughput. This is because binding characterization remains a critical bottleneck, wherein the affinity and specificity of each candidate aptamer are measured individually in a serial manner. To accelerate aptamer discovery, we devised the Quantitative Parallel Aptamer Selection System (QPASS), which integrates microfluidic selection and next-generation sequencing with in situ-synthesized aptamer arrays, enabling simultaneous measurement of affinity and specificity for thousands of candidate aptamers in parallel. After using QPASS to select aptamers for the human cancer biomarker angiopoietin-2 (Ang2), we in situ synthesized arrays of the selected sequences and obtained equilibrium dissociation constants (Kd) for every aptamer in parallel. We thereby identified over a dozen high-affinity Ang2 aptamers, with Kd as low as 20.5 ± 7.3 nM. The same arrays enabled us to quantify binding specificity for these aptamers in parallel by comparing relative binding of differentially labeled target and nontarget proteins, and by measuring their binding affinity directly in complex samples such as undiluted serum. Finally, we show that QPASS offers a compelling avenue for exploring structure-function relationships for large numbers of aptamers in parallel by coupling array-based affinity measurements with next-generation sequencing data to identify nucleotides and motifs within the aptamer that critically affect Ang2 binding.

Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods.

A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (K(d), AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

Measurement of aptamer-protein interactions with back-scattering interferometry.

We report the quantitative measurement of aptamer-protein interactions using backscattering interferometry (BSI) and show that BSI can determine when distinct binding regions are accessed. As a model system, we utilized two DNA aptamers (Tasset and Bock) that bind to distinct sites of a target protein (human α-thrombin). This is the first time BSI has been used to study a multivalent system in free solution wherein more than one ligand binds to a single target. We measured aptamer equilibrum dissociation constants (K(d)) of 3.84 nM (Tasset-thrombin) and 5.96 nM (Bock-thrombin), in close agreement with the literature. Unexpectedly, we observed allosteric effects such that the binding of the first aptamer resulted in a significant change in the binding affinity of the second aptamer. For example, the K(d) of Bock aptamer binding to preformed Tasset-thrombin complexes was 7-fold lower (indicating higher affinity) compared to binding to thrombin alone. Preliminary modeling efforts suggest evidence for allosteric linkage between the two exosites.

Improving aptamer selection efficiency through volume dilution, magnetic concentration, and continuous washing in microfluidic channels.

The generation of nucleic acid aptamers with high affinity typically entails a time-consuming, iterative process of binding, separation, and amplification. It would therefore be beneficial to develop an efficient selection strategy that can generate these high-quality aptamers rapidly, economically, and reproducibly. Toward this goal, we have developed a method that efficiently generates DNA aptamers with slow off-rates. This methodology, called VDC-MSELEX, pairs the volume dilution challenge process with microfluidic separation for magnetic bead-assisted aptamer selection. This method offers improved aptamer selection efficiencies through the application of highly stringent selection conditions: it retrieves a small number (<10(6)) of magnetic beads suspended in a large volume (>50 mL) and concentrates them into a microfluidic chamber (8 µL) with minimal loss for continuous washing. We performed three rounds of the VDC-MSELEX using streptavidin (SA) as the target and obtained new DNA aptamer sequences with low nanomolar affinity that specifically bind to the SA proteins.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Selection of phage-displayed peptides on live adherent cells in microfluidic channels.

Affinity reagents that bind to specific molecular targets are an essential tool for both diagnostics and targeted therapeutics. There is a particular need for advanced technologies for the generation of reagents that specifically target cell-surface markers, because transmembrane proteins are notoriously difficult to express in recombinant form. We have previously shown that microfluidics offers many advantages for generating affinity reagents against purified protein targets, and we have now significantly extended this approach to achieve successful in vitro selection of T7 phage-displayed peptides that recognize markers expressed on live, adherent cells within a microfluidic channel. As a model, we have targeted neuropilin-1 (NRP-1), a membrane-bound receptor expressed at the surface of human prostate carcinoma cells that plays central roles in angiogenesis, cell migration, and invasion. We show that, compared to conventional biopanning methods, microfluidic selection enables more efficient discovery of peptides with higher affinity and specificity by providing controllable and reproducible means for applying stringent selection conditions against minimal amounts of target cells without loss. Using our microfluidic system, we isolate peptide sequences with superior binding affinity and specificity relative to the well known NRP-1-binding RPARPAR peptide. As such microfluidic systems can be used with a wide range of biocombinatorial libraries and tissue types, we believe that our method represents an effective approach toward efficient biomarker discovery from patient samples.

Dual-aptamer-based delivery vehicle of doxorubicin to both PSMA (+) and PSMA (-) prostate cancers.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing.

We describe the integration of microfluidic selection with high-throughput DNA sequencing technology for rapid and efficient discovery of nucleic acid aptamers. The Quantitative Selection of Aptamers through Sequencing method tracks the copy number and enrichment-fold of more than 10 million individual sequences through multiple selection rounds, enabling the identification of high-affinity aptamers without the need for the pool to fully converge to a small number of sequences. Importantly, this method allows the discrimination of sequences that arise from experimental biases rather than true high-affinity target binding. As a demonstration, we have identified aptamers that specifically bind to PDGF-BB protein with K(d) < 3 nM within 3 rounds. Furthermore, we show that the aptamers identified by Quantitative Selection of Aptamers through Sequencing have approximately 3-8-fold higher affinity and approximately 2-4-fold higher specificity relative to those discovered through conventional cloning methods. Given that many biocombinatorial libraries are encoded with nucleic acids, we extrapolate that our method may be extended to other types of libraries for a range of molecular functions.

Simultaneous electrochemical detection of both PSMA (+) and PSMA (-) prostate cancer cells using an RNA/peptide dual-aptamer probe.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (-) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

Detection of mismatched DNAs via the binding affinity of MutS using a gold nanoparticle-based competitive colorimetric method.

A gold nanoparticle-based competitive colorimetric assay can detect mismatched DNAs using MutS, a mismatch binding protein, and determine their relative binding affinities for this protein by a simple color change and the melting temperature of DNA-functionalized nanoparticle assemblies.

A simple and direct electrochemical detection of interferon-gamma using its RNA and DNA aptamers.

Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.

Detection for folding of the thrombin binding aptamer using label-free electrochemical methods.

The folding of aptamer immobilized on an Au electrode was successfully detected using label-free electrochemical methods. A thrombin binding DNA aptamer was used as a model system in the presence of various monovalent cations. Impedance spectra showed that the extent to which monovalent cations assist in folding of aptamer is ordered as K(+) > NH(4)(+) > Na(+) > Cs(+). Our XPS analysis also showed that K(+) and NH(4)(+) caused a conformational change of the aptamer in which it forms a stable complex with these monovalent ions. Impedance results for the interaction between aptamer and thrombin indicated that thrombin interacts more with folded aptamer than with unfolded aptamer. The EQCM technique provided a quantitative analysis of these results. In particular, the present impedance results showed that thrombin participates a folding of aptamer to some extent, and XPS analysis confirmed that thrombin stabilizes and induces the folding of aptamer.

Steady-state ATPase activity of E. coli MutS modulated by its dissociation from heteroduplex DNA.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

A simple fluorescent method for detecting mismatched DNAs using a MutS-fluorophore conjugate.

A fluorescent method was developed for the detection of unpaired and mismatched DNAs using a MutS-fluorophore conjugate. The fluorophore, 2-(4'-(iodoacetoamido)anilino) naphthalene-6-sulfonic acid (IAANS), was site-specifically attached to the 469 position of Thermus aquaticus (Taq.) MutS mutant (C42A/T469C). The fluorophore labeled residue located at the dimer interface of the protein undergoes a drastic conformational change upon binding with mismatched DNA. The close proximity of the two identical fluorescent molecules presumably causes the self-quenching of the fluorophore, since fluorescence emission of the biosensor decreases with increasing concentrations of mismatched DNA. The order of binding affinity for each unpaired and mismatched DNA obtained by this method was DeltaT (Kd=52 nM)>GT (62 nM)>DeltaC (130 nM)>CT (160 nM)>DeltaG (170 nM)>DeltaA (250 nM)>CC (720 nM)>AT (950 nM). This order is comparable to the previous results of the gel mobility shift assay. Thus, this method can be a simple, useful tool for elucidating the mechanism of DNA mismatch repair as well as a novel probe for detecting of genetic mutation.

Electrochemical detection of mismatched DNA using a MutS probe.

A direct and label-free electrochemical biosensor for the detection of the protein-mismatched DNA interaction was designed using immobilized N-terminal histidine tagged Escherichia coli. MutS on a Ni-NTA coated Au electrode. General electrochemical methods, cyclic voltammetry (CV), electrochemical quartz crystal microbalance (EQCM) and impedance spectroscopy, were used to ascertain the binding affinity of mismatched DNAs to the MutS probe. The direct results of CV and impedance clearly reveal that the interaction of MutS with the CC heteroduplex was much stronger than that with AT homoduplex, which was not differentiated in previous results (GT > CT > CC approximately AT) of a gel mobility shift assay. The EQCM technique was also able to quantitatively analyze MutS affinity to heteroduplexes.