Thromboxane Antagonism with terutroban in Peripheral Arterial Disease: the TAIPAD study.

BACKGROUND: Terutroban is a selective prostaglandin endoperoxide (TP) receptor antagonist with antithrombotic, antivasoconstrictive and antiatherosclerotic properties and is currently in development for long-term cardiovascular secondary prevention. OBJECTIVES: TAIPAD is an international, double-blind, randomized controlled study comparing the effects of five dosages of oral terutroban vs. aspirin and placebo on platelet aggregation in peripheral arterial disease (PAD) patients. PATIENTS/METHODS: After 10 day's placebo run-in, included patients (n = 435; ankle-brachial pressure index, 0.7 ± 0.1) were randomly allocated to aspirin 75 mg day(-1), terutroban 1, 2.5, 5, 10 or 30 mg day(-1) or placebo. On day 5, the placebo group was reallocated to one of the terutroban groups for the rest of the study (day 83). Ex vivo platelet aggregation induced by the thromboxane analog U46619 (7 µm) was measured 24 h after dosing, as well as platelet aggregation induced by arachidonic acid (AA), collagen and ADP. RESULTS: Terutroban dose-dependently inhibited U46619-induced platelet aggregation at days 5 and 83. At day 5, the inhibition was significant vs. placebo for all terutroban dosages (P < 0.001). Terutroban (5, 10 and 30 mg day(-1)) was at least as effective as aspirin in inhibiting platelet aggregation induced by arachidonic acid (AA), collagen and adenosine diphosphate (ADP). Terutroban was well tolerated, with a safety profile similar to aspirin. CONCLUSIONS: In PAD patients, terutroban dose-dependently inhibited platelet aggregation 24 h after dosing, and was at least as effective as aspirin at 5, 10 and 30 mg day(-1). Terutroban was well tolerated.

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 µm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 µm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Night-day blood pressure ratio and dipping pattern as predictors of death and cardiovascular events in hypertension.

Our objective was to assess the prognostic significance of the night-time dipping pattern and the night-day blood pressure (BP) ratio for mortality and cardiovascular events in hypertensive patients without major cardiovascular disease at baseline. We performed a meta-analysis on individual data of 3468 patients from four prospective studies performed in Europe. Age of the subjects averaged 61+/-13 years; 45% were men and 61% were under antihypertensive treatment at the time of ambulatory BP monitoring. The night-day BP ratio and 24-h BP averaged, respectively, 0.907+/-0.085/0.866+/-0.095 and 138.1+/-16.4/82.3+/-11.0 mm Hg. Total follow-up time amounted to 23 164 patient-years. We used multivariable Cox regression analysis to assess the outcome of reverse dippers, non-dippers and extreme dippers vs dippers, and to assess the hazard ratios associated with 1 standard deviation higher night-day BP ratio. In comparison with dippers, and with adjustment for confounders and 24-h BP, the incidence of cardiovascular events was worse in reverse dippers (P

A clinical approach to the management of a patient with suspected renovascular disease who presents with leg ischemia.

Atherosclerotic renal artery stenosis (ARAS) may cause hypertension, progressive renal failure, and recurrent pulmonary edema. It typically occurs in high risk patients with coexistent vascular disease elsewhere. Most patients with ARAS are likely to die from coronary heart disease or stroke before end-stage renal failure occurs. Recent controlled trials have shown that most patients undergoing angioplasty to treat renovascular hypertension still need antihypertensive agents 6 or 12 months after the procedure. Nevertheless, the number of antihypertensive agents required to control blood pressure adequately is lower following angioplasty than for medication alone. Trials assessing the value of revascularization for preserving renal function or preventing clinical events are only in the early recruitment phase. Revascularization should be undertaken in patients with ARAS and resistant hypertension or heart failure, and probably in those with rapidly deteriorating renal function or with an increase in plasma creatinine levels during angiotensin-converting enzyme inhibition. With or without revascularization, medical therapy using antihypertensive, hypolipidemic and antiplatelet agents is necessary in almost all cases.

Relationship between left ventricular mass and blood pressure in treated hypertension.

This study evaluated prospectively whether there is still a relationship between left ventricular mass and blood pressure once hypertension is treated and determined the relative importance of daytime vs night-time blood pressure, systolic vs diastolic blood pressure and office vs ambulatory blood pressure. A total of 649 patients (305 or 47% female) with essential hypertension, treated with antihypertensive drugs for at least 3 months, underwent office blood pressure measurement and both daytime and night-time ambulatory blood pressure measurement, electrocardiography and echocardiography. Correlations were made between blood pressure values and parameters of left ventricular mass. Electrocardiographic voltage criteria and even more so echocardiographic parameters correlate significantly albeit weakly (r < or = 0.28) with blood pressure in treated hypertension. Correlations are consistently higher when systolic blood pressure is considered. Overall, the best correlations are found between 24-h ambulatory systolic or night-time blood pressure and the Sokolow-Lyon voltage as well as the echocardiographic age and body mass index adjusted left ventricular mass. In conclusion, once hypertension is treated, the relationship between blood pressure and left ventricular mass is low. Nevertheless, in this the largest single centre study of its kind, echocardiographic parameters of left ventricular mass in treated hypertensive subjects correlate better with blood pressure than electrocardiographic parameters. Parameters of hypertrophy are more closely related to systolic blood pressure than to diastolic blood pressure. In accordance with the finding that dippers have a better prognosis than non-dippers, night-time blood pressure consistently correlates better with left ventricular mass than daytime blood pressure.

Twenty-four hour ambulatory blood pressure in the Hypertension Optimal Treatment (HOT) study.

BACKGROUND AND AIMS: The Hypertension Optimal Treatment (HOT) study showed that when antihypertensive treatment reduces diastolic blood pressure well below 90 mmHg, there can be a further reduction of cardiovascular events, particularly myocardial infarction, with no evidence of a J-shaped curve at lower pressures. Office measurement, however, gives no information about blood pressure outside the office. This paper describes a HOT substudy in which patients underwent both office measurement and 24 h ambulatory blood pressure monitoring. METHODS: The mean age of the substudy population was 62 +/- 7 years. Substudy patients were treated for a median period of 2 years. All received the dihydropyridine calcium antagonist felodipine, while some also received an ACE-inhibitor, a beta-blocker or a diuretic. Average 24 h, day and night ambulatory blood pressure values were computed at baseline (n = 277) and during treatment (n = 347): 112 patients had been randomized to a target office diastolic blood pressure

Relationship between periventricular or deep white matter lesions and arterial elasticity indices in very old people.

OBJECTIVE: To examine the relationship between the presence of cerebral white matter lesions and large and small artery elasticity indices in a population of healthy, very old subjects. METHODS: We studied 24 subjects (14 women, 10 men) with a mean age of 84+/-5 years, who were free from overt neurological, cardiovascular or psychiatric illness. We measured blood pressure and heart rate in supine and standing positions. Elasticity indices of the large arteries (C1) and small arteries (C2) were derived from radial artery pulse waves. Each subject had multi-slice spin-echo cerebral magnetic resonance imaging. The severity of white matter lesions was graded as 0, 1 or 2. RESULTS: Cerebral white matter lesions on magnetic resonance imaging were common in very old apparently healthy subjects: grade 0 (n=4, C1=2.68+/-1.80 ml/mmHg and C2=0.045+/-0.017 ml/mmHg), grade 1 (n=7, C1=2.13+/-0.36 ml/mmHg and C2=0.040+/-0.016 ml/mmHg) and grade 2 (n=13, C1=1.12+/-0.36 ml/mmHg and C2=0.018+/-0.003 ml/mmHg). There was no significant association between elasticity indices and blood pressure. CONCLUSION: In very old, apparently healthy subjects, both large and small artery elasticity indices were inversely related to the severity of cerebral white matter lesions on magnetic resonance imaging.

A comparison between systolic and diastolic pulse contour analysis in the evaluation of arterial stiffness.

Several methodologically independent measures of arterial stiffness derived from either the systolic or diastolic segments of the arterial pulse have been proposed. The exact nature of the large and small artery elasticity indices (C1 and C2, respectively) derived from diastolic pulse contour analysis remains largely unexplored, although C2 has controversially been termed to be "oscillatory" and "reflective." We investigated the relation between C2 and, respectively, a prototype of arterial reflectivity (ie, the augmentation index, AIx) and a covariate of arterial reflectivity (body height). A validated transfer function is used to transform a tonometrically obtained radial pressure wave into an ascending aortic pressure wave, from which AIx is derived using systolic pulse contour analysis. Diastolic pulse contour analysis using a modified Windkessel model is used to derive C1 and C2. One hundred subjects, who were free from atherothrombotic disease and 19 to 77 years of age, with a wide pressure range (97 to 186/52 to 104 mm Hg) were studied. Mean values of C1, C2, AIx, and body height were, respectively, 13.8+/-4.3 mL/mm Hgx10, 5.9+/-3.1 mL/mm Hgx100, 128.5+/-24.9%, and 169+/-9 cm. Coefficients of variation were 32.8% for C1, 33.3% for C2, and 6.7% for AIx. C2 was significantly and inversely correlated to AIx (r=-0.707, P<0.001). Both AIx and C2 were correlated to body height (r=-0.487, P<0.001, and r=0.514, P<0.001). In conclusion, the results of this study provide the first clinical evidence that validates a probable biophysical equivalent of the C2 element of a third-order, 4-element modified Windkessel model. We suggest that C2 is, at least in part, a measure of arterial wave reflectance. However, although short-term reproducibility of AIx is excellent, C2 showed markedly increased variability with the devices used.

Interchangeability of carotid and femoral intima-media thickness in risk stratification.

BACKGROUND: Carotid intima-media thickness (c-IMT) is an intermediate phenotype not only for the local but also the global arteriosclerotic status, a concept which has been validated by its ability to act as a marker for future cardiovascular and cerebrovascular events. Whether the association between c-IMT and risk factors, distant atherosclerotic disease and prognosis are the sole prerogative of the carotid artery, or whether these findings can be extrapolated to other arterial sites is less well studied. In view of the concept of vascular heterogeneity, we measured the IMT in a muscular, lower extremity artery, the common femoral (f-IMT), and in elastic upper extremity artery, the common carotid, in apparently healthy individuals and explored the relationship with risk factors and the individuals 10-year cardiovascular (CV) risk, calculated using the Framingham systolic blood pressure equation. METHODS: A population of 156 apparently healthy normotensive Caucasian volunteers between 18 and 65 years was studied (mean age 43+/-13 years; 68 men, 88 women; mean arterial blood pressure 126 +/- 15/70 +/- 10 mmHg). The c-IMT and f-IMT were measured using a 10 MHz vascular linear array transducer at the far walls 1 to 2 centimetres proximal to the right common carotid and right common femoral artery bifurcations, respectively. Risk factors were assessed and the 10-year cardiovascular risk was calculated using the Framingham systolic blood pressure equation. RESULTS: The median c-IMT was 0.52 mm (interquartile range 0.45-0.62 mm) and f-INT was 0.52 mm (0.39-0.67). Both parameters were significantly correlated (r = 0.363; p < 0.01) and both were significantly correlated to the calculated 10-year CV risk (r = 0.579; p < 0.01 and r = 0.574; p < 0.01 for the carotid and c-IMT and f-IMT, respectively). Median risk was low: 2.11% (0.27-5.50). Although measures of agreement were higher for the f-IMT versus risk (0.47) than for the c-IMT versus risk (0.30), the former showed a significantly wider scatter with increasing age and with quartiles of CV risk. The c-IMT and f-IMT do not share determinant risk factors to the same extent and with only 20% of mutual variance explained, cannot be regarded as interchangeable. CONCLUSIONS: Although the c-IMT and f-IMT are significantly intercorrelated and correlate to the calculated 10-year CV risk, they are not interchangeable. While the f-IMT is less suited as a continuous variable for risk stratification in a low-risk population, our data suggest its possible use as a dichotomised risk marker.

Serum vitamin C concentration is low in peripheral arterial disease and is associated with inflammation and severity of atherosclerosis.

BACKGROUND: Peripheral arterial disease (PAD) is a severe atherosclerotic condition frequently accompanied by inflammation and oxidative stress. We hypothesized that vitamin C antioxidant levels might be low in PAD and are related to inflammation and disease severity. METHODS AND RESULTS: We investigated vitamin C (L-ascorbic acid) levels in 85 PAD patients, 106 hypertensives without PAD, and 113 healthy subjects. Serum L-ascorbic acid concentrations were low among PAD patients (median, 27.8 micromol/L) despite comparable smoking status and dietary intake with the other groups (P<0.0001). Subclinical vitamin C deficiency (<11.4 micromol/L), confirmed by low serum alkaline phosphatase activity, was found in 14% of the PAD patients but not in the other groups. Serum C-reactive protein (CRP) concentrations were significantly higher in PAD patients (P<0.0001) and negatively correlated with L-ascorbic acid levels (r=-0.742, P<0.0001). In stepwise multivariate analysis, low L-ascorbic acid concentration in PAD patients was associated with high CRP level (P=0.0001), smoking (P=0.0009), and shorter absolute claudication distance on a standardized graded treadmill test (P=0.029). CONCLUSIONS: Vitamin C concentrations are lower in intermittent claudicant patients in association with higher CRP levels and severity of PAD. Future studies attempting to relate vitamin C levels to disease occurrence should include in their analysis an inflammatory marker such as CRP.

Small and large artery elasticity indices in peripheral arterial occlusive disease (PAOD).

In peripheral arterial occlusive disease (PAOD), arterial compliance of the central arteries has been reported to be reduced. It is, however, not clear whether, in PAOD, decreased arterial compliance is also accompanied by similar changes in the peripheral arteries. Therefore the aim of the study was to determine the large (C1) and small (C2) artery elasticity indices in PAOD and their relations to its well-accepted characteristics (ankle-brachial index, ABI; pulse pressure, PP; absolute claudication distance, ACD). A total of 43 patients with PAOD (mean age 68 +/- 9 years; ABI of the limiting leg 0.65 +/- 0.14; SBP (systolic blood pressure) 149 +/- 20 mmHg, and ACD 488 +/- 187 m) were enrolled as well as 16 control subjects of comparable age (69 +/- 4 years) and blood pressure (SBP 147 +/- 27 mmHg). All subjects underwent non-invasive pulse wave analysis in order to determine arterial compliance of the aorta and major side branches (C1) and of the distal circulation (C2), using a modified Windkessel model. In PAOD, both C1 (1.41 +/- 0.56 ml/mmHg) and C2 (0.023 +/- 0.012 ml/mmHg) were comparable to values in an age and blood pressure-matched control group (C1, 1.25 +/- 0.66 ml/mmHg; C2, 0.027 +/- 0.008 ml/mmHg). C1 was significantly correlated with ACD (r = 0.36, p = 0.02), PP (r = -0.33, p < 0.02) and only borderline with ABI (r = 0.28, p = 0.07). C2 was correlated with PP (r = -0.38, p < 0.01), ABI (r = 0.36, p < 0.02) but not with ACD. Large (C1) and small (C2) artery elasticity indices in PAOD were decreased but comparable to values in an elderly group with isolated systolic hypertension. Moreover, C1 and C2 correlated with markers (ABI and PP) of severity of vascular disease.

Naftidrofuryl in quality of life (NIQOL). A Belgian study.

BACKGROUND: Using a disease specific questionnaire, the Claudication Scale (CLAU-S), we undertook a double blind, placebo controlled study in patients with intermittent claudication (IC) to determine whether the increase in the pain-free walking distance, previously demonstrated with naftidrofuryl, is reflected as an improvement in the patients' quality of life. METHODS: Following an initial one month placebo run-in 235 patients, with stable IC for at least 3 months, were randomized to either naftidrofuryl (Praxilene), at a dosage of 200 mg three times daily, or matching placebo, for 6 months. All patients completed the self-administered CLAU-S questionnaire which is divided into 6 dimensions, before the start of treatment, at 3 and at 6 months. Statistical analysis was undertaken on an intention-to-treat (ITT) basis which included all patients known to have taken at least one dose of the drug and to have provided key data on at least one occasion after baseline. For each of the CLAU-S dimensions the two groups were compared in respect to difference between the initial and final values. RESULTS: Two hundred and twenty patients (108 naftidrofuryl, 112 placebo) were eligible for the ITT analysis. Significant improvements, in favour of the active medication, were seen for the dimensions Daily living, Pain and Social life (all p<0.01). For the dimensions complaints, disease specific fears and mood, there were no significant differences between naftidrofuryl and placebo. A multivariate analysis of covariance, which took into account such factors as initial score, age and sex confirmed the global superiority of naftidrofuryl (p=0.047). CONCLUSIONS: In this placebo controlled study, using a disease specific questionnaire, naftidrofuryl has been shown to significantly improve several aspects of the quality of life of patients with IC.

Relationship between arterial elasticity indices and carotid artery intima-media thickness.

Functional and structural changes of the arterial wall appear to serve as early hallmarks of the hypertensive disease process. Structural vascular changes can be studied by the determination of the intima-media wall thickness (IMT) at the carotid artery. The elastic behavior of the proximal and distal parts of the arterial tree can be assessed from noninvasively recorded radial artery waveforms. The aim of the study was to compare large (proximal, C1) and small (distal, C2) artery elasticity indices in two age-matched study groups with high- and low-normal blood pressure (BP) and to assess the relation between elasticity indices and IMT. A total number of 22 subjects with high-normal BP (40 +/- 2 years; BP, 147 +/- 2.5/84 +/- 1.5 mm Hg) and 22 matched controls with low-normal BP (40 +/- 2 years; BP, 123 +/- 1.9/69 +/- 1.5 mm Hg) were enrolled. The IMT was echographically determined at the common carotid artery by the leading-edge technique. Large artery (C1) and small artery (C2) elasticity indices were calculated from a third-order, four-element model of the arterial circulation. In the group with high-normal BP large and small artery elasticity indices were significantly decreased versus controls with low-normal BP (C1: 1.63 +/- 0.08 v 1.99 +/- 0.09 mL/mm Hg, P < .01; C2: 0.059 +/- 0.005 v 0.076 +/- 0.007 mL/ mm Hg, P < .05) and IMT increased significantly (0.607 +/- 0.039 v 0.516 +/- 0.027 mm, P < .05). Moreover, there was an inverse relationship between IMT and small artery elasticity index (r = -0.60, P = .004). In subjects with a high-normal BP there is already a change in the IMT of the carotid artery versus normotension. The IMT is related to the small artery elasticity index (C2).

Aldosterone and vascular damage.

Although the aldosterone escape mechanism is well known, aldosterone has often been neglected in the pathophysiologic consequences of the activated renin-angiotensin-aldosterone system in arterial hypertension and chronic heart failure. There is now evidence for vascular synthesis of aldosterone aside from its secretion by the adrenal cortex. Moreover, aldosterone is involved in vascular smooth muscle cell hypertrophy and hyperplasia, as well as in vascular matrix impairment and endothelial dysfunction. The mechanisms of action of aldosterone may be either delayed (genomic) or rapid (nongenomic). Deleterious effects of aldosterone leading to vascular target-organ damage include (besides salt and water retention) decreased arterial and venous compliance, increased peripheral vascular resistance, and impaired autonomic vascular control due to baroreflex dysfunction.

Infarct size and recurrence of ventricular arrhythmias after defibrillator implantation.

Infarct size as determined by perfusion imaging is an independent predictor of mortality after implantable cardioverter defibrillator (ICD) implantation in patients with coronary artery disease (CAD) and life-threatening ventricular arrhythmias (VA). However, its value as a predictor of VA recurrence and hospitalisation after ICD implantation is unknown. Therefore, the objective of this study was to evaluate whether infarct size as determined by perfusion imaging can help to identify patients who are at high risk for recurrence of VA and hospitalisation after ICD implantation. We studied 56 patients with CAD and life-threatening VA. Before ICD implantation, all patients underwent a uniform study protocol including a thallium-201 stress-redistribution perfusion study. A defect score as a measurement of infarct size was calculated using a 17-segment 5-point scoring system. Study endpoints during follow-up were documented episodes of appropriate anti-tachycardia pacing and/or shocks for VA and cardiac hospitalisation for electrical storm (defined as three or more appropriate ICD interventions within 24 h), heart failure or angina. After a mean follow-up of 470+/-308 days, 22 patients (39%) had recurrences of VA. In univariate analysis, predictors for recurrence were: (a) ventricular tachycardia (VT) as the initial presenting arrhythmia (86% vs 59% for patients without ICD therapy, P=0.04), (b) treatment with beta-blockers (36% vs 68%, P=0.03) and (c) a defect score (DS) > or = 20 (64% vs 32%, P=0.03). In multivariate analysis, VT as the presenting arrhythmia (chi2=5.51, P=0.02) and a DS > or = 20 (chi2=4.22, P=0.04) remained independent predictors. Cardiac hospitalisation was more frequent in patients with a DS > or = 20 (44% vs 13% for patients with DS < 20, P=0.015) and this was particularly due to more frequent hospitalisations for electrical storm (24% vs 3% for patients with DS < 20, P=0.037). The extent of scarring determined by perfusion imaging can separate patients with CAD into high- and low-risk groups for recurrence of VA and cardiac hospitalisation after ICD implantation.

Cardiac involvement in pheochromocytoma.

We report the details of a 40-year-old farmer, a cigarette smoker, who was admitted with general malaise, nausea, vomiting, upper abdominal pain, with ST-elevation on ECG suggestive of an acute anterolateral myocardial infarction. He was treated with nitrates, heparin, beta-blockade and angiotensin-converting enzyme (ACE) inhibitors. Because of the presence of some blood while vomiting no thrombolysis was given and abdominal echography was performed. This revealed a nodular mass at the right adrenal gland. Urinary catecholamines and abdominal magnetic resonance imaging confirmed the suspected diagnosis of pheochromocytoma. Before adrenectomy, a coronary angiography under alpha blocker therapy was performed, which demonstrated no significant coronary artery disease, although the patient showed ST-elevations on ECG. Pathological examination of the adrenal tumor was compatible with a diagnosis of pheochromocytoma. Postoperatively urinary catecholamines dropped dramatically, and the ECG normalised slowly over time. After 8 months the patient is still well. Blood pressure is well controlled with no antihypertensive drugs and exercise testing shows no evidence of myocardial ischaemia.