Robust, defensible, and fair: The AMEE guide to selection into medical school: AMEE Guide No. 153.

Selection is the first assessment of medical education and training. Medical schools must select from a pool of academically successful applicants and ensure that the way in which they choose future clinicians is robust, defensible, fair to all who apply and cost-effective. However, there is no comprehensive and evidence-informed guide to help those tasked with setting up or rejuvenating their local selection process. To address this gap, our guide draws on the latest research, international case studies and consideration of common dilemmas to provide practical guidance for designing, implementing and evaluating an effective medical school selection system. We draw on a model from the field of instructional design to frame the many different activities involved in doing so: the ADDIE model. ADDIE provides a systematic framework of Analysis (of the outcomes to be achieved by the selection process, and the barriers and facilitators to achieving these), Design (what tools and content are needed so the goals of selection are achieved), Development (what materials and resources are needed and available), Implementation (plan [including piloting], do study and adjust) and Evaluation (quality assurance is embedded throughout but the last step involves extensive evaluation of the entire process and its outcomes).HIGHLIGHTSRobust, defensible and fair selection into medical school is essential. This guide systematically covers the processes required to achieve this, from needs analysis through design, development and implementation, to evaluation of the success of a selection process.

The hypoxia-sensor carbonic anhydrase IX affects macrophage metabolism, but is not a suitable biomarker for human cardiovascular disease.

Hypoxia is prevalent in atherosclerotic plaques, promoting plaque aggravation and subsequent cardiovascular disease (CVD). Transmembrane protein carbonic anhydrase IX (CAIX) is hypoxia-induced and can be shed into the circulation as soluble CAIX (sCAIX). As plaque macrophages are hypoxic, we hypothesized a role for CAIX in macrophage function, and as biomarker of hypoxic plaque burden and CVD. As tumor patients with probable CVD are treated with CAIX inhibitors, this study will shed light on their safety profile. CAIX co-localized with macrophages (CD68) and hypoxia (pimonidazole), and correlated with lipid core size and pro-inflammatory iNOS+ macrophages in unstable human carotid artery plaques. Although elevated pH and reduced lactate levels in culture medium of CAIX knock-out (CAIXko) macrophages confirmed its role as pH-regulator, only spare respiratory capacity of CAIXko macrophages was reduced. Proliferation, apoptosis, lipid uptake and expression of pro- and anti-inflammatory genes were not altered. Plasma sCAIX levels and plaque-resident CAIX were below the detection threshold in 50 and 90% of asymptomatic and symptomatic cases, respectively, while detectable levels did not associate with primary or secondary events, or intraplaque hemorrhage. Initial findings show that CAIX deficiency interferes with macrophage metabolism. Despite a correlation with inflammatory macrophages, plaque-resident and sCAIX expression levels are too low to serve as biomarkers of future CVD.

Gene profiling of cathepsin K deficiency in atherogenesis: profibrotic but lipogenic.

Recently, we showed that cathepsin K deficiency reduces atherosclerotic plaque progression, induces plaque fibrosis, but aggravates macrophage foam cell formation in the ApoE -/- mouse. To obtain more insight into the molecular mechanisms by which cathepsin K disruption evokes the observed phenotypic changes, we used microarray analysis for gene expression profiling of aortic arches of CatK -/-/ApoE -/- and ApoE -/- mice on a mouse oligo microarray. Out of 20 280 reporters, 444 were significantly differentially expressed (p-value of < 0.05, fold change of > or = 1.4 or < or = - 1.4, and intensity value of > 2.5 times background in at least one channel). Ingenuity Pathway Analysis and GenMAPP revealed upregulation of genes involved in lipid uptake, trafficking, and intracellular storage, including caveolin - 1, - 2, - 3 and CD36, and profibrotic genes involved in transforming growth factor beta (TGFbeta) signalling, including TGFbeta2, latent TGFbeta binding protein-1 (LTBP1), and secreted protein, acidic and rich in cysteine (SPARC), in CatK -/-/ApoE -/- mice. Differential gene expression was confirmed at the mRNA and protein levels. In vitro modified low density lipoprotein (LDL) uptake assays, using bone marrow derived macrophages preincubated with caveolae and scavenger receptor inhibitors, confirmed the importance of caveolins and CD36 in increasing modified LDL uptake in the absence of cathepsin K. In conclusion, we suggest that cathepsin K deficiency alters plaque phenotype not only by decreasing proteolytic activity, but also by stimulating TGFbeta signalling. Besides this profibrotic effect, cathepsin K deficiency has a lipogenic effect owing to increased lipid uptake mediated by CD36 and caveolins.

Is there more than C-reactive protein and fibrinogen? The prognostic value of soluble CD40 ligand, interleukin-6 and oxidized low-density lipoprotein with respect to coronary and cerebral vascular disease.

Incidence of atherosclerosis and atherosclerosis-related complications will increase significantly in the coming decennia. Research identified many serum and plasma markers that are associated with cardiovascular disease. However, little is known about the prognostic value of these markers to identify patients at risk for future cardiovascular events. Therefore, we aimed to investigate the prognostic value of three of these markers (soluble CD40 ligand (sCD40L), interleukin-6 (IL-6) and oxidized low-density lipoprotein (oxLDL)) with respect to coronary vascular disease and stroke. For this reason the Medline database was searched for the period January 1999-January 2005. To be selected in our study, concentration of the marker had to be determined at baseline, follow-up period had to be longer than 3 months and an estimate of relative risk had to be available. Based on these criteria, 4 studies for sCD40L, 10 for IL-6 and 2 for oxLDL were selected. Relative risk estimates adjusted for potential confounders varied between 1.9 and 2.8 for sCD40L, between 1.1 and 3.1 for IL-6 and between 1.9 and 3.2 for oxLDL. In conclusion, this systematic review shows that sCD40L, IL-6 and oxLDL are associated with an increased relative risk of developing cardiovascular disease.

Disruption of the cathepsin K gene reduces atherosclerosis progression and induces plaque fibrosis but accelerates macrophage foam cell formation.

BACKGROUND: Cathepsin K (catK), a lysosomal cysteine protease, was identified in a gene-profiling experiment that compared human early plaques, advanced stable plaques, and advanced atherosclerotic plaques containing a thrombus, where it was highly upregulated in advanced stable plaques. METHODS AND RESULTS: To assess the function of catK in atherosclerosis, catK(-/-)/apolipoprotein (apo) E(-/-) mice were generated. At 26 weeks of age, plaque area in the catK(-/-)/apoE(-/-) mice was reduced (41.8%) owing to a decrease in the number of advanced lesions as well as a decrease in individual advanced plaque area. This suggests an important role for catK in atherosclerosis progression. Advanced plaques of catK(-/-)/apoE(-/-) mice showed an increase in collagen content. Medial elastin fibers were less prone to rupture than those of apoE(-/-) mice. Although the relative macrophage content did not differ, individual macrophage size increased. In vitro studies of bone marrow derived-macrophages confirmed this observation. Scavenger receptor-mediated uptake (particularly by CD36) of modified LDL increased in the absence of catK, resulting in an increased macrophage size because of increased cellular storage of cholesterol esters, thereby enlarging the lysosomes. CONCLUSIONS: A deficiency of catK reduces plaque progression and induces plaque fibrosis but aggravates macrophage foam cell formation in atherosclerosis.

Accumulation of ultrasmall superparamagnetic particles of iron oxide in human atherosclerotic plaques can be detected by in vivo magnetic resonance imaging.

BACKGROUND: One of the features of high-risk atherosclerotic plaques is a preponderance of macrophages. Experimental studies with hyperlipidemic rabbits have shown that ultrasmall superparamagnetic particles of iron oxide (USPIOs) accumulate in plaques with a high macrophage content and that this induces magnetic resonance (MR) signal changes. The purpose of our study was to investigate whether USPIO-enhanced MRI can also be used for in vivo detection of macrophages in human plaques. METHODS AND RESULTS: MRI was performed on 11 symptomatic patients scheduled for carotid endarterectomy before and 24 (n=11) and 72 (n=5) hours after administration of USPIOs (Sinerem) at a dose of 2.6 mg Fe/kg. Histological and electron microscopical analyses of the plaques showed USPIOs primarily in macrophages within the plaques in 10 of 11 patients. Histological analysis showed USPIOs in 27 of 36 (75%) of the ruptured and rupture-prone lesions and 1 of 14 (7%) of the stable lesions. Of the patients with USPIO uptake, signal changes in the post-USPIO MRI were observed by 2 observers in the vessel wall in 67 of 123 (54%) and 19 of 55 (35%) quadrants of the T2*-weighted MR images acquired after 24 and 72 hours, respectively. For those quadrants with changes, there was a significant signal decrease of 24% (95% CI, 33% to 15%) in regions of interest in the images acquired after 24 hours, whereas no significant signal change was found after 72 hours. CONCLUSIONS: Accumulation of USPIOs in macrophages in predominantly ruptured and rupture-prone human atherosclerotic lesions caused signal decreases in the in vivo MR images.

Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques.

In the present study, we examined the expression of regulators of bone formation and osteoclastogenesis in human atherosclerosis because accumulating evidence suggests that atherosclerotic calcification shares features with bone calcification. The most striking finding of this study was the constitutive immunoreactivity of matrix Gla protein, osteocalcin, and bone sialoprotein in nondiseased aortas and the absence of bone morphogenetic protein (BMP)-2, BMP-4, osteopontin, and osteonectin in nondiseased aortas and early atherosclerotic lesions. When atherosclerotic plaques demonstrated calcification or bone formation, BMP-2, BMP-4, osteopontin, and osteonectin were upregulated. Interestingly, this upregulation was associated with a sustained immunoreactivity of matrix Gla protein, osteocalcin, and bone sialoprotein. The 2 modulators of osteoclastogenesis (osteoprotegerin [OPG] and its ligand, OPGL) were present in the nondiseased vessel wall and in early atherosclerotic lesions. In advanced calcified lesions, OPG was present in bone structures, whereas OPGL was only present in the extracellular matrix surrounding calcium deposits. The observed expression patterns suggest a tight regulation of the expression of bone matrix regulatory proteins during human atherogenesis. The expression pattern of both OPG and OPGL during atherogenesis might suggest a regulatory role of these proteins not only in osteoclastogenesis but also in atherosclerotic calcification.

Identification of genes potentially involved in rupture of human atherosclerotic plaques.

Although rupture of an atherosclerotic plaque is the major cause of acute vascular occlusion, the exact molecular mechanisms underlying this process are still poorly understood. In this study, we used suppression subtractive hybridization to make an inventory of genes that are differentially expressed in whole-mount human stable and ruptured plaques. Two libraries were generated, one containing 3000 clones upregulated and one containing 2000 clones downregulated in ruptured plaques. Macroarray analysis of 500 randomly chosen clones showed differential expression of 45 clones. Among the 25 clones that showed at least a 2-fold difference in expression was the gene of perilipin, upregulated in ruptured plaques, and the genes coding for fibronectin and immunoglobulin lambda chain, which were downregulated in ruptured plaques. Reverse transcriptase-polymerase chain reaction analysis on 10 individual ruptured and 10 individual stable plaques showed a striking consistency of expression for the clones SSH6, present in 8 ruptured and 2 stable plaques, and perilipin, expressed in 8 ruptured plaques and completely absent in stable plaques. Localization studies of both perilipin mRNA and protein revealed expression in cells surrounding the cholesterol clefts and in foam cells of ruptured atherosclerotic plaques. No expression was observed in nondiseased artery, and only a few cells in the shoulder region of stable plaques tested positive for perilipin. In conclusion, this study shows that it is possible to identify genes that are differentially expressed in whole-mount stable or ruptured atherosclerotic plaques. This approach may yield several potential regulators of plaque destabilization.

Both early and delayed anti-CD40L antibody treatment induces a stable plaque phenotype.

In the present study, we investigated the role of the CD40L-CD40 pathway in a model of progressive atherosclerosis. ApoE-/- mice were treated with an anti-CD40L antibody or a control antibody for 12 wk. Antibody treatment started early (age 5 wk) or was delayed until after the establishment of atherosclerosis (age 17 wk). In both the early and delayed treatment groups, anti-CD40L antibody did not decrease plaque area or inhibit lesion initiation or age-related increase in lesion area. The morphology of initial lesions was not affected, except for a decrease in T-lymphocyte content. Effects of anti-CD40L antibody treatment on the morphology of advanced lesions were pronounced. In both the early and delayed treatment groups, T-lymphocyte content was significantly decreased. Furthermore, a pronounced increase in collagen content, vascular smooth muscle cell/myofibroblast content, and fibrous cap thickness was observed. In the delayed treatment group, a decrease in lipid core and macrophage content occurred. Interestingly, advanced lesions of anti-CD40L antibody-treated mice exhibited an increased transforming growth factor beta1 immunoreactivity, especially in macrophages. In conclusion, both early and delayed treatment with an anti-CD40L antibody do not affect atherosclerotic lesion initiation but do result in the development of a lipid-poor collagen-rich stable plaque phenotype. Furthermore, delayed treatment with anti-CD40L antibody can transform the lesion profile from a lipid-rich to a lipid-poor collagen-rich phenotype. Postulated mechanisms of this effect on plaque phenotype are the down-regulation of proinflammatory pathways and up-regulation of collagen-promoting factors like transforming growth factor beta.

An Sp1 binding site is essential for basal activity of the human prostate-specific transglutaminase gene (TGM4) promoter.

Human prostate-specific transglutaminase (hTG(P)) is a cross-linking enzyme encoded by the TGM4 gene. The TGM4 gene promoter was characterized by deletion mapping and mutational analysis. Promoter constructs, containing the minimal promoter requirements, could efficiently drive transcription in the prostate cancer cell lines PC346C and LNCaP and the hepatic cancer cell line Hep3B. The region between positions -113 and -61 was demonstrated to be essential for core promoter activity. Further analysis revealed the functional importance of an Sp1 binding motif, 5'-ACCCCGCCCC-3', at positions -96 to -87. This sequence is a binding site of the ubiquitous transcription factors Sp1 and Sp3.

A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans.

Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene.

An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter.

Prostate-specific antigen (PSA) is expressed at a high level in the luminal epithelial cells of the prostate and is absent or expressed at very low levels in other tissues. PSA expression can be regulated by androgens. Previously, two functional androgen-response elements were identified in the proximal promoter of the PSA gene. To detect additional, more distal control elements, DNasel-hypersensitive sites (DHSs) upstream of the PSA gene were mapped in chromatin from the prostate-derived cell line LNCaP grown in the presence and absence of the synthetic androgen R1881. In a region 4.8 to 3.8 kb upstream of the transcription start site of the PSA gene, a cluster of three DHSs was detected. The middle DNAseI-hypersensitive site (DHSII, at approximately -4.2 kb) showed strong androgen responsiveness in LNCaP cells and was absent in chromatin from HeLa cells. Further analysis of the region encompassing DHSII provided evidence for the presence of a complex, androgen-responsive and cell-specific enhancer. In transient transfected LNCaP cells, PSA promoter constructs containing this upstream enhancer region showed approximately 3000-fold higher activity in the presence than in the absence of R1881. The core region of the enhancer could be mapped within a 440-bp fragment. The enhancer showed synergistic cooperation with the proximal PSA promoter and was found to be composed of at least three separate regulatory regions. In the center, a functionally active, high-affinity androgen receptor binding site (GGAACATATTGTATC) could be identified. Mutation of this element almost completely abolished PSA promoter activity. Transfection experiments in prostate and nonprostate cell lines showed largely LNCaP cell specificity of the upstream enhancer region, although some activity was found in the T47D mammary tumor cell line.

Androgen-regulated gene expression in prostate cancer.

Androgen-regulated gene expression is mediated by the ligand-activated androgen receptor. Androgen receptor target genes contain in the regulatory regions one or more androgen response elements. Development of the male urogenital tract, including the prostate, depends on an activated androgen receptor. Similarly, growth of the majority of prostate cancers is androgen-dependent. Therefore, endocrine therapy, aimed at inhibition of androgen receptor functioning, has been applied for many years. However, during therapy, apparently androgen receptor independent cancers continue to grow. In general, these tumors still express the androgen receptor, suggesting a functional role of the androgen receptor. In a proportion of late stage prostate tumors, mutations and amplification of the androgen receptor gene have been found. Additionally, it has been hypothesized that ligand-independent androgen receptor activation can be involved in hormone refractory prostate cancer.

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter.

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.