Complete remission with immunotherapy: Case report of a patient with metastatic bladder cancer to the humerus.

Bladder cancer is the sixth most common malignancy in the United States. Cisplatin combination regimens are first line therapy for patients with metastatic urothelial bladder cancer who are eligible candidates and no treatments have shown to improve outcome compared to chemotherapy for the past 20 years. Significant advances were made in past 2-3 years and the most significant was the introduction of checkpoints inhibitors in bladder cancer treatment. We present a patient diagnosed with metastatic urothelial carcinoma who progressed while on cisplatin/gemcitabine chemotherapy in the form of oligometastasis to the bone. He has achieved a durable complete response with atezolizumab.

Efatutazone, an oral PPAR-γ agonist, in combination with paclitaxel in anaplastic thyroid cancer: results of a multicenter phase 1 trial.

PURPOSE: A phase 1 study was initiated to determine the safety, potential effectiveness, and maximal tolerated dose and recommended phase 2 dose of efatutazone and paclitaxel in anaplastic thyroid cancer. EXPERIMENTAL DESIGN: Patients received efatutazone (0.15, 0.3, or 0.5 mg) orally twice daily and then paclitaxel every 3 weeks. Patient tolerance and outcomes were assessed, as were serum efatutazone pharmacokinetics. RESULTS: Ten of 15 patients were women. Median age was 59 years. Seven patients received 0.15 mg of efatutazone, 6 patients received 0.3 mg, and 2 patients received 0.5 mg. One patient receiving 0.3 mg of efatutazone had a partial response from day 69 to day 175; 7 patients attained stable disease. Median times to progression were 48 and 68 days in patients receiving 0.15 mg of efatutazone and 0.3 mg of efatutazone, respectively; corresponding median survival was 98 vs 138 days. The median peak efatutazone blood level was 8.6 ng/mL for 0.15-mg dosing vs 22.0 ng/mL for 0.3-mg twice daily dosing. Ten patients had grade 3 or greater adverse events (Common Terminology Criteria for Adverse Events), with 2 of these (anemia and edema) related to efatutazone. Thirteen events of edema were reported in 8 patients, with 2 of grade 3 or greater. Eight patients had ≥1 serious adverse event, with 1 of these (anemia) attributed to efatutazone and 1 (anaphylactic reaction) related to paclitaxel. The maximal tolerated dose was not achieved. Angiopoietin-like 4 was induced by efatutazone in tissue biopsy samples of 2 patients. CONCLUSIONS: Efatutazone and paclitaxel in combination were safe and tolerated and had biologic activity.

Expression of the PAX8/PPARγ Fusion Protein Is Associated with Decreased Neovascularization In Vivo: Impact on Tumorigenesis and Disease Prognosis.

The PAX8/PPARγ fusion protein (PPFP) occurs in 36% of human follicular thyroid carcinoma (FTC) and is associated with favorable prognosis. To elucidate the function of PPFP in FTC, we analyzed the consequences of PPFP expression in immortalized thyrocytes in vitro and in vivo via xenograft tumorigenesis. While PPFP-expressing cells exhibited oncogenic hallmarks, including increased growth and decreased apoptosis, in vitro, xenograft tumors were initiated but not sustained in vivo. PPFP xenograft tumors exhibited reduced CD31 staining and VEGF expression, suggesting that PPFP modulates neovascularization. Microarray analysis demonstrated increased expression of tissue inhibitor of metalloproteinase (TIMP-3), an inhibitor of angiogenesis, in PPFP cells and tumors, a finding confirmed by quantitative PCR and immunohistochemistry. Immunohistochemical staining of archival human thyroid tumors demonstrates a significant decrease in CD31 staining in all adenomas and carcinomas containing the PAX8/PPARγ rearrangement. Decreased angiogenesis in PPFP-containing tumors is directly correlated with our observations in the xenograft model and provides evidence for the first time that PPFP may impact FTC tumorigenesis by modulating angiogenesis in vivo.

Anaplastic thyroid carcinoma: pathogenesis and emerging therapies.

Anaplastic thyroid carcinoma ranges from 1.3 to 9.8% of all thyroid cancers globally. Mutations, amplifications, activation of oncogenes and silencing of tumour suppressor genes contribute to its aggressive behaviour, and recent studies (e.g. microarrays, microRNAs) have provided further insights into its complex molecular dysregulation. Preclinical studies have identified numerous proteins over- or underexpressed that affect critical cellular processes, including transcription, signalling, mitosis, proliferation, cell cycle, apoptosis and adhesion, and a variety of agents that effectively inhibit these processes and tumour growth. In clinical studies of 1771 patients, 64% were women, the median survival was 5 months, and 1-year survival was 20%. The variables associated with survival in some series included age, tumour size, extent of surgery, higher dose radiotherapy, absence of distant metastases at presentation, co-existence of differentiated thyroid cancer and multimodality therapy. However, considerable bias exists in these non-randomised studies. Although more aggressive radiotherapy has reduced locoregional recurrences, the median overall survival has not improved in over 50 years. Newer systemic therapies are being tried, and more effective combinations are needed to improve patient outcomes.

Loss of type III transforming growth factor-beta receptor expression is due to methylation silencing of the transcription factor GATA3 in renal cell carcinoma.

Loss of transforming growth factor-beta receptor III (TbetaRIII) correlates with loss of transforming growth factor-beta (TGF-beta) responsiveness and suggests a role for dysregulated TGF-beta signaling in clear cell renal cell carcinoma (ccRCC) progression and metastasis. Here we identify that for all stages of ccRCC TbetaRIII expression is downregulated in patient-matched tissue samples and cell lines. We find that this loss of expression is not due to methylation of the gene and we define GATA3 as the first transcriptional factor to positively regulate TbetaRIII expression in human cells. We localize GATA3's binding to a 10-bp region of the TbetaRIII proximal promoter. We demonstrate that GATA3 mRNA is downregulated in all stages, of ccRCC, mechanistically show that GATA3 is methylated in ccRCC patient tumor tissues as well as cell lines, and that inhibiting GATA3 expression in normal renal epithelial cells downregulates TbetaRIII mRNA and protein expression. These data support a sequential model whereby loss of GATA3 expression through epigenetic silencing decreases TbetaRIII expression during ccRCC progression.

ONYX-411, a conditionally replicative oncolytic adenovirus, induces cell death in anaplastic thyroid carcinoma cell lines and suppresses the growth of xenograft tumors in nude mice.

Anaplastic thyroid carcinoma (ATC) is the most aggressive thyroid cancer variant, accounting for 1-2% of all cases, but 33% of deaths, and exhibiting an average life expectancy of 5 months. ATC is largely unresponsive to radioactive iodine, chemotherapy, external beam radiation or surgery, underscoring the need for new and effective therapies. We evaluated the therapeutic potential of an oncolytic adenovirus, ONYX-411, that replicates selectively in and kills cells with dysfunction of the retinoblastoma (RB) pathway. In the present study, we report that ONYX-411 is able to induce cell death in eight human anaplastic carcinoma cell lines in vitro. The cytopathic effect of the virus is specific to cells with RB dysfunction, which appears to be frequent in ATC. We confirmed the expression of the coxsackie adenovirus receptor, CAR, in all ATC cell lines, demonstrating the potentially universal application of this oncolytic viral therapy to ATC. In addition, the growth of xenograft tumors induced in athymic mice with the ARO and DRO cell lines was significantly reduced by ONYX-411 treatment. These results indicate that ONYX-411 can be a potential therapeutic agent for the treatment of ATC, rendering this class of conditionally replicating adenoviruses an attractive candidate for clinical trials.

Directed engineering of umbilical cord blood stem cells to produce C-peptide and insulin.

OBJECTIVES: In this study, we investigated the potential of umbilical cord blood stem cell lineages to produce C-peptide and insulin. MATERIALS AND METHODS: Lineage negative, CD133+ and CD34+ cells were analyzed by flow cytometry to assess expression of cell division antigens. These lineages were expanded in culture and subjected to an established protocol to differentiate mouse embryonic stem cells (ESCs) toward the pancreatic phenotype. Phase contrast and fluorescence immunocytochemistry were used to characterize differentiation markers with particular emphasis on insulin and C-peptide. RESULTS: All 3 lineages expressed SSEA-4, a marker previously reported to be restricted to the ESC compartment. Phase contrast microscopy showed all three lineages recapitulated the treatment-dependent morphological changes of ESCs as well as the temporally restricted expression of nestin and vimentin during differentiation. After engineering, each isolate contained both C-peptide and insulin, a result also obtained following a much shorter protocol for ESCs. CONCLUSIONS: Since C-peptide can only be derived from de novo synthesis and processing of pre-proinsulin mRNA and protein, we conclude that these results are the first demonstration that human umbilical cord blood-derived stem cells can be engineered to engage in de novo synthesis of insulin.

Novel high-affinity PPARgamma agonist alone and in combination with paclitaxel inhibits human anaplastic thyroid carcinoma tumor growth via p21WAF1/CIP1.

Peroxisome proliferator-activated receptor gamma (PPARgamma) agonists demonstrate antitumor activity likely through transactivating genes that regulate cell proliferation, apoptosis, and differentiation. The PAX8/PPARgamma fusion oncogene, which is common in human follicular thyroid carcinomas appears to act via dominant negative suppression of wild-type PPARgamma, suggesting that it may be a tumor suppressor gene in thyroid cells. We have identified a novel high-affinity PPARgamma agonist (RS5444) that is dependent upon PPARgamma for its biological activity. This is the first report of this molecule and its antitumor activity. In vitro, the IC50 for growth inhibition is approximately 0.8 nM while anaplastic thyroid carcinoma (ATC) tumor growth was inhibited three- to fourfold in nude mice. siRNA against PPARgamma and a pharmacological antagonist demonstrated that functional PPARgamma was required for growth inhibitory activity of RS5444. RS5444 upregulated the cell cycle kinase inhibitor, p21WAF1/CIP1. Silencing p21WAF1/CIP1 rendered cells insensitive to RS5444. RS5444 plus paclitaxel demonstrated additive antiproliferative activity in cell culture and minimal ATC tumor growth in vivo. RS5444 did not induce apoptosis but combined with paclitaxel, doubled the apoptotic index compared to that of paclitaxel. Our data indicate that functional PPARgamma is a molecular target for therapy in ATC. We demonstrated that RS5444, a thiazolidinedione (Tzd) derivative, alone or in combination with paclitaxel, may provide therapeutic benefit to patients diagnosed with ATC.

Pregnancy, parturition, and prostaglandins: defining uterine leiomyomas.

Leiomyomas, benign smooth muscle tumors of the uterus, are the most common gynecologic neoplasm in women. Studies with surgically resected human tissues and primary cultures have revealed that several genes are differentially expressed in leiomyomas compared to matched normal myometrium. An estrogen-driven pattern of gene expression in leiomyomas, similar to that seen in normal myometrium during pregnancy and parturition, is associated with a persistent inappropriate response of neoplastic myometrial smooth muscle cells to ovarian hormones. This is possibly due to aberrant expression levels or signaling via estrogen and progesterone receptors. We propose the hypothesis that uterine leiomyomas mimic a differentiated myometrial cell at pregnancy and exhibit a hypersensitivity to sex steroid hormones that prevents the cells from responding to normal apoptotic or dedifferentiation signals and from returning to a nongravid phenotype. Support of this hypothesis is derived from experimental studies in female Eker rats that develop uterine leiomyomas with many similarities to the human disease. Our hypothesis accounts for the benign nature of these tumors and their high incidence in women during the reproductive years. By identifying the factors that participate in parturition and involution of the pregnant myometrium, we may better define uterine leiomyomas and thus identify novel targets for therapeutic strategies to treat these tumors.

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Signal pathways mediating oxytocin stimulation of prostaglandin synthesis in select target cells.

A major action of oxytocin is to stimulate prostaglandin production in reproductive tissues. The two major enzyme systems involved are cytosolic phospholipase A2 (cPLA2), which catalyses the formation of arachidonic acid from membrane glycerophospholipids, and prostaglandin endoperoxide-H synthases-1 and -2, which allow conversion of arachidonic acid to prostaglandins. During gestation, the concentrations of all three enzymes rise in the rabbit amnion. Agonists, including oxytocin, increase cPLA2 activity, in part, by elevating intracellular Ca2+ concentration, which causes cPLA2 to be translocated from the cytosol to intracellular membrane binding sites. Cytosolic PLA2 is then activated by a mitogen-activated protein kinase (MAPK)-dependent step. Our studies have elucidated signal pathways involved in oxytocin-stimulated prostaglandin output in both rabbit amnion cells and Chinese hamster ovary cells stably transfected with the rat oxytocin receptor. The two cell types are alike with respect to oxytocin-stimulated intracellular Ca2+ transients, mediation via Gq, and the specific MAPK that catalyses the phosphorylation of cPLA2. However, they differ with respect to the mechanisms of upregulation of key enzymes involved in prostaglandin E2 synthesis. These findings illustrate the tiers of complementary mechanisms involved in oxytocin stimulation of prostaglandin E2, and the extent of the diversity in the cellular signalling pathways involved.

Functional oxytocin receptors in a human endometrial cell line.

OBJECTIVE: Our goal was to demonstrate expression and functionality of oxytocin receptors in a human endometrial cell line. This cell line could then be used for further investigation of the role of oxytocin in reproductive function at the cellular level. STUDY DESIGN: Oxytocin receptor messenger ribonucleic acid expression was determined by reverse transcriptase-polymerase chain reaction deoxyribonucleic acid amplification with ribonucleic acid from confluent Ishikawa cells. Ligand binding to whole cells was evaluated by nonlinear regression analysis with an iodinated oxytocin antagonist. The coupling of the oxytocin receptor to signaling pathways was evaluated by measuring oxytocin-stimulated increases in intracellular calcium concentration, phosphorylation of ERK2 (extracellular-regulated protein kinase 2) mitogen-activated protein kinase, and prostaglandin E(2) release. RESULTS: Polyacrylamide gel electrophoresis of the reverse transcriptase-polymerase chain reaction products demonstrated the presence of oxytocin receptor messenger ribonucleic acid in Ishikawa cells. Ligand-binding analysis of these cells demonstrated a single class of noninteracting sites, with a B(max) (maximal number of binding sites) of 77.7 fmol/mg deoxyribonucleic acid and an apparent dissociation constant of 8.3 x 10(-11) mol/L. Stimulation with 100-nmol/L oxytocin caused a rapid transient increase in intracellular free calcium concentration, which was blocked by 1-micromol/L oxytocin antagonist. Treatment of cells with oxytocin for 10 minutes resulted in a marked increase in the phosphorylation of ERK2, as determined by Western blot analysis, and a 5-fold increase in prostaglandin E(2) release. CONCLUSION: This study is the first to demonstrate functional oxytocin receptors in an established human endometrial cell line. This cell line will be useful in elucidating the mechanisms of action of oxytocin in the reproductive tract at the molecular level.

The proximal portion of the COOH terminus of the oxytocin receptor is required for coupling to g(q), but not g(i). Independent mechanisms for elevating intracellular calcium concentrations from intracellular stores.

As the oxytocin receptor plays a key role in parturition and lactation, there is considerable interest in defining its structure/functional relationships. We previously showed that the rat oxytocin receptor transfected into Chinese hamster ovary cells was coupled to both G(q/11) and G(i/o), and that oxytocin stimulated ERK-2 phosphorylation and prostaglandin E(2) synthesis via protein kinase C activity. In this study, we show that deletion of 51 amino acid residues from the carboxyl terminus resulted in reduced affinity for oxytocin and a corresponding rightward shift in the dose-response curve for oxytocin-stimulated [Ca(2+)](i). However, oxytocin-stimulated ERK-2 phosphorylation and prostaglandin E(2) synthesis did not occur in cells expressing the truncated receptor. Oxytocin also failed to increase phospholipase A activity or activate protein kinase C, indicating that the mutant receptor is uncoupled from G(q)-mediated pathways. The Delta51 receptor is coupled to G(i), as oxytocin-stimulated Ca(2+) transients were inhibited by pertussis toxin, and a Gbetagamma sequestrant. Preincubation of Delta51 cells with the tyrosine kinase inhibitor, genistein, also blocked the oxytocin effect. A Delta39 mutant had all the activities of the wild type oxytocin receptor. These results show that the portion between 39 and 51 residues from the COOH terminus of the rat oxytocin receptor is required for interaction with G(q/11), but not G(i/o). Furthermore, an increase in intracellular calcium was generated via a G(i)betagamma-tyrosine kinase pathway from intracellular stores that are distinct from G(q)-mediated inositol trisphosphate-regulated stores.

Functional oxytocin receptors discovered in human osteoblasts.

Undifferentiated or differentiated human trabecular bone cells with osteogenic capacity in primary culture express oxytocin receptors (OTRs). OTR expression then persists upon differentiation to an osteoblast phenotype. A human epithelial osteosarcoma cell line, Saos-2, also expresses OTRs. Expression was determined both at mRNA and protein levels. Functional OTRs are evidenced by an increase in intracellular calcium concentration, [Ca2+]i, in response to 10 nM oxytocin (OT). An oxytocin antagonist (OTA) blocked this effect, demonstrating specificity for OT. OT also stimulated prostaglandin E2 (PGE2) synthesis in both confluent undifferentiated and differentiated human trabecular bone cells. This is the first report of OTR mRNA and protein expression and of prescribed OT signal pathways in osteoblastic cells. Since PGE2 has been shown to increase bone turnover in favor of bone formation, OT may be a new class of a bone anabolic agent.

Demonstration of functional oxytocin receptors in human breast Hs578T cells and their up-regulation through a protein kinase C-dependent pathway.

Oxytocin (OT) receptors (OTRs) have been demonstrated in a number of human breast tumors and tumor cells, but it was not clear whether the receptors were functional. We examined the regulation and function of OTR in a tumor cell line, Hs578T, derived from human breast. These cells expressed moderate levels of OTR when cultured in 10% FBS, as demonstrated by RT-PCR and binding analyses. Serum deprivation resulted in the loss of OTRs, with no effect on cell viability. Restoration of serum and addition of 1 microM dexamethasone (DEX) increased OTR levels by about 9-fold. Up-regulation was blocked by the addition of phospholipase C and PKC inhibitors. Serum/DEX treatment also increased steady state OTR messenger RNA levels. OT increased intracellular Ca2+ in a time- and dose-responsive manner, and the effects of OT were lost when OTRs were down-regulated by serum starvation. Serum/DEX up-regulation of OTR restored the responsiveness to OT. OT also stimulated ERK-2 (extracellular signal-regulated protein kinase) phosphorylation and PGE2 synthesis in Hs578T cells. In addition to showing that OTRs in the breast tumor cells are functional, these studies show that Hs578T cells can be used to study molecular regulation of OTR gene expression and intracellular signaling pathways stimulated by OT.

Identification of a GABP alpha/beta binding site involved in the induction of oxytocin receptor gene expression in human breast cells, potentiation by c-Fos/c-Jun.

Oxytocin (OT) receptors (OTRs) mediate reproductive functions, including the initiation of labor and milk ejection. OTR messenger RNA levels are highly regulated, reaching the greatest concentration in the uterus at the end of gestation, and in the mammary gland during lactation. Factors directly effecting changes in OTR gene expression in the mammary gland are not known, so the present studies were done to elucidate possible regulators by characterizing the human OTR gene promoter and 5'-flanking sequence. By analyzing expression of promoter-luciferase constructs, we localized a region between -85 and -65 that was required for both basal and serum-induced expression in a mammary tumor cell line (Hs578T) that expresses inducible, endogenous OTRs. This DNA region contains an ets family target sequence (5'-GGA-3'), and a CRE/AP-1-like motif. The specific Ets factor binding to the OTR promoter was identified, by electrophoretic mobility immunoshift assays, to be GABP alpha/beta. Co-transfection of a -85 OTR/luciferase construct with vectors expressing GABP alpha and GABP beta1 had only a modest effect on expression, but cotransfection with GABP alpha/beta- with c-Fos/c-Jun-expressing plasmids resulted in an increase of almost 10-fold in luciferase activity. Mutation of either the GABP- or CRE-like binding sites obliterated the induction. These findings are consistent with the involvement of protein kinase C activity in serum induction of the endogenous gene in Hs578T cells. We showed the requirement for GABP alpha/beta and c-Fos/c-Jun in endogenous OTR gene expression, using oligonucleotide GABP and AP-1 binding decoys to inhibit serum-induced increases in 125I-labeled OT antagonist binding to Hs578T cells. Our work is the first characterization of the proximal promoter region of the human OTR gene, and it sets the stage for studying regulation of OTR expression in breast cells.

ERK2 mediates oxytocin-stimulated PGE2 synthesis.

Oxytocin (OT) induces PG synthesis by both uterine endometrial and amnion cells. We showed previously that CHO cells stably transfected with the rat oxytocin receptor (CHO-OTR cells) also synthesize PGE2 in response to OT. In the present work we have demonstrated that OTRs are coupled to both Gi and Gq/11, using immunoprecipitation of solubilized OTR complexes and ADP ribosylation. OT treatment caused the rapid phosphorylation of extracellular signal-regulated protein kinase 2 (ERK2 or p42MAPK), which was partially inhibited by pertussis toxin (PTX), consistent with OTR-Gi coupling. The PTX-insensitive portion of ERK2 phosphorylation was linked to Gq, as inhibitors of both phospholipase C (U-73122) and protein kinase C (GF-109203X) blocked OT-induced ERK2 phosphorylation. OT-stimulated c-fos expression was also mediated by ERK2 phosphorylation. The ERK-c-fos pathway has been shown to be associated with cell proliferation, but OT had no effect on [3H]thymidine uptake by CHO-OTR cells. However, inhibition of OT-induced ERK2 phosphorylation with an ERK kinase inhibitor (PD-98059) markedly reduced OT-stimulated PGE2 synthesis, pointing to the importance of ERK2 activation in OT action.

Molecular cloning and functional characterization of the oxytocin receptor from a rat pancreatic cell line (RINm5F).

Oxytocin (OT) and vasopressin (AVP) stimulate insulin and glucagon release from the pancreas, and evoke insulin secretion from the rat insulinoma cell line, RINm5F. To determine which AVP/OT receptor subtype is expressed in RINm5F cells, we used PCR with degenerate primers to two transmembrane domains of the AVP (V1a, V1b (or V3), V2) and OT receptors (OTRs). The single PCR fragment identified was used to obtain a full length cDNA from a RINm5F cDNA library. Comparison of the deduced amino acid sequence of this clone with uterine OTR sequences from several species (human, sheep, bovine) and to the pig kidney epithelial cell (LLC-PK1) OTR reveals a very high degree of homology. After the RIN cell OTR cDNA was stably transfected into CHO cells (CHO-OTR), the cell membranes bound iodinated oxytocin antagonist with an apparent Kd comparable to that of RIN cell membranes and those from other OT target cells. Comparison of the ligand specificities of CHO-OTR and RIN cells membranes showed that the relative Ki values of a series of OT analogues were approximately equivalent in both preparations. The rank order of apparent Ki values also corresponded to published values for the rat myometrium, where OT elicits intracellular calcium transients, and increases inositol phosphate production. In uterin endometrium and amnion cells, OT stimulates prostaglandin release. Stimulation of CHO-OTR cells with OT caused an increase in cytosolic calcium concentration originating from both intracellular and extracellular sources, and a dose-dependent increase in inositol phosphate levels. Arachidonic acid release and PGE2 synthesis were also stimulated by OT. These findings (amino acid sequence homology, binding specificity, and signal transduction/second messenger production) suggest that OTRs from RINm5F cells are indistinguishable from OTRs that have been described in other tissues. The expression of OTR in pancreatic cells implies that OT plays a role in pancreatic function.

Design of novel antiestrogens.

The physicochemical principle of "die and coin" complementarity proffered by Pauling and Delbruck and exemplified in Watson and Crick DNA was used to design new antineoplastic compounds. In search of an explanation for why certain molecules and not others are present in nature, biologically active small molecules were discovered to exhibit complementarity when inserted into cavities between base pairs in DNA. Ligands in the steroid/thyroid hormone/vitamin D family fit particularly well into the site 5'-dTdG-3'.5'-dCdA-3'. Degree of fit of various candidate compounds in the manner of a given hormone correlated with degree of hormonal activity. Hormone antagonists fit into the same site but in a different manner than the agonists. Computer graphics and energy calculations confirmed salient observations including the remarkable complementarity of estradiol and DNA. Using the above criteria, a new candidate antiestrogen, para-hydroxyphenyl-acetylamino-2,6-piperidinedione was successfully designed. Taken as a whole, these results coupled with recent independent findings raise the possibility that the mode of action of certain hormones and hormone antagonists may involve direct insertion into DNA mediated by classical protein receptors and other transcription factors.

Antiestrogenic piperidinediones designed prospectively using computer graphics and energy calculations of DNA-ligand complexes.

Drug design technology based upon DNA stereochemistry and now supplemented by computer modeling was used to design a novel compound to inhibit estrogen-induced tumor cell growth. A known compound 3-phenylacetylamino-2,6-piperidinedione (PP) was accommodated in partially unwound DNA in a manner consistent with criteria for antiestrogens. Examination of the PP-DNA complex revealed that substitution of a hydroxyl group at the para position (p-OH-PP) would provide a stereospecific hydrogen bond and a substantial increase in fit as assessed by energy calculations. The antiestrogen tamoxifen could also be accomodated within the site; analogous substitution of a hydroxyl at the 4 position resulted in a better fitting molecule. 4-Hydroxytamoxifen is a more potent antiestrogen than tamoxifen. Synthesis and subsequent evaluation of p-OH-PP as an inhibitor of estrogen stimulated MCF-7 (E3) human breast cancer cell growth demonstrated that p-OH-PP was more active than both PP and its hydrolysis product phenylacetylglutamine. As predicted, the order of fit into DNA correlated with the relative ability to inhibit estrogen-induced growth of tumor cells suggesting that the evolving drug design technology will be valuable in developing new drugs for breast cancer.