Pantoea trifolii sp. nov., a novel bacterium isolated from Trifolium rubens root nodules.

A novel bacterium, designated strain MMK2T, was isolated from a surface-sterilised root nodule of a Trifolium rubens plant growing in south-eastern Poland. Cells were Gram negative, non-spore forming and rod shaped. The strain had the highest 16S rRNA gene sequence similarity with P. endophytica (99.4%), P. leporis (99.4%) P. rwandensis (98.8%) and P. rodasii (98.45%). Phylogenomic analysis clearly showed that strain MMK2T and an additional strain, MMK3, should reside in the genus Pantoea and that they were most closely related to P. endophytica and P. leporis. Genome comparisons showed that the novel strain shared 82.96-93.50% average nucleotide identity and 26.2-53. 2% digital DNA:DNA hybridization with closely related species. Both strains produced siderophores and were able to solubilise phosphates. The MMK2T strain was also able to produce indole-3-acetic acid. The tested strains differed in their antimicrobial activity, but both were able to inhibit the growth of Sclerotinia sclerotiorum 10Ss01. Based on the results of the phenotypic, phylogenomic, genomic and chemotaxonomic analyses, strains MMK2T and MMK3 belong to a novel species in the genus Pantoea for which the name Pantoea trifolii sp. nov. is proposed with the type strain MMK2T (= DSM 115063T = LMG 33049T).

Whole-Genome-Sequence-Based Classification of Xanthomonas euvesicatoria pv. eucalypti and Computational Analysis of the Type III Secretion System.

Xanthomonas spp. infect a wide range of annual and perennial plants. Bacterial blight in young seedlings of Eucalyptus spp. in Indonesia was originally identified as X. perforans. However, these strains failed to elicit a hypersensitive response (HR) on either tomatoes or peppers. Two of the strains, EPK43 and BCC 972, when infiltrated into tomato and pepper leaves, failed to grow to significant levels in comparison with well-characterized X. euvesicatoria pv. perforans (Xp) strains. Furthermore, spray inoculation of 'Bonny Best' tomato plants with a bacterial suspension of the Eucalyptus strains resulted in no obvious symptoms. We sequenced the whole genomes of eight strains isolated from two Eucalyptus species between 2007 and 2015. The strains had average nucleotide identities (ANIs) of at least 97.8 with Xp and X. euvesicatoria pv. euvesicatoria (Xeu) strains, both of which are causal agents of bacterial spot of tomatoes and peppers. A comparison of the Eucalyptus strains revealed that the ANI values were >99.99% with each other. Core genome phylogeny clustered all Eucalyptus strains with X. euvesicatoria pv. rosa. They formed separate clades, which included X. euvesicatoria pv. alangii, X. euvesicatoria pv. citrumelonis, and X. euvesicatoria pv. alfalfae. Based on ANI, phylogenetic relationships, and pathogenicity, we designated these Eucalyptus strains as X. euvesicatoria pv. eucalypti (Xee). Comparative analysis of sequenced strains provided unique profiles of type III secretion effectors. Core effector XopD, present in all pathogenic Xp and Xeu strains, was absent in the Xee strains. Comparison of the hrp clusters of Xee, Xp, and Xeu genomes revealed that HrpE in Xee strains was very different from that in Xp and Xeu. To determine if it was functional, we deleted the gene and complemented with the Xee hrpE, confirming it was essential for secretion of type III effectors. HrpE has a hypervariable N-terminus in Xanthomonas spp., in which the N-terminus of Xee strains differs significantly from those of Xeu and Xp strains.

Genomic delineation and description of species and within-species lineages in the genus Pantoea.

As the name of the genus Pantoea ("of all sorts and sources") suggests, this genus includes bacteria with a wide range of provenances, including plants, animals, soils, components of the water cycle, and humans. Some members of the genus are pathogenic to plants, and some are suspected to be opportunistic human pathogens; while others are used as microbial pesticides or show promise in biotechnological applications. During its taxonomic history, the genus and its species have seen many revisions. However, evolutionary and comparative genomics studies have started to provide a solid foundation for a more stable taxonomy. To move further toward this goal, we have built a 2,509-gene core genome tree of 437 public genome sequences representing the currently known diversity of the genus Pantoea. Clades were evaluated for being evolutionarily and ecologically significant by determining bootstrap support, gene content differences, and recent recombination events. These results were then integrated with genome metadata, published literature, descriptions of named species with standing in nomenclature, and circumscriptions of yet-unnamed species clusters, 15 of which we assigned names under the nascent SeqCode. Finally, genome-based circumscriptions and descriptions of each species and each significant genetic lineage within species were uploaded to the LINbase Web server so that newly sequenced genomes of isolates belonging to any of these groups could be precisely and accurately identified.

Draft genome sequences for Pantoea ananatis ATCC 35400 and Pantoea stewartii subspecies indologenes ICMP 10132.

Here, we describe draft genome sequences for two bacterial isolates from the genus Pantoea. Pantoea ananatis ATCC 35400 was originally isolated from honeydew melon and was obtained from the American Type Culture Collection. Pantoea stewartii subspecies indologenes ICMP 10132 was originally isolated from sugarcane and classified as Pantoea ananatis, but average nucleotide identity and discriminatory PCR support species reclassification.

Pantailocins: phage-derived bacteriocins from Pantoea ananatis and Pantoea stewartii subsp. indologenes.

IMPORTANCE: Phage-derived bacteriocins (tailocins) are ribosomally synthesized structures produced by bacteria in order to provide advantages against competing strains under natural conditions. Tailocins are highly specific in their target range and have proven to be effective for the prevention and/or treatment of bacterial diseases under clinical and agricultural settings. We describe the discovery and characterization of a new tailocin locus encoded within genomes of Pantoea ananatis and Pantoea stewartii subsp. indologenes, which may enable the development of tailocins as preventative treatments against phytopathogenic infection by these species.

Morphologic and Genetic Analysis of Synhimantus (Synhimantus) laticeps from a Long-Eared Owl (Asio otus).

The long-eared owl (Asio otus) is a medium-sized owl species that is well-distributed in almost all of the territories in Portugal. Nematodes were found in the oral cavity of a long-eared owl (A. otus) admitted to CRASSA (Wildlife Rehabilitation Centre of Santo André). During a physical exam and stabilization of the bird, five nematodes were collected. The worms were examined and measured under light microscopy, and photos were taken. After a morphological analysis was conducted, all the nematodes (five females) were identified as Synhimantus (Synhimantus) laticeps. Two specimens were subjected to molecular analysis, which confirmed the result. This study provides a combined morphological and genetic approach to S. laticeps. To the authors' best knowledge, this is the first report including genetic sequencing of S. laticeps in a long-eared owl (A. otus) from Portugal.

Corrigendum to "A highly specific tool for identification of Xanthomonas vasicola pv. musacearum based on five Xvm-specific coding sequences" [Heliyon 4 (12) (December 2018) Article e01080].

[This corrects the article DOI: 10.1016/j.heliyon.2018.e01080.].

A Novel Biosynthetic Gene Cluster Across the Pantoea Species Complex Is Important for Pathogenicity in Onion.

Onion center rot is caused by at least four species of genus Pantoea (P. ananatis, P. agglomerans, P. allii, and P. stewartii subsp. indologenes). Critical onion pathogenicity determinants for P. ananatis were recently described, but whether those determinants are common among other onion-pathogenic Pantoea species remains unknown. In this work, we report onion pathogenicity determinants in P. stewartii subsp. indologenes and P. allii. We identified two distinct secondary metabolite biosynthetic gene clusters present separately in different strains of onion-pathogenic P. stewartii subsp. indologenes. One cluster is similar to the previously described HiVir phosphonate biosynthetic cluster identified in P. ananatis and another is a novel putative phosphonate biosynthetic gene cluster, which we named Halophos. The Halophos gene cluster was also identified in P. allii strains. Both clusters are predicted to be phosphonate biosynthetic clusters based on the presence of a characteristic phosphoenolpyruvate phosphomutase (pepM) gene. The deletion of the pepM gene from either HiVir or Halophos clusters in P. stewartii subsp. indologenes caused loss of necrosis on onion leaves and red onion scales and resulted in significantly lower bacterial populations compared with the corresponding wild-type and complemented strains. Seven (halB to halH) of 11 genes (halA to halK) in the Halophos gene cluster are required for onion necrosis phenotypes. The onion nonpathogenic strain PNA15-2 (P. stewartii subsp. indologenes) gained the capacity to cause foliar necrosis on onion via exogenous expression of a minimal seven-gene Halophos cluster (genes halB to halH). Furthermore, cell-free culture filtrates of PNA14-12 expressing the intact Halophos gene cluster caused necrosis on onion leaves consistent with the presence of a secreted toxin. Based on the similarity of proteins to those with experimentally determined functions, we are able to predict most of the steps in Halophos biosynthesis. Together, these observations indicate that production of the toxin phosphonate seems sufficient to account for virulence of a variety of different Pantoea strains, although strains differ in possessing a single but distinct phosphonate biosynthetic cluster. Overall, this is the first report of onion pathogenicity determinants in P. stewartii subsp. indologenes and P. allii. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Pseudomonas uvaldensis sp. nov., a bacterial pathogen causing onion bulb rot.

A Gram-stain-negative, aerobic and non-spore-forming bacterial strain, designated 20TX0172T, was isolated from a rotting onion bulb in Texas, USA. The results of phylogenetic analysis based on the 16S rRNA sequence indicated that the novel strain represented a member of the genus Pseudomonas and had the greatest sequence similarities with Pseudomonas kilonensis 520-20T (99.3 %), Pseudomonas corrugata CFBP 2431T (99.2 %), and Pseudomonas viciae 11K1T (99.2 %) but the 16S rRNA phylogenetic tree displayed a monophyletic clade with Pseudomonas mediterranea CFBP 5447T. In the phylogenetic trees based on sequences of four housekeeping genes (gap1, gltA, gyrB and rpoD), the novel strain formed a separate branch, indicating that the strain was distinct phylogenetically from known species of the genus Pseudomonas. The genome-sequence-derived average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values between the novel isolate and P. mediterranea DSM 16733T were 86.7 and 32.7 %, respectively. These values were below the accepted species cutoff threshold of 96 % ANI and 70 % dDDH, affirming that the strain represented a novel species. The genome size of the novel species was 5.98 Mbp with a DNA G+C content of 60.8 mol%. On the basis of phenotypic and genotypic characteristics, strain 20TX0172T represents a novel species of the genus Pseudomonas. The name Pseudomonas uvaldensis sp. nov. is proposed. The type strain is 20TX0172T (=NCIMB 15426T=CIP 112022T).

First report of human Thelazia callipaeda infection in Portugal.

The zoonotic parasitic nematode Thelazia callipaeda, also known as the oriental eye worm, is endemic in several European countries, including Portugal. Infections may result in ocular disease in domestic and wild animals as well as humans, with more or less severe manifestations. We report the first human case of ocular thelaziosis by T. callipaeda in Portugal, a country where the parasite had already been found to infect dogs, cats, red foxes, wild rabbits and a beech marten. An 80-year-old patient from east-central Portugal, who had been suffering from tearing for a few years, had whitish filiform fragments removed from the left eye. Polymerase chain reaction of partial cytochrome c oxidase subunit 1 and 18S small subunit rRNA genes followed by bidirectional sequencing and BLAST analysis confirmed T. callipaeda haplotype 1, the only haplotype previously reported in Europe. The endemicity of T. callipaeda in domestic and wild animals in east-central Portugal makes it very likely that infection of the human patient had occurred locally. In east-central and other geographical areas of Portugal, veterinarians and physicians, especially ophthalmologists, should regard T. callipaeda as a cause of ocular pathology in animals and humans.

Validation of Species-Specific PCR Assays for the Detection of Pantoea ananatis, P. agglomerans, P. allii, and P. stewartii.

Species of Pantoea represent a group of plant pathogenic bacteria that infect a variety of agro-economically important plant species. Among these, a complex of P. ananatis, P. allii, P. agglomerans, and P. stewartii subsp. indologenes cause center rot in onion, resulting in significant economic losses. As species of Pantoea are phenotypically closely related, identification of Pantoea species relies on the sequencing and phylogenetic analysis of housekeeping genes. To aid in rapid identification of Pantoea species, efforts have been made in developing species-specific primers to be used in PCR assays. In the current study, two P. ananatis, one P. allii, one P. agglomerans, and three P. stewartii published primers as well as newly developed P. agglomerans PagR primers were evaluated for their specificity against 79 Pantoea strains, belonging to 15 different species. To ensure that selected primers were evaluated against accurately identified species, sequencing and phylogenetic analysis of housekeeping gene infB were conducted. Thereafter, PCR assays using selected species-specific primers were performed. The results showed that previously described P. ananatis-specific PANA_1008; P. allii-specific allii-leuS; P. stewartii-specific PANST_rpoB, 3614galE, and DC283galE primers; and one newly designed P. agglomerans-specific PagR primer pair were highly specific for their target Pantoea species. They accurately identified these strains into their species and, in some cases, their subspecies level. The findings of the current study will facilitate rapid and reliable identification of P. ananatis, P. agglomerans, P. allii, and P. stewartii.

Population homogeneity for the antibody response to COVID-19 BNT162b2/Comirnaty vaccine is only reached after the second dose across all adult age ranges.

While mRNA vaccines are administrated worldwide in an effort to contain the COVID-19 pandemic, the heterogeneity of the humoral immune response they induce at the population scale remains unclear. Here, in a prospective, longitudinal, cohort-study, including 1245 hospital care workers and 146 nursing home residents scheduled for BNT162b2 vaccination, together covering adult ages from 19 to 99 years, we analyse seroconversion to SARS-CoV-2 spike protein and amount of spike-specific IgG, IgM and IgA before vaccination, and 3-5 weeks after each dose. We show that immunogenicity after a single vaccine dose is biased to IgG, heterogeneous and reduced with increasing age. The second vaccine dose normalizes IgG seroconversion in all age strata. These findings indicate two dose mRNA vaccines is required to reach population scale humoral immunity. The results advocate for the interval between the two doses not to be extended, and for serological monitoring of elderly and immunosuppressed vaccinees.

The Distribution of Onion Virulence Gene Clusters Among Pantoea spp.

Pantoea ananatis is a gram-negative bacterium and the primary causal agent of center rot of onions in Georgia. Previous genomic studies identified two virulence gene clusters, HiVir and alt, associated with center rot. The HiVir gene cluster is required to induce necrosis on onion tissues via synthesis of pantaphos, (2-hydroxy[phosphono-methyl)maleate), a phosphonate phytotoxin. The alt gene cluster aids in tolerance to thiosulfinates generated during onion tissue damage. Whole genome sequencing of other Pantoea species suggests that these gene clusters are present outside of P. ananatis. To assess the distribution of these gene clusters, two PCR primer sets were designed to detect the presence of HiVir and alt. Two hundred fifty-two strains of Pantoea spp. were phenotyped using the red onion scale necrosis (RSN) assay and were genotyped using PCR for the presence of these virulence genes. A diverse panel of strains from three distinct culture collections comprised of 24 Pantoea species, 41 isolation sources, and 23 countries, collected from 1946-2019, was tested. There is a significant association between the alt PCR assay and Pantoea strains recovered from symptomatic onion (P < 0.001). There is also a significant association of a positive HiVir PCR and RSN assay among P. ananatis strains but not among Pantoea spp., congeners. This may indicate a divergent HiVir cluster or different pathogenicity and virulence mechanisms. Last, we describe natural alt positive [RSN+/HiVir+/alt +] P. ananatis strains, which cause extensive bulb necrosis in a neck-to-bulb infection assay compared to alt negative [RSN+/HiVir+/alt -] P. ananatis strains. A combination of assays that include PCR of virulence genes [HiVir and alt] and an RSN assay can potentially aid in identification of onion-bulb-rotting pathogenic P. ananatis strains.

SNP-based genotyping and whole-genome sequencing reveal previously unknown genetic diversity in Xanthomonas vasicola pv. musacearum, causal agent of banana xanthomonas wilt, in its presumed Ethiopian origin.

For decades, Xanthomonas vasicola pv. musacearum (Xvm) has been an economically important bacterial pathogen on enset in Ethiopia. Since 2001, Xvm has also been responsible for significant losses to banana crops in several East and Central African countries, with devastating consequences for smallholder farmers. Understanding the genetic diversity within Xvm populations is essential for the smart design of transnationally reasoned, durable, and effective management practices. Previous studies have revealed limited genetic diversity in Xvm, with East African isolates from banana each falling into one of two closely related clades previously designated as sublineages SL 1 and SL 2, the former of which had also been detected on banana and enset in Ethiopia. Given the presumed origin of Xvm in Ethiopia, we hypothesized that both clades might be found in that country, along with additional genotypes not seen in Central and East African bananas. Genotyping of 97 isolates and whole-genome sequencing of 15 isolates revealed not only the presence of SL 2 in Ethiopia, but additional diversity beyond SL 1 and SL 2 in four new clades. Moreover, SL 2 was detected in the Democratic Republic of Congo, where previously SL 1 was the only clade reported. These results demonstrate a greater range of genetic diversity among Xvm isolates than previously reported, especially in Ethiopia, and further support the hypothesis that the East/Central Africa xanthomonas wilt epidemic has been caused by a restricted set of genotypes drawn from a highly diverse pathogen pool in Ethiopia.

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 µm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Draft Genome Sequences of Pantoea agglomerans Strains BD1274 and BD1212, Isolated from Onion Seeds, Reveal Major Differences in Pathogenicity and Functional Genes.

Pantoea agglomerans strains BD1274 and BD1212 were isolated from Allium cepa seeds. Strain BD1274 induced a disease symptom on a healthy onion, whereas strain BD1212 did not and remains nonpathogenic. A comparative genomic study revealed that the strains differ in their genomic compositions, particularly in the genes that confer pathogenicity.

Flagella by numbers: comparative genomic analysis of the supernumerary flagellar systems among the Enterobacterales.

BACKGROUND: Flagellar motility is an efficient means of movement that allows bacteria to successfully colonize and compete with other microorganisms within their respective environments. The production and functioning of flagella is highly energy intensive and therefore flagellar motility is a tightly regulated process. Despite this, some bacteria have been observed to possess multiple flagellar systems which allow distinct forms of motility. RESULTS: Comparative genomic analyses showed that, in addition to the previously identified primary peritrichous (flag-1) and secondary, lateral (flag-2) flagellar loci, three novel types of flagellar loci, varying in both gene content and gene order, are encoded on the genomes of members of the order Enterobacterales. The flag-3 and flag-4 loci encode predicted peritrichous flagellar systems while the flag-5 locus encodes a polar flagellum. In total, 798/4028 (~ 20%) of the studied taxa incorporate dual flagellar systems, while nineteen taxa incorporate three distinct flagellar loci. Phylogenetic analyses indicate the complex evolutionary histories of the flagellar systems among the Enterobacterales. CONCLUSIONS: Supernumerary flagellar loci are relatively common features across a broad taxonomic spectrum in the order Enterobacterales. Here, we report the occurrence of five (flag-1 to flag-5) flagellar loci on the genomes of enterobacterial taxa, as well as the occurrence of three flagellar systems in select members of the Enterobacterales. Considering the energetic burden of maintaining and operating multiple flagellar systems, they are likely to play a role in the ecological success of members of this family and we postulate on their potential biological functions.

First report of Spirocerca vulpis in red foxes (Vulpes vulpes) in Portugal.

Recent studies have described Spirocerca lupi-like nematodes in the stomach of red foxes (Vulpes vulpes) in Europe. A phylogenetic analysis of those specimens using mitochondrial DNA and their morphological reexamination allowed their characterization as a different species, Spirocerca vulpis. Between the years of 2010 and 2017, roundworms were collected from seven red foxes of northeastern Portugal found at necropsy with nodular lesions on their stomach wall. Histopathological analysis of four foxes revealed granulomatous lesions of the gastric nodules. On morphological assessment, by light microscopy, nematodes revealed the presence of six triangular teeth-like buccal capsule structures, which are absent in S. lupi. Polymerase chain reaction was run to amplify a 551 bp partial fragment of the cytochrome c oxidase subunit 1 gene. Sequences were 99% similar to S. vulpis (85% coverage) of red foxes from Spain and Bosnia and Herzegovina, 99% similar (99% coverage) to sequences of Spirocerca sp. of red foxes from Denmark and 93% similar (99% coverage) to S. lupi from South Africa. This is the first report of S. vulpis in foxes or any other host from Portugal.