Characterization of Beet curly top virus Strains Circulating in Beet Leafhoppers (Hemiptera: Cicadellidae) in Northeastern Oregon.

The beet leafhopper, Circulifer tenellus, is an agriculturally important pest, particularly in the western United States. This insect transmits the Beet curly top virus (BCTV) to multiple crops, including bean, tomato, and pepper. In this study, we investigated the incidence of BCTV in individual leafhoppers collected at several sites in northeastern Oregon during the growing season in 2007, 2008, and 2009. Of the 800 insects tested, 151 (18.9%) were found positive for the virus. Percentage of virus incidence varied from 0% at one location in 2009 to a high of 55.6% for a location sampled in 2008. The complete virus genomes from one virus-positive insect collected in each of the 3 years were determined. BLAST analysis of the BCTV whole-genome sequences from 2007, 2008, and 2009 insects showed 98, 94, and 96% identities with the BCTV-Worland sequence (AY134867), respectively. The BCTV_2008 sequence showed the greatest identity (96%) with another BCTV genomic sequence (JN817383), and was found to be a recombinant between the BCTV-Worland type, representing the majority of the genome (approximately 2.2 kb), and the BCTV-CFH type that provided an approximately 0.8-kb fragment spanning replication-related genes C1 and C2. This area of the BCTV genome, between the C1 and C2 genes, was previously found to carry symptom determinants of the virus, and the data may suggest more severe effects of BCTV during the 2008 season. Results indicate that BCTV is common and widespread in C. tenellus in eastern Oregon and that there is substantial genetic diversity among the virus strains present in this important field and vegetable crop-growing region.

First Report of Potato virus Y in Potato in West Java, Indonesia.

Potato (Solanum tuberosum) is an important vegetable crop in Indonesia. A small survey was conducted for virus diseases in November 2011 in Lembang, West Java, as part of assessing the sanitary status of potatoes produced in farmers' fields. Among the six potato fields surveyed, one field had nearly 20% of plants displaying stunted growth with leaves showing mild chlorotic spots and reduced size of lamina. Tubers harvested from symptomatic plants showed no necrosis symptoms. Symptomatic leaves from three representative potato plants were positive for Potato virus Y (PVY) when tested with PVY-specific immunostrips (Agdia Inc., Elkhart, IN). Leaf samples from virus-positive plants were imprinted on FTA Classic Cards (Whatman International Ltd., Maidstone, UK), air dried, and shipped to Washington State University for confirmatory diagnostic tests. Total nucleic acids were eluted from FTA cards (1) and subjected to reverse transcription (RT)-PCR using primers (PVY/Y4A and PVY/Y3S) specific to the coat protein (CP) of PVY (3). Nucleic acid extracts from samples infected with PVY ordinary strain (PVYO), tuber necrosis strain (PVYNTN), tobacco veinal necrosis strains (PVYEU-N and PVYNA-N), and a recombinant strain (PVYN:O) were included as standards to validate RT-PCR assays. The approximately 480-bp DNA fragment, representing a portion of the CP, amplified in RT-PCR was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). DNA isolated from four independent recombinant clones was sequenced from both orientations. Pairwise comparison of these sequences (GenBank Accession Nos. KF261310 to 13) showed 100% identity among themselves and 93 to 100% identity with corresponding sequences of reference strains of PVY available in GenBank (JQ743609 to 21). To our knowledge, this study represents the first confirmed report of PVY in potato in West Java, Indonesia. Studies are in progress to assess the prevalence of PVY in other potato-growing regions of Indonesia and document the presence of different strains of the virus (2). Since the majority of farmers in Indonesia plant seed selected from their previous potato crop, there is an increased risk of primary and secondary spread of PVY through the informal seed supply system, leading to its increased significance to potato production in Indonesia. Therefore, strengthening foundation seed potato and supply chain programs will promote the production of virus-free potatoes in Indonesia. References: (1) O. J. Alabi et al. Plant Dis. 96:107, 2012. (2) A. Karasev and S. M. Gray. Am. J. Potato Res. 90:7, 2013. (3) R. P. Singh et al. J. Virol. Methods 59:189, 1996.

Characterization of management and environmental factors associated with regional variations in potato zebra chip occurrence.

Potato zebra chip (ZC), caused by the bacterial pathogen 'Candidatus Liberibacter solanacearum', which is vectored by the potato psyllid (Bactericera cockerelli), has caused widespread damage to U.S. potato production ever since its first discovery in south Texas in 2000. To determine the influence of environmental factors and management practices on ZC occurrence, data on management and meteorological variables, field locations, and psyllid counts were collected over a 3-year period (2010 to 2012) from six locations across the central United States (south Texas to Nebraska). At these locations, ZC-symptomatic plants were counted in 26 fields from systematically established 20 m × 30 m plots around the field edges and field interiors. Mean numbers of symptomatic plants per plot were classified into two intensity classes (ZC ≤ 3 or ZC > 3) and subjected to discriminant function and logistic regression analyses to determine which factors best distinguish between the two ZC intensity classes. Of all the variables, location, planting date, and maximum temperature were found to be the most important in distinguishing between ZC intensity classes. These variables correctly classified 88.5% of the fields into either of the two ZC-intensity classes. Logistic regression analysis of the individual variables showed that location accounted for 90% of the variations, followed by planting date (86%) and maximum temperature (70%). There was a low but significant (r = -0.44983, P = 0.0211) negative correlation between counts of psyllids testing positive for pathogen and latitudinal locations, indicating a south-to-north declining trend in counts of psyllids testing positive for the pathogen. A similar declining trend also was observed in ZC occurrence (r = -0.499, P = 0.0094).

Detection of Potato mop top virus (Furovirus) on potato in southeast Idaho.

In February 2012, commercially produced potato (Solanum tuberosum) tubers, cv. Modoc, grown in southeast Idaho, were observed with internal necrotic arcs and lines. Samples were obtained from potatoes that had been washed and packaged. No external symptoms were evident. Multiple samples were collected from the packing line and cut to check for internal defects as part of the normal grading procedure. The incidence of symptomatic tubers from these samples was determined by personnel at the packaging facility to be approximately 3%. Initially, one symptomatic and one asymptomatic tuber were tested. Total RNA extracted from these tubers were tested by RT-PCR at Aberdeen, Idaho, with primers specific for Potato mop top virus (PMTV) (1) and Tobacco rattle virus (TRV) (4). RT-PCR results showed that the symptomatic tuber produced a band at 416 bp with the PMTV primers, which was also present in the PMTV-positive control. No amplification was observed with the TRV primers. The asymptomatic tuber was negative for both PMTV and TRV. Subsequently, total RNA from four additional symptomatic tubers from the same lot were tested at USDA-ARS in Prosser, WA, by RT-PCR for TRV (4) and with a different set primers for PMTV (2). The tests included two PMTV-positive controls from cv. Alturas tubers (1), a healthy cv. Russet Burbank control, and a water control. Results showed that amplified products of 460 bp were obtained with the PMTV primers for the four symptomatic tubers and the same tubers were negative for TRV. In addition, symptomatic tissue from the four tubers tested positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). Symptomless Russet Burbank tubers and water controls were negative in RT-PCR and ELISA tests. The 460 bp PMTV amplicon from two symptomatic Modoc tubers were cloned and sequenced. The sequences were identical and the sequence (GenBank Accession No. JX239990) was 100% identical to the corresponding sequences of PMTV isolates from North Dakota (HM776172) and Finland (AM503632). There was one nucleotide difference from the corresponding sequence of a PMTV isolate from Washington (JN132117). To our knowledge, this is the first published report of PMTV in Idaho and confirms that PMTV exists in southeast Idaho. A previous report made by Canada in 2004 (Plant Dis. 88:363) indicates that PMTV was found in multiple states and provinces, but no specific locations were identified. This report follows reports of PMTV in commercial potatoes in Washington (1), North Dakota (2), and Maine (3). In 2011, 129,000 hectares of potatoes were grown in Idaho, representing 29% of the fall grown potatoes in the United States. PMTV can cause quality problems and as evidenced by these samples with no external symptoms, problems may be compounded because of internal symptoms that may go undetected. The confirmation of PMTV alerts growers and processors to the presence of this virus in this important potato-producing state. References: (1) J. M. Crosslin. Plant Dis. 95:1483, 2011. (2) N. David et al.Plant Dis. 94:1506, 2010. (3) D. H. Lambert et al.Plant Dis. 87:872, 2003. (4) D. J. Robinson. J. Virol. Methods 40:57, 1992.

Seasonal population dynamics of the potato psyllid (Hemiptera: Triozidae) and its associated pathogen "Candidatus Liberibacter solanacearum" in potatoes in the southern great plains of North America.

The potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae), and its associated pathogen "Candidatus Liberibacter solanacearum" (Ca. L. solanacearum), the putative causal agent of zebra chip (ZC) disease in potatoes (Solanum tuberosum L.), were sampled in commercial potato fields and untreated control plots for 3 yr in multiple locations in Texas, Kansas, Nebraska, and Colorado. Populations of the potato psyllid varied across years and across potato growing regions. However, the percentage of potato psyllids infected with Ca. L. solanacearum although variable across years, was consistently highest in the Lower Rio Grande Valley of Texas (LRGV), the reported overwintering location for this pest. The numbers of Ca. L. solanacearum-infected psyllids collected on field traps and large nymphs counted on leaf samples were both positively correlated with the final percentage of ZC in tubers. In the LRGV, where vector and disease pressure is the highest, population levels of immature life stages of the psyllid and percentage of ZC differed greatly between commercial and untreated fields. These results show that the pest management program that was used can be effective at controlling development of the psyllid and ultimately reducing the incidence of ZC.

First Report of Zebra Chip Disease and "Candidatus Liberibacter solanacearum" on Potatoes in Idaho.

In September 2011, potato (Solanum tuberosum L.) tubers graded in a packing facility in south-central Idaho were observed with internal discolorations suggestive of zebra chip disease (ZC). Symptoms were observed in 1 to 2% of tubers of cv. Russet Norkotah and included brown spots and streaks especially in and near the vascular tissue. Some tubers also showed a dark and sunken stolon attachment typical of ZC (1). Initially, tissue samples were taken from seven symptomatic tubers and tested by PCR for "Candidatus Liberibacter solanacearum", the bacterium associated with ZC. Primers specific for the 16S rDNA (primers CLipoF [4] and OI2c [3]) and the outer membrane protein (OMB 1482f and 2086r) (2) were used. Six of these samples were positive for the bacterium. The amplified 16S rDNA and OMB products from two symptomatic tubers of cv. Russet Norkotah were cloned and three clones of each were sequenced. The 16S sequences (1,071 bp; GenBank Accession Nos. JN848755 and JN848756) from the two tubers varied by one nucleotide and had 99 to 100% sequence identity to numerous "Ca. L. solanacearum" sequences in GenBank (e.g., Accession Nos. HM246509, FJ957897, and EU935004). Sequences of the two OMB clones (605 bp; GenBank Accession Nos. JN848757 and JN848758) had 97% sequence identity to the two "Ca. L. solanacearum" OMB sequences in GenBank (Accession Nos. CP002371 and FJ914617). Six of eight additional symptomatic field-collected cv. Russet Norkotah tubers corresponding to tubers collected in the packing facility were also positive for "Ca. L. solanacearum" by PCR. Additional severely symptomatic tubers of cvs. Russet Burbank, Yukon Gold, and raw cut French fries of Ranger Russet produced in south-central Idaho were subsequently tested by PCR and were found to be positive for "Ca. L. solanacearum" as well. On the basis of the symptoms, specific PCR amplification with two distinct primer pairs and DNA sequence analysis, zebra chip disease caused by "Ca. L. solanacearum" was determined to be present in Idaho. This disease has caused significant economic damage to potatoes in many regions, including Texas, Mexico, Central America, and New Zealand (1). Idaho is the largest potato-producing state in the United States, with over 150,000 ha planted this year, and therefore, ZC potentially poses a significant risk to agriculture in this state. References: (1) J. M. Crosslin et al. Online publication. doi:10.1094/PHP-2010-0317-01-RV, Plant Health Progress, 2010. (2) J. M. Crosslin et al. Southwest. Entomol. 36:125, 2011. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) G. A. Secor. Plant Dis. 93:574, 2009.

First Report of Zebra Chip Disease and "Candidatus Liberibacter solanacearum" on Potatoes in Oregon and Washington State.

In August of 2011, potato (Solanum tuberosum) tubers grown in the lower Columbia Basin of southern Washington State and northern Oregon were observed with internal discolorations suggestive of zebra chip disease (ZC). Symptoms included brown spots, streaks, and stripes in and near the vascular tissue, typical of ZC (1). Symptoms were observed in cvs. Alturas, Russet Norkotah, Pike, Ranger Russet, Umatilla Russet, and Russet Burbank. Foliar symptoms on plants that produced symptomatic tubers included purple discoloration in upper leaves, leaf rolling, axial bud elongation, chlorosis, leaf scorch, and wilt. Tissue was taken from two symptomatic tubers each of cvs. Alturas and Russet Norkotah, three tubers of cv. Umatilla Russet, and one tuber of cv. Pike. These tubers were tested by PCR for "Candidatus Liberibacter solanacearum", an unculturable alphaproteobacterium associated with ZC (1,4). Primers specific for the 16S rDNA were CLipoF (4) and OI2c (3), and primers OMB 1482f and 2086r were specific for the outer membrane protein (2). All of these samples, except one Umatilla tuber, were positive for the bacterium. The 16S rDNA and OMB amplicons from one symptomatic tuber each of Alturas (from Washington) and Pike (from Oregon) were cloned and three clones of each were sequenced. BLAST analysis of the consensus sequences confirmed "Ca. L. solanacearum". The 16S sequences (1,071 bp) from the two tubers were identical and showed 99 to 100% identity to a number of 16S rDNA sequences of "Ca. L. solanaceaum" in GenBank (e.g., Accession Nos. HM246509 and FJ957897). The 16S rDNA sequences were deposited in GenBank as Accession Nos. JN848751 and JN848753. Consensus sequences of the two OMB clones (605 bp; deposited in GenBank as Accession Nos. JN848752 and JN848754) were identical and showed 97% identity to the two "Ca. L. solanacearum" OMB sequences in GenBank (Accession Nos. CP002371 and FJ914617). Potato psyllids (Bactericera cockerelli Sulc), the vector of "Ca. L. solanacearum", were present in ZC-affected fields in Oregon and Washington and the bacterium was confirmed by PCR in 5 to 10% of 128 adult psyllids collected from two fields. On the basis of foliar and tuber symptoms, specific PCR amplification with two primer pairs, sequence analyses, and the presence of Liberibacter-infected potato psyllids, ZC and "Ca. L. solanacearum" are present in potatoes in Oregon and Washington State. Washington and Oregon together grow ~80,000 ha of potatoes. ZC has caused significant economic damage to potatoes in Texas, Mexico, Central America, and New Zealand (1). Therefore, ZC may pose a risk to agriculture in Oregon, Washington, and neighboring states. However, the potential for development of widespread and serious disease will depend upon the arrival time and number of infective potato psyllids entering the region. References: (1) J. M. Crosslin et al. Online publication. doi:10.1094/PHP-2010-0317-01-RV, Plant Health Progress, 2010. (2) J. M. Crosslin et al. Southwest. Entomol. 36:125, 2011. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) G. A. Secor. Plant Dis. 93:574, 2009.

First Report of Potato virus Y in Potato in Tajikistan.

Potato (Solanum tuberosum L.) is widely grown as a staple food and cash crop in Tajikistan and is an important food security crop in the country. In June 2011, we conducted a survey of potatoes in farmers' fields in the Buston and Dushanbe regions (about 200 miles apart) of Tajikistan. Potato plants with stunted growth and leaves showing chlorotic spots, curling, and necrotic spots and rings were observed with the disease incidence monitored in 10 fields each in Buston and Dushanbe areas varying between 10 and 60%. Representative samples from symptomatic plants tested positive for Potato virus Y (PVY) using virus-specific immunostrips (Agdia Inc., Elkhart, IN). Leaf samples from symptomatic plants were collected from Buston and Dushanbe areas, imprinted on FTA Classic Cards (Whatman International Ltd., Maidstone, UK), air dried, and shipped to the lab at Washington State University for confirmatory diagnostic tests. Total nucleic acids were eluted from FTA cards (1) and subjected to reverse transcription (RT)-PCR with primers (PVY/Y4A and PVY/Y3S) specific to the coat protein of PVY (3). Samples infected with PVY ordinary strain (PVYO), tuber necrosis strain (PVYNTN), tobacco veinal necrosis strains (PVYEU-N and PVYNA-N), and a recombinant strain (PVYN:O) were included as references to validate RT-PCR results. A single DNA product of approximately 480 bp was amplified from potato samples that tested positive with PVY-specific immunostrips. The amplified fragments from two samples from Dushanbe and six from Buston areas were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA) and two independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 90 to 100% identity among the cloned amplicons (GenBank Accession Nos. JQ743609 to JQ743616) and 90 to 100% with corresponding nucleotide sequence of reference PVY strains (GenBank Accession Nos. JQ743617 to JQ743621). A global phylogenetic analysis of sequences revealed the presence of PVYO in both samples from Dushanbe and one sample from Buston regions and presence of PVYNTN in the remaining five samples from the Buston region. Because of the possible occurrence of mixed infections of PVY strains (2), further studies are needed to determine the presence of mixed infections of two or more strains of PVY and their specificity to potato cultivars. To our knowledge, this study represents the first confirmed report of two distinct strains of PVY in potato in Tajikistan. The occurrence of PVYNTN, a quarantine pathogen in many countries (2), warrants additional investigations to improve sanitary status of potato fields and to facilitate the availability of virus-free seed in clean plant programs for significant yield increases in Tajikistan. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) S. Gray et al. Plant Dis. 94:1384, 2010. (3) R. P. Singh et al. J. Virol. Methods 59:189, 1996.

First Report of Potato mop-top virus on Potatoes in Washington State.

In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. References: (1) N. David et al. Plant Dis. 94:1506, 2010. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) H. Xu et al. Plant Dis. 88:363, 2004.

First Report of Potato mop-top virus in North Dakota.

Potato mop-top virus (PMTV) is the type member of the genus Pomovirus. PMTV is an important pathogen of potato, causing significant economic losses in Northern Europe, North and South America, and Asia (3). PMTV in the United States was first reported in Maine (2). PMTV is vectored by the plasmodiophoromycete Spongospora subterranea cv. subterranea, which causes powdery scab of potato (1). S. subterranea and PMTV are usually associated with cool and humid environments. In the spring of 2010, six potato tubers of cv. Russet Burbank were received from a commercial potato farm in Grand Forks County in North Dakota. The tubers had multiple, internal, concentric, necrotic arcs and circles. The presence of PMTV in the necrotic lesions was verified by a positive double-antibody sandwich-ELISA (Agden Ltd., Ayr, Scotland). The tuber lesions had an absorbance value (405 nm) at least two times greater than that of the negative control sample, which consisted of a healthy tuber. Total RNA was extracted from lesions of six different tubers that tested positive by ELISA using a Total RNA Isolation kit (Promega Corp. Madison, WI). These extracts were tested for PMTV by reverse transcription (RT)-PCR using two different sets of primers. The primer set H360/C819 targeted the coat protein (CP) of PMTV and yielded an amplicon of 460 bp (4). The amplicons generated from the necrotic lesions were cloned (TOPO Cloning; Invitrogen, Carlsbad, CA) and sequenced. Another set of primers, pmtF4/pmtR4, designed to bind to a region in RNA 2 of PMTV, yielded a 417-bp amplicon that also was cloned and sequenced (3). The sequences from all six tuber lesions were identical for the respective primer sets. A consensus sequence for each primer pair was submitted to GenBank (Accession No. HM776171 for primers pmtF4/pmtR4 and No. HM776172 for primers H360/C819). The sequences obtained from the H360/C819 and pmtF4/pmtR4 amplicons were 99% identical to the corresponding regions of PMTV isolates from Northern Europe (GenBank Accession Nos. AM503629 and AJ277556, respectively). Freeze-dried, necrotic tuber tissue from all six tubers was also tested at a USDA Laboratory in Prosser, WA by RT-PCR with the H360/C819 primer pair (4), confirming the results above. Cloning and sequencing of one of the amplicons revealed 100% similarity to the sequence described above for these primers (GenBank Accession No. HM776172), confirming the presence of PMTV in the symptomatic tubers. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge this is the first report of PMTV in North Dakota. References: (1) R. A. C. Jones and B. D. Harrsion. Ann. Appl. Biol. 63:1, 1969. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) J. Santala et al. Ann. Appl. Biol. Online publication. DOI: 10.1111/j.1744-7348.2010.00423.x (4) H. Xu et al. Plant Dis. 88:363, 2004.

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State.

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5' TAACACAACACAAAGCAAACC 3' and reverse: 5' CCAAATACTACTTTAACCGCA 3') (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

First Report of Seedborne Cherry leaf roll virus in Wild Potato, Solanum acaule, from South America.

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3' untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2). References: (1) K. Hosaka and D. M. Spooner. Theor. Appl. Genet. 84:851, 1992. (2) R. A. C. Jones et al. Phytopathology 73:195, 1983. (3) J. R. Thompson et al. Arch. Virol. 149:2141, 2004. (4) B. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

First Report of "Candidatus Liberibacter solanacearum" in Pepper Plants in México.

Bell pepper (Capsicum annuum) plants exhibiting symptoms that resembled those of potato psyllid (Bactericera cockerelli Sulc) damage and "Candidatus Liberibacter solanacearum" infection (2) were observed in a pepper field in La Cruz de Elota, Sinaloa, México in March 2009, with an infection rate of 1.5%. Plants exhibited chlorotic or pale green apical growth and leaf cupping, sharp tapering of the leaf apex, shortened internodes, and an overall stunting (2). Total DNA was extracted from the top whole leaf tissue of nine symptomatic and five asymptomatic pepper plants with cetyltrimethylammoniumbromide (CTAB) buffer (3,4). Seven and eight of the nine selected symptomatic pepper plants yielded the expected 1,168-bp 16S rDNA and the expected 669-bp rplJ/rplL ribosomal protein gene amplicons with the "Ca. L. solanacearum" specific OA2/OI2c and CL514F/CL514R primer pairs, respectively, indicating the presence of liberibacter (2,4). Nucleic acid from asymptomatic pepper plants yielded no products with these primers. Three amplicons generated from symptomatic pepper plants with each primer pair were cloned into pCRII-TOPO plasmid vectors (Invitrogen, Carlsbad, CA) and three clones of each amplicon were sequenced in both directions (ACGT, Inc., Wheeling, IL). BLAST analysis of the 16S rDNA consensus sequence (GenBank Accession No. FJ957896) showed 100% identity to 16S rDNA sequences of "Ca. L. solanacearum" amplified from Solanum betaceum (EU935004) and S. lycopersicum (EU834130) from New Zealand (2), and "Ca. L. psyllaurous" from potato psyllids (EU812559) (1). The ribosomal protein gene consensus sequence (GenBank Accession No. FJ957894) was 100% identical to the analogous rplJ and rplL "Ca. L. solanacearum" ribosomal protein gene sequence amplified from S. lycopersicum (EU834131) from New Zealand (2) and to 'Ca. Liberibacter' sp. sequence amplified from zebra chip-infected potato tubers from Lancaster, CA (FJ498803). To our knowledge, this is the first report of "Ca. L. solanacearum" associated with bell pepper in México. "Ca. L. solanacearum" was first reported in tomato and pepper plants in 2008 in New Zealand, where it has resulted in plant decline and significant yield loss, resulting in millions of dollars in losses to the commercial glasshouse tomato and pepper industry (2). Zebra chip, a new and emerging potato disease associated with 'Ca. Liberibacter' sp., was first identified in México in 1994, where it has caused significant economic damage, often leading to abandonment of entire potato fields (3,4). References: (1) A. K. Hansen et al. Appl. Environ. Microbiol. 74:5862, 2008. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. J. Econ. Entomol. 100:656, 2007. (4) J. E. Munyaneza et al. Plant Dis. 93:552, 2009.

First Report of "Candidatus Liberibacter solanacearum" in Tomato Plants in México.

Tomato (Solanum lycopersicum) plants exhibiting symptoms resembling those of permanent yellowing disease (known in Mexico as "permanente del tomate") that is commonly associated with phytoplasmas (1) were observed in tomato fields in Sinaloa, México in March 2009. Plant symptoms also resembled those caused by "Candidatus Liberibacter solanacearum" infection (2). Affected plants showed an overall chlorosis, severe stunting, leaf cupping, purple discoloration of veins, excessive branching of axillary shoots, and leaf scorching (1,2). Symptom incidence ranged from 18 to 40%. To investigate whether liberibacter is associated with permanent yellowing disease of tomato in México, eight symptomatic and five asymptomatic tomato plants were collected from two fields in La Cruz de Elota and Culiacán, Sinaloa. Total DNA was extracted from the top whole leaf tissue of symptomatic and asymptomatic plants with cetyltrimethylammoniumbromide (CTAB) buffer (3,4). DNA samples were tested by PCR using primer pairs OA2/OI2c and CL514F/CL514R, which amplify a sequence from the 16S rDNA and rplJ and rplL ribosomal protein genes, respectively, of "Ca. L. solanacearum" (2,4). The DNA samples were also tested for phytoplasmas with nested PCR using universal primer pairs P1/P7 and fU5/rU3 (3). DNA from five and four symptomatic plants yielded the expected 1,168-bp 16S rDNA and 669-bp rplJ/rplL amplicons, respectively, indicating the presence of liberibacter. Extracts from asymptomatic plants yielded no products with these primers. Amplicons generated from three symptomatic plants with each primer pair were cloned into pCRII-TOPO plasmid vectors (Invitrogen, Carlsbad, CA) and three clones of each of these amplicons were subsequently sequenced in both directions (ACGT, Inc., Wheeling, IL). BLAST analysis of the 16S rDNA consensus sequence (GenBank Accession No. FJ957897) showed 100% identity to 16S rDNA sequences of "Ca. L. solanacearum" amplified from S. betaceum (EU935004) and S. lycopersicum (EU834130) from New Zealand (2), and "Ca. L. psyllaurous" from potato psyllids (EU812559). The rplJ/rplL consensus sequence (GenBank Accession No. FJ957895) was 100% identical to the analogous rplJ and rplL "Ca. L. solanacearum" ribosomal protein gene sequence amplified from S. lycopersicum (EU834131) from New Zealand (2) and 'Ca. Liberibacter' sp. sequence amplified from zebra chip-infected potatoes from Lancaster, CA (FJ498803). No phytoplasmas were detected in the symptomatic tomato plants. To our knowledge, this is the first report of "Ca. L. solanacearum" associated with tomatoes in México. In 2008, this bacterium was detected in glasshouse tomatoes in New Zealand and caused millions of dollars in losses to the commercial glasshouse tomato industry (2). References: (1) R. L. Holguín-Peña et al. Plant Dis. 91:328, 2007. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. J. Econ. Entomol. 100:656, 2007. (4) J. E. Munyaneza et al. Plant Dis. 93:552, 2009.

First Report of 'Candidatus Liberibacter psyllaurous' in Potato Tubers with Zebra Chip Disease in Mexico.

Zebra Chip (ZC), an emerging disease of potato (Solanum tuberosum L.) first documented in potato fields around Saltillo in México in 1994, has been identified in the southwestern United States, México, and Central America and is causing losses of millions of dollars to the potato industry (4). Recently, this damaging potato disease was also documented in New Zealand (3). This disease is characterized by a striped pattern of necrosis in tubers produced on infected plants, and fried chips processed from these infected tubers are commercially unacceptable (4). Recent studies conducted in the United States and New Zealand have associated ZC with a new species of 'Candidatus Liberibacter' vectored by the potato psyllid, Bactericera cockerelli Sulc (1,3,4). A bacterium designated 'Candidatus Liberibacter psyllaurous' has recently been identified in potato plants with "psyllid yellows" symptoms that resemble those of ZC (2). To investigate whether liberibacter is associated with ZC in México, 11 potato (cv. Atlantic) tuber samples exhibiting strong ZC symptoms and six asymptomatic tubers were collected from a ZC-affected commercial potato field near Saltillo City, Coahuila, México in September 2008 and tested for this bacterium by PCR. Total DNA was extracted from symptomatic and asymptomatic tubers with cetyltrimethylammoniumbromide (CTAB) buffer (4). DNA samples were tested by PCR using primer pair OA2/OI2c (5'-GCGCTTATTTTTAATAGGAGCGGCA-3' and 5'-GCCTCGCGACTTCGCAACCCAT-3', respectively) specific for 16S rDNA and primer pair CL514F/R (5'-CTCTAAGATTTCGGTTGGTT-3' and 5'-TATATCTATCGTTGCACCAG-3', respectively) designed from ribosomal protein genes (3). Seven of eleven (63.7%) ZC-symptomatic tubers and one of six (16.7%) asymptomatic potatoes yielded the expected 1,168-bp 16S rDNA and 669-bp CL514F/R amplicons, indicating the presence of liberibacter. Amplicons generated from symptomatic tubers were cloned into pCR2.1-Topo plasmid vectors (Invitrogen, Carlsbad, CA) and one clone of each amplicon was sequenced in both directions (ACGT, Inc., Wheeling, IL). BLAST analysis of the ZC OA2/OI2c sequence (GenBank Accession No. FJ498806) showed 100% identity to liberibacter 16S rDNA sequences amplified from potato psyllids from Dalhart, TX and potato tubers from Garden City, KS (GenBank Accession Nos. EU921627 and EU921626, respectively). The ZC CL514F/R sequence (GenBank Accession No. FJ498807) was 98% identical to analogous rplJ and rplL liberibacter ribosomal protein gene sequences amplified from several solanaceous plants in New Zealand (GenBank Accession Nos. EU834131 and EU935005). The OA2/OI2c sequence was also identical to the 16S rDNA sequence (Genbank Accession No. EU812559) of 'Ca. Liberibacter psyllaurous' (2). To our knowledge, this is the first report of 'Ca. Liberibacter psyllaurous' associated with ZC-affected potatoes in México. References: (1) J. A. Abad et al. Plant Dis. 93:108, 2009. (2) A. K. Hansen et al. Appl. Environ. Microbiol. 74:5862, 2008. (3) L. W. Liefting et al. Plant Dis. 92:1474, 2008. (4) J. E. Munyaneza et al. J. Econ. Entomol. 100:656, 2007.

First Report of 'Candidatus Liberibacter psyllaurous' in Zebra Chip Symptomatic Potatoes from California.

A disease that severely affects processing potatoes (Solanum tuberosum L.), termed zebra chip (ZC), has been identified in several locations in the United States (Texas, Nebraska, Colorado, Kansas, New Mexico, Arizona, and Nevada), Mexico, and Central America (4). The disease name comes from the rapid oxidative darkening of freshly cut tubers and the dark stripes and blotches that occur in chips processed from infected tubers. Recently, the disorder has been associated with a new 'Candidatus Liberibacter' species in New Zealand (3). Also, a bacterium designated 'Candidatus Liberibacter psyllaurous' has been identified recently in potato plants with "psyllid yellows" symptoms that resemble foliar symptoms of ZC (2). In the fall of 2008, 10 tubers were received at the Prosser laboratory from a commercial potato grower and five had symptoms characteristic of ZC. The tubers, cv. Dakota Pearl, were grown near Lancaster in southern California. The tubers showed rapid oxidation upon slicing and the sunken stolon attachment characteristic of ZC (4). Nucleic acid was extracted from symptomatic tubers (1) and tested by PCR for 'Ca. Liberibacter' species with primer pairs OA2/OI2c (5'-GCGCTTATTTTTAATAGGAGCGGCA-3' and 5'-GCCTCGCGACTTCGCAACCCAT-3') and CL514F/R (5'-CTCTAAGATTTCGGTTGGTT-3' and 5'-TATATCTATCGTTGCACCAG-3'), which amplify from the 16S rDNA and rplJ and rplL ribosomal protein genes, respectively (3). Four of the five tubers with distinct ZC symptoms yielded the expected amplicons with both primer pairs. Two tubers with mild internal discoloration yielded correctly sized amplicons but in lesser amounts than from the severely affected tubers. Nucleic acid from healthy potato tubers yielded no product with these primers. One clone of the 1,168-bp OA2/OI2c amplicon and two clones of the 669-bp CL514F/R amplicon from a strongly positive sample were sequenced in both directions (ACGT, Inc., Wheeling, IL). BLAST alignments of the consensus sequences of the OA2/OI2c and CL514F/R amplicons (GenBank Accessions Nos. FJ498802 and FJ498803, respectively) revealed 100% identity with analogous 'Ca. Liberibacter' sequences reported from ZC-symptomatic potatoes in New Zealand (GenBank Accession Nos. EU849020 and EU919514). The OA2/OI2c amplicon was also identical to a sequence of 'Ca. Liberibacter psyllaurous' (GenBank Accession No. EU812559) from psyllid yellows-affected potatoes in the United States (2) and also showed a 99% identity with sequences from a 'Ca. Liberibacter' species reported in ZC tubers from Kansas (GenBank Accession No. EU921626). Potato crops with symptoms of ZC have been observed previously in California (4), but this is the first identification of 'Ca. Liberibacter psyllaurous' from diseased potatoes grown in California. Since ZC was first reported in the mid- to late-1990s, information from potato growers and processors suggests that ZC is becoming more important. The disease has caused millions of dollars in losses, particularly in south Texas (4). The identification of 'Ca. Liberibacter psyllaurous' in California provides additional evidence that the disease is increasing in importance in other potato-growing regions. References: (1) J. M. Crosslin et al. Plant Dis. 90:663, 2006. (2) A. K. Hansen et al. Appl. Environ. Microbiol. 74:5862, 2008. (3) L. W. Liefting et al. Plant Dis. 92:1474, 2008. (4) J. E. Munyaneza et al. Subtrop. Plant Sci. 59:30, 2007.

First Report of Tomato spotted wilt virus Causing Potato Tuber Necrosis in Texas.

In the summer of 2008, potato (Solanum tuberosum L.) tubers (cvs. FL1867, FL2053, and FL1922) from commercial fields near Dalhart, TX were observed with distinct external erumpent rings and severe internal discolorations including blotches, spots, and dry, cork-like tissue. The presence of rings suggested the possible involvement of one or more viruses. Nucleic acid from seven of eight symptomatic tubers received in Washington (cvs. FL1867 and FL1922) tested positive for Tomato spotted wilt virus (TSWV) by reverse transcription (RT)-PCR with primers TSWV 1 and 2 (3). Similarly, tubers (cvs. FL1867 and FL2053) received in North Dakota tested positive for TSWV with forward (S1983) and reverse (S2767) primers of Tsompana et al. (4). The 777-bp amplicon obtained with primers TSWV 1 and 2 and the 803-bp amplicon obtained with primers S1983 and S2767 were cloned and three clones of each were sequenced. Analysis of the consensus sequences and BLAST comparisons confirmed the Washington and North Dakota sequences were indeed TSWV in origin and were each 98 to 99% identical to the corresponding nucleocapsid region of a number of TSWV isolates and most closely related to an isolate detected in eastern black nightshade from Colorado (GenBank No. AY777475). The deduced amino acid sequences of the 777-bp nucleocapsid open reading frame differed from AY777475 at only two residues in each of the Washington and North Dakota sequences. The Washington and North Dakota derived sequences were deposited with GenBank (Nos. FJ882069 and FJ882070, respectively). None of the eight symptomatic tubers tested positive for Tobacco rattle virus (TRV), Alfalfa mosaic virus (AMV), or the necrotic strains of Potato virus Y (PVY) by RT-PCR. Mechanical transmission tests were conducted by grinding symptomatic tissue of a TSWV-positive FL1867 tuber in 10 volumes of 30 mM potassium phosphate buffer, pH 8.0, containing 10 mM of sodium diethyldithiocarbamate and 10 mM of sodium thioglycollate and rub inoculated onto Carborundum-dusted leaves of Samsun NN tobacco. Approximately 10 days after inoculation, chlorotic-necrotic rings were present on the inoculated leaves and circular necrotic lesions developed on the upper leaves. Dark stem lesions were also present on inoculated tobacco, and after 3 weeks, the upper leaves developed severe, spreading lesions. Tissue from the symptomatic tobacco tested positive for TSWV by RT-PCR (primers TSWV 1 and 2) and also with a TSWV-specific ImmunoStrip (Agdia, Inc., Elkhart, IN), but tested negative for TRV, AMV, and PVY by RT-PCR. TSWV has been reported on field-grown potatoes in North Carolina (1) and has been reported on potatoes in Australia (2) and in other parts of the world (referenced in 1). To our knowledge, this is the first report associating TSWV with tuber necrosis on potatoes in Texas. References: (1) J. A. Abad et al. Am. J. Potato Res. 82:255, 2005. (2) L. J. Latham and R. A. C. Jones. Aust. J. Agric. Res. 48:359, 1997. (3) R. Navarre et al. Am. J. Potato Res. 86:88, 2009. (4) M. Tsompana et al. Mol. Ecol. 14:53, 2005.

Rapid Detection of Tobacco Rattle Tobravirus in Viruliferous Paratrichodorus allius from Greenhouse and Field Specimens.

The stubby root nematode, Paratrichodorus allius, is important to the potato industry in the Pacific Northwest of USA, because it vectors Tobacco rattle virus (TRV), the causal agent of corky ringspot disease. The current method for determining if nematodes are viruliferous for TRV takes several weeks, requiring a glasshouse bioassay followed by a serological test. To overcome this drawback, a rapid and affordable molecular test was developed using reverse transcription polymerase chain reaction (RT-PCR) to identify viruliferous P. allius nematodes within 48 hours. Primers from the 16 kDa gene of TRV were used to detect TRV in both greenhouse-reared and field collected P. allius. TRV RNA can be detected consistently in nucleic acids equivalent to one quarter of a viruliferous adult nematode reared in the greenhouse. In order to reduce the time and expense of processing individual nematodes from field samples, viral RNA was consistently and affordably detected in extracts from 5 field-collected adult P. allius.

Prevalence and natural host range of Homalodisca coagulata virus-1 (HoCV-1).

Transmission electron microscopy was used to confirm the presence of picorna-like virus particles presumed to be Homalodisca coagulata virus-1 (HoCV-1) in the midgut region of adult glassy-winged sharpshooters (GWSS). In addition, we offer a reverse transcription polymerase chain reaction (RT-PCR) assay for the detection of this virus with a sensitivity of approximately 95 genome equivalents. A survey employing this assay in conjunction with GWSS samples collected throughout the United States including California, Hawaii, Florida Georgia, and the Carolinas revealed a fairly widespread pattern of distribution, although potentially restricted to temperate regions, areas with elevated host densities, or to populations of a common origin. The virus was found to naturally infect adults regardless of host plant and was not specific to a particular lifestage or sex. Examination of alternate leafhopper species further demonstrated that, although infection is not ubiquitous to all sharpshooter genera, HoCV-1 is not limited to Homalodisca vitripennis (=H. coagulata).

First Report of Tobacco rattle virus Causing Corky Ringspot in Potatoes Grown in Minnesota and Wisconsin.

In July 2007, potato tubers cv. Russet Burbank (RB) with necrotic arcs and spots were detected in three fields in Buffalo County, Wisconsin and one field in Benson County, Minnesota. Umatilla Russet (UR) potatoes harvested from the west half of a field in Swift County, MN had similar, but visually distinct necrotic lesions. Portions of one field in Minnesota were abandoned, and the stored potato crop from two fields in Wisconsin was rejected by processors, representing a total crop loss due to tuber necrosis. Tuber symptoms displayed in both cultivars resembled those described for corky ringspot caused by Tobacco rattle virus (TRV) (4). Total RNA was isolated from necrotic tuber tissue crushed in liquid nitrogen and extracted using the Total RNA Isolation Kit (Promega Corp., Madison, WI). These extracts were tested for the presence of TRV by reverse transcription (RT)-PCR using primers complementary to nucleotides 6555 to 6575 and identical to nucleotides 6113 to 6132 within the 3' terminal open reading frame of TRV RNA-1 (3). The expected 463-bp fragments were amplified from RB tubers. Nucleotide sequences from a Wisconsin and Minnesota isolate (GenBank Accession Nos. EU569290 and EU569291, respectively) were 99 to 100% identical to the corresponding region in a published TRV sequence (GenBank Accession No. AF055912). A 396-bp fragment was amplified from UR tubers and sequence data (GenBank Accession No. EU569292) indicated a unique 63 nucleotide sequence was substituted for a 129 nucleotide sequence spanning residues 227 to 357 of the 463-bp amplicon from the RB TRV isolates. Seven fragments were sequenced from different UR tubers and the 396-bp fragment was identical among them. The sequence outside the substituted region had 92% identity to the published TRV sequence. Amplification of the full-length TRV RNA2 using primers 179/180 located in the 5' and 3' untranslated regions (2) was successful for 28 and 0% of the RB and UR samples, respectively, suggesting that the RNA2 is not present in these strains or has undergone significant mutation. TRV-infected sap from both potato cultivars was mechanically transmitted to tobacco cv. Samsun NN and these plants subsequently tested positive for TRV by ELISA using ATCC antiserum PVAS 820. Ninety tubers exhibiting mild to severe symptoms of TRV were planted in the greenhouse. Each tuber was bisected laterally; necrotic tissue was removed from one half of the tuber and tested for the presence of TRV using RT-PCR protocols described above for RNA1. The remaining half was bisected horizontally and both sections were planted. Foliage from each emerged plant was subsequently also tested by RT-PCR for TRV RNA1. All RB tubers from Wisconsin tested positive for TRV, but only 7 of 24 emerged plants tested positive. Only 72% of the UR tubers and 4 of 25 emerged plants tested positive. TRV has been confirmed in California, Colorado, Florida, Idaho, Michigan (1), Oregon, and Washington. To our knowledge, this is the first report of corky ringspot in potato caused by TRV in Minnesota and Wisconsin. References: (1) W. W. Kirk et al. Plant Dis. 92:485, 2008. (2) S. A. MacFarlane. J. Virol. Methods. 56:91, 1996. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) S. A. Slack. Tobacco rattle virus. Page 71 in: Compendium of Potato Diseases. 2nd ed. W. R. Stevenson et al., eds. The American Phytopathological Society, St. Paul, MN, 2001.