Bisphenol A induces coronary endothelial cell necroptosis by activating RIP3/CamKII dependent pathway.

Epidemiological studies link long term exposure to xenoestrogen Bisphenol-A to adverse cardiovascular effects. Our previous results show that BPA induces hypertension by a mechanism involving CamKII activation and increased redox stress caused by eNOS uncoupling. Recently, CamKII sustained activation has been recognized as a central mediator of programmed cell death in cardiovascular diseases, including necroptosis. However, the role of necroptosis in cardiac response to BPA had not yet been explored. Mice exposed to BPA for 16 weeks showed altered heart function, electrical conduction, and increased blood pressure. Besides, a stress test showed ST-segment depression, indicative of cardiac ischemia. The hearts exhibited cardiac hypertrophy and reduced vascularization, interstitial edema, and large hemorrhagic foci accompanied by fibrinogen deposits. BPA initiated a cardiac inflammatory response, up-regulation of M1 macrophage polarization, and increased oxidative stress, coinciding with the increased expression of CamKII and the necroptotic effector RIP3. In addition, cell death was especially evident in coronary endothelial cells within hemorrhagic areas, and Evans blue extravasation indicated a vascular leak in response to Bisphenol-A. Consistent with the in vivo findings, BPA increased the necroptosis/apoptosis ratio, the expression of RIP3, and CamKII activation in endothelial cells. Necrostatin-1, an inhibitor of necroptosis, alleviated BPA induced cardiac dysfunction and prevented the inflammatory and hemorrhagic response in mice. Mechanistically, silencing of RIP3 reversed BPA-induced necroptosis and CamKII activation in endothelial cells, while inhibition of CamKII activation by KN-93 had no effect on RIP3 expression but decreased necroptotic cell death suggesting that BPA induced necroptosis is mediated by a RIP 3/CamKII dependent pathway. Our results reveal a novel pathogenic role of BPA on the coronary circulation. BPA induces endothelial cell necroptosis, promotes the weakening of coronary vascular wall, which caused internal ventricular hemorrhages, delaying the reparative process and ultimately leading to cardiac dysfunction.

Critical role of the death receptor pathway in the antitumoral effects induced by hispanolone derivatives.

Labdane diterpenoids have a broad spectrum of biological activities including antibacterial, antiviral and anti-inflammatory properties. However, little is known about their possible role in the apoptotic cell death machinery. Here, we report that hispanolone derivatives, a group of labdane diterpenoids, induce apoptosis in different tumor cell lines by activating caspase-8 with subsequent participation of mitochondrial signaling. Activation of caspase-8 by hispanolone derivatives was followed by a decrease in mitochondrial membrane potential, the release of apoptotic factors from mitochondria to the cytosol, and activation of caspases-9 and 3. Hispanolone derivatives also led to a time-dependent cleavage of Bid. Inhibition of caspase-8 abrogated these processes, suggesting that the death receptor pathway has a critical role in the apoptotic events induced by hispanolone derivatives. In addition, silencing death receptors with small interfering RNA s or pretreating cells with neutralizing antibodies to Fas ligand, tumor necrosis factor receptor 1 (TNF-R1), and TNF-α receptor 2 (TRAIL) inhibited diterpenoid-induced apoptosis, revealing it to be dependent on these death receptors. Interestingly, hispanolone derivatives had no effect on non-tumor cells. Consistently, in vivo bioluminescence imaging corroborates this antineoplasic effect, as hispanolone derivatives significantly decrease cancer growth in tumor xenograft assays. These data demostrate the antitumoral effects of hispanolone derivatives and provide relevant preclinical validation for the use of these compounds as potent therapeutic agents in cancer treatment.

Labdane diterpenes protect against anoxia/reperfusion injury in cardiomyocytes: involvement of AKT activation.

Several labdane diterpenes exert anti-inflammatory and cytoprotective actions; therefore, we have investigated whether these molecules protect cardiomyocytes in an anoxia/reperfusion (A/R) model, establishing the molecular mechanisms involved in the process. The cardioprotective activity of three diterpenes (T1, T2 and T3) was studied in the H9c2 cell line and in isolated rat cardiomyocyte subjected to A/R injury. In both cases, treatment with diterpenes T1 and T2 protected from A/R-induced apoptosis, as deduced by a decrease in the percentage of apoptotic and caspase-3 active positive cells, a decrease in the Bcl-2/Bax ratio and an increase in the expression of antiapoptotic proteins. Analysis of cell survival signaling pathways showed that diterpenes T1 and T2 added after A/R increased phospho-AKT and phospho-ERK 1/2 levels. These cardioprotective effects were lost when AKT activity was pharmacologically inhibited. Moreover, the labdane-induced cardioprotection involves activation of AMPK, suggesting a role for energy homeostasis in their mechanism of action. Labdane diterpenes (T1 and T2) also exerted cardioprotective effects against A/R-induced injury in isolated cardiomyocytes and the mechanisms involved activation of specific survival signals (PI3K/AKT pathways, ERK1/2 and AMPK) and inhibition of apoptosis.

Development of real-time RT-PCR assays for the detection of Cucumber vein yellowing virus (CVYV) and Cucurbit yellow stunting disorder virus (CYSDV) in the whitefly vector Bemisia tabaci.

Reverse transcription followed by real-time PCR assays based on TaqMan chemistry have been developed for the detection and quantification of Cucumber vein yellowing virus (CVYV) and Cucurbit yellow stunting disorder virus (CYSDV) in individual adults of the whitefly vector Bemisia tabaci. The method includes an internal control for the detection of a gene from B. tabaci to compensate for variations in extraction efficiency. The assays designed were used to estimate proportions of viruliferous whiteflies collected from commercial greenhouse-grown crops in Spain. In a significant number of whiteflies, both viruses were detected and their amounts were estimated. The assays could be used to assist risk assessment of CVYV and CYSDV which constitute limiting factors in cucurbit crops. They are also suited to investigating the epidemiology and plant-virus-vector relationships in these diseases.

Bienzyme sensors based on novel polymethylferrocenyl dendrimers.

Amperometric bienzyme electrodes with horseradish peroxidase (HRP) and glucose oxidase (GOx) co-immobilized on polymethylferrocenyl dendrimers deposited onto platinum electrodes have been used for determination of the hydrogen peroxide produced by the oxidase during the enzymatic reaction. The redox dendrimers consist of flexible poly(propylenimine) dendrimer cores functionalised with octamethylferrocenyl units. The effects of dendrimer generation, the thickness of the dendrimer layer, substrate concentration, interferences, and reproducibility on the response of the sensors were investigated. The new bienzyme biosensors respond to substrate at work potential values between 200 and 50 mV (vs. SCE), have good sensitivity, and are resistant to interferences. Figure.

Mapping of neurokinin b in the cat brainstem.

We studied the distribution of neurokinin B-immunoreactive cell bodies and fibers in the cat brainstem using an indirect immunoperoxidase technique. The highest density of immunoreactive fibers was found in the motor trigeminal nucleus, the laminar and alaminar spinal trigeminal nuclei, the facial nucleus, the marginal nucleus of the brachium conjunctivum, the locus coeruleus, the cuneiform nucleus, the dorsal motor nucleus of the vagus, the postpyramidal nucleus of the raphe, the lateral tegmental field, the Kölliker-Fuse nucleus, the inferior central nucleus, the periaqueductal gray, the nucleus of the solitary tract, and in the inferior vestibular nucleus. Immunoreactive cell bodies containing neurokinin B were observed, for example, in the locus coeruleus, the dorsal motor nucleus of the vagus, the median division of the dorsal nucleus of the raphe, the lateral tegmental field, the pericentral nucleus of the inferior colliculus, the internal division of the lateral reticular nucleus, the inferior central nucleus, the periaqueductal gray, the postpyramidal nucleus of the raphe, and in the medial nucleus of the solitary tract. This widespread distribution of neurokinin B in the cat brainstem suggests that the neuropeptide could be involved in many different physiological functions. In comparison with previous studies carried out in the rat brainstem on the distribution of neurokinin B, our results point to a more widespread distribution of this neuropeptide in the cat brainstem.

Absence of a coding region for the helper component-proteinase in the genome of cucumber vein yellowing virus, a whitefly-transmitted member of the Potyviridae.

The complete nucleotide sequence of isolates of Cucumber vein yellowing virus (CVYV) has been determined. The viral genome comprises 9734 nucleotides, excluding a 3'-terminal poly(A) sequence. The genome of CVYV has a 5'-non coding and a 3' non coding region of respectively 67 and 240 nucleotides. The RNA of CVYV encodes a single polyprotein of 3148 amino acid residues and has a deduced genome organization and motifs typical for a member of the family Potyviridae. However, CVYV is atypical because it lacks a coding sequence region for the putative helper-component as well as conserved helper-component-proteinase motifs which may account for its vector relations. All the present coding regions were compared to those from several members of the Potyviridae family. CVYV is most closely related to Sweetpotato mild mottle virus confirming its assignation to the genus Ipomovirus, despite similarities with tritimoviruses.

Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus.

ABSTRACT Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.

First Report of Southern bean mosaic virus Infecting French Bean in Morocco.

Common bean (Phaseolus vulgaris L.) is grown on approximately 1,500 ha in commercial greenhouses and is of major economic importance in the Souss-Massa Region, Agadir, Morocco. Since October 2003, symptoms resembling a viral disease, consisting of pod mosaic and distortion and mild to severe mosaic in leaves, have been observed on bean plants in several greenhouses. Mechanical inoculation with symptomatic leaf extracts produced necrotic local lesions on P. vulgaris 'Pinto' and systemic symptoms similar to those observed in the naturally infected bean plants P. vulgaris 'Donna' (five plants per cultivar). Inoculated and naturally infected samples reacted positively using a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) to Southern bean mosaic virus (SBMV) (DSMZ, Braunschweig, Germany), a member of the Sobemovirus genus that is transmitted by contact, soil, beetles, and seeds (1). Virions purified from a naturally infected 'Donna' plant contained a 30-kDa polypeptide that reacted positively using sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blot analysis with SBMV antiserum (DSMZ). Reverse transcription-polymerase chain reaction amplification with SMBV primers as described by Verhoeven et al. (2) produced an expected 870-bp band. The amplicon was cloned, sequenced (GenBank Accession No. AJ748276), and compared to those isolates available in GenBank and had a nucleotide sequence identity of 87% and a derived amino acid sequence identity of 95% with an SBMV isolate from Spain (2). During a survey in different areas of the Souss-Massa Region, 20 symptomatic leaf and pod samples were randomly collected from 12 greenhouses (50 ha) where significant commercial losses were suffered because of this virus disease, and all samples were positive using DAS-ELISA for SBMV. To our knowledge, this is the first report of SBMV in Morocco. References: (1) J. H. Tremaine and R. I. Hamilton. Southern bean mosaic virus. No. 274 in: Descriptions of Plant Viruses. CMI/AAB, Kew, Surrey, England, 1983. (2) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 109:935, 2003.

Rapid detection of cucumber vein yellowing virus by tissue-print hybridisation with digoxigenin-labelled cDNA probes.

Hybridisation of tissue prints with nonradioactive cDNA probes was developed to detect cucumber vein yellowing virus (CVYV) in cucurbit plants. Results showed irregular distribution of the virus within cucumber, zucchini or melon plants without defined tropism for a specific tissue. Therefore, reliable diagnosis of CVYV requires analysis of tissue prints from at least five different plant sites. This detection procedure allows rapid analysis of large numbers of plants and it can be useful for epidemiological studies of CVYV and to control virus spread via eradication of early foci.

[Apolipoprotein E polymorphism as a predictor of progression of multiple sclerosis]. / El polimorfismo de la apolipoproteína E como marcador pronóstico de la esclerosis múltiple.

INTRODUCTION: During recent years, different studies have proposed that apolipoprotein E e4 can be a predictor of progression in multiple sclerosis. We aim to evaluate these findings in our country. PATIENTS AND METHODS: We studied 42 patients with relapsing remitting or secondary progressive multiple sclerosis, and a disease duration of at least 2 years. We correlated the presence or absence of e4 allele with markers of progression such as age of onset and diagnosis, disease duration, number of relapses, EDSS at 1, 2, 5 and 10 years, progression index and relapse rate. RESULTS: None of the parameters evaluated significantly correlate with e4 allele of the APOE. CONCLUSIONS: In spite of the limitation due to the small number of patients studied, we cannot confirm that APOE e4 allele is a predictor of progression of disability in multiple sclerosis.

El polimorfismo de la apolipoproteína Ecomo marcador pronósticode la esclerosis múltiple / Apolipoprotein e polymorphism AS a predictor of progression of multiple sclerosis

Introducción: En los últimos años se han publicado varios estudios en los que se ha propuesto que el alelo e4 del gen de la apolipoproteína E (APOE) es un marcador de progresión de la esclerosis múltiple. Pretendemos evaluar la validez de dicha determinación en nuestro medio. Pacientes y métodos: Se estudian 42 pacientes con esclerosis múltiple en su forma remitente recidivante o secundaria progresiva y de más de 2 años de evolución. Se correlaciona la presencia o ausencia del alelo e4 de la APOE con diferentes marcadores clínicos de progresión de la enfermedad, como son las edades de inicio y diagnóstico, años de evolución, número total de brotes, puntuaciones EDSS a los 1, 2, 5 y 10 años, índice de progresión y tasa de brotes. Resultados: Ninguno de los parámetros evaluados se correlaciona significativamente con la presencia o ausencia del alelo e4 de la APOE. Conclusiones: A pesar de la limitación impuesta por el pequeño número de casos estudiados, nuestro estudio no demuestra que el alelo e4 del gen de la APOE tenga valor como marcador pronóstico de la esclerosis múltiple (AU)

First Report of Turnip mosaic virus in Pisum sativum in Spain.

During 2001 and 2002, Pisum sativum var. vulgare plants grown as commercial crops in Almeria (southeast Spain) showed vein clearing and chlorotic mottle of leaves, leaf deformation, flower abortion, necrotic mottle and deformation of pods, and stunted plant growth. Crude sap of collected plants was mechanically inoculated on healthy pea plants which reproduced symptoms observed in the field; local necrotic lesions were produced on mechanically infected Chenopodium quinoa, C. amaranticolor, and Gomphrena globosa, systemic mosaic symptoms on Brassica napus and Nicotiana benthamiana, and local lesions plus systemic mosaic symptoms on N. clevelandii, which are all characteristic of Turnip mosaic virus (TuMV) (1). A reverse transcription-polymerase chain reaction assay using general primers for the extreme 3' end of the potyvirus genome amplified products of 750 and 1,700 bp in nucleic acid extracts from naturally infected pea plants as well as from the mechanically infected test plants. The overlapping nucleotide sequences of the products (GenBank Accession No. AJ489259) had a nucleotide sequence identity of 86.5% and a derived amino acid identity of 95.0% with several published sequences of TuMV (1). This report cites the first partial nucleotide sequence of TuMV infecting pea crops, and although natural infections of this virus in pea have been reported in Morocco (1976) and in the United States (2), to our knowledge, this is the first report of TuMV in Spain. References: (1) P. Lehmann et al. Physiol. Mol. Plant Pathol. 51:195, 1997. (2) R. Provvidenti. Plant Dis. Rep. 62:482, 1978.

A New Tomato yellow leaf curl virus Strain in Southern Spain.

Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four 'Kampala' and four 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.

Cobaltocenium-functionalized poly(propylene imine) dendrimers: redox and electromicrogravimetric studies and AFM imaging.

The first four generations of cobaltocenium-functionalized, diaminobutane-based poly(propylene imine) dendrimers DAB-dend-Cb,(PFb)x (x = 4, 8, 16, and 32; Cb=[Co(eta5-C5H4CONH)(eta5-C5H5)] (1-4) have been synthesized and characterized. The redox activity of the cobaltocenium centers in 1-4 has been characterized by using cyclic voltammetry and the electrochemical quartz-crystal microbalance (EQCM). All of the dendrimers exhibit reversible redox chemistry associated with the cobaltocenium/cobaltocene redox couple. Upon reduction. the dendrimers exhibit a tendency to electrodeposit onto the electrode surface, which is more pronounced for the higher generations. Pt and glassy carbon electrodes could be modified with films derived from 1-4,exhibiting a well-defined and persistent electrochemical response. EQCM measurements show that the dendrimers adsorb, at open circuit, onto platinum surfaces at monolayer or submonolayer coverage. Cathodic potential scanning past -0.75 V at which the cobaltocenium sites are reduced, gave rise to the electrodeposition of multilayer equivalents of the dendrimers. The additional material gradually desorbs upon re-oxidation so that only a monolayer equivalent remains on the electrode surface. Changes in film morphology as a function of dendrimer generation and surface coverage were studied by using admittance measurements of the quartz-crystal resonator on the basis of its electrical equivalent circuit, especially in terms of its resistance parameter. In general, we find that films of the lower dendrimer generation 1 behave rigidly, whereas those of the higher generation 4 exhibit viscoelastic behavior with an intermediate behavior being exhibited by 2 and 3. Using tapping-mode atomic force microscopy (AFM). we have been able to obtain molecularly resolved images of dendrimer 4 adsorbed on a Pt(111) electrode.

First Report of Cucumber vein yellowing virus in Spain.

In the autumn of 2000, an outbreak of a disease caused considerable losses in greenhouse cucumber crops in Almeria (Spain). Infected plants showed vein clearing followed by chlorosis in leaves and yellow/green chlorotic spots on fruits. These symptoms as well as the presence of Bemisia tabaci in the crops suggested the possible involvement of Cucumber vein yellowing virus (CVYV), a proposed member of the Potiviridae family, which was first described in 1960 in Cucumis spp. from Israel (1). B. tabaci populations and leaves from cucumber plants were collected from the greenhouses and analyzed by RT-PCR using specific primers (CV(+): 5'-AGCTAGCGCGTATGGGGTGAC-3'; CV(-): 5'-GCGCCGCAAGTGCAA-ATAAAT-3') that we designed based on the partial sequence published for CVYV (2). Total nucleic acid extracts from both B. tabaci individuals and the collected plants yielded amplification products of the expected size (449 bp), which were cloned and sequenced (Genebank accession number AJ301640). The sequence was 95.6% identical to that previously reported for CVYV. Nonviruliferous B. tabaci whiteflies were given a 24-h acquisition period on symptomatic leaves and then placed in groups of 15 insects on each of 10 healthy cucumber plants at the 4 leaf-stage for a 24-h inoculation period. Inoculated and control plants were analyzed 1 week later and the infection with CVYV was confirmed (10/10) by RT-PCR. Doublestranded RNA extractions from field-collected samples and from plants inoculated under controlled conditions suggested that no dsRNA formation was associated with the infection. This is the first report of CVYV in Spain. References: (1) S. Cohen and F. E. Nitzany. Phytopathol. Medit. 1:44, 1960. (2) H. Lecoq et al. J. Gen. Virol. 81:2289, 2000.

First Report of Cucumber leaf spot virus in Spain.

Cucumber leaf spot virus (CLSV), reclassified as a species in the new genus Aureusvirus (family Tombusviridae) (1), has ≈30-nm isometric particles with a ≈4.4-kb positive-sense, single-stranded RNA. CLSV is transmitted by the chytrid fungus Olpidium bornovanus. The virus has been reported in Germany, Great Britain, Greece, Jordan, and Saudi Arabia. During the fall of 2000, abundant chlorotic spots with necrotic centers were observed on the leaves of cucumber plants grown in a commercial greenhouse in Granada (southeastern Spain). When sap from collected leaves was used to mechanically inoculate cucumber, symptoms were reproduced and were suggestive of CLSV. Based on the nucleic acid sequence of CSLV (2), the following specific primers were designed: CLSVU1440 (5'-AAGGTAGGGGAGATCTTG-3') and CLSVA2160 (5'-GCTTCGGCTGATTCTGA-3'). When used in reverse transcription-polymerase chain reactions (RT-PCR), leaves expressing symptoms yielded amplification products of the expected size (720 bp). These products were cloned into a pGEM-T vector and sequenced (GenBank Accession No. AY038365). The similarity of the nucleic acid and derived amino acid sequences with the one published for CLSV (2) was 94.5 and 99.1%, respectively. The amino acid sequence was 86% identical to that of Pothos latent virus (GenBank Accession No. AJ243370). Ten cucumber plants grown in vermiculite supplemented with rhizosphere soil (1/30, vol/wt) from infected plants developed symptoms on leaves after 1 month and were positive for CLSV when leaf and root tissues were analyzed by RT-PCR and Southern blot hybridization. Plants grown in vermiculite alone did not become infected with CLSV. Microscopic examination of root tissue revealed O. bornovanus only in infected plants. To our knowledge, this is the first record of CSLV in Spain. References: (1) G. P. Martelli et al. Arch. Virol. 143:1847, 1998. (2) J. S. Miller et al. Virus Res. 52:51, 1997.