Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 9 de 9
Filter
1.
Trop Anim Health Prod ; 55(2): 89, 2023 Feb 20.
Article in English | MEDLINE | ID: mdl-36805351

ABSTRACT

One of the factors that limit ruminant production in the semiarid region is the lack of roughage in the dry season. The management of forage plants adapted to edaphoclimatic conditions is a strategy to improve animal production. This study was conducted to examine the effects of biomass sorghum silage (BSS; Sorghum bicolor (L.) Moench) and BRS capiaçu grass silage (CGS; Pennisetum purpureum Schum) with or without spineless cactus (Opuntia spp.) in crossbred Holstein × Zebu heifers' diets on the intake, apparent digestibility of the nutrients and animal performance (e.g., final weight, daily weight gain) (experiment 1). Also, to evaluate the ruminal kinetics of dry matter (DM) and neutral detergent fiber (NDF) of roughages used in diets using two animals cannulated in the rumen (experiment 2). In experiment 1, ten heifers with an initial body weight of 200 ± 2.74 kg (mean ± standard deviation) and a mean age of 10 months were used. The animals were distributed in an experimental design in two simultaneous 5 × 5 Latin squares. Five experimental diets were used: diet 1, Volumax sorghum silage (VSS); diet 2, biomass sorghum silage (BSS); diet 3, BRS capiaçu silage (CGS); diet 4, biomass sorghum silage (60%) with spineless cactus (40%) (BSS + SC); and diet 5, BRS capiaçu grass silage (60%) with spineless cactus (40%) (CGS + SC). The diets were formulated with sorghum silage or BRS capiaçu grass silage with or without spineless cactus (roughage) and a maize- and soybean-based concentrate (75:25 roughage-to-concentrate ratio) on DM basis. The experiment lasted 105 days, divided into five periods of 21 days (17 days for the adaptation of the animals to the diets and management and 4 for data collection and samples). The diets containing CGS and CGS + SC resulted in lower dry matter intake (DMI; 5.61 kg day-1; P < 0.01), which was 19.4% lower than the diets with VSS, BSS, and BSS + SC (7.00 kg day-1). The BSS + SC and CGS + SC diets showed higher crude protein digestibility (P < 0.01) at 21.9% than the other treatments (Volumax, BSS, CGS). The different diets did not change the final weight or the daily weight gain of the heifers. The BRS 716 biomass sorghum silage and BRS capiaçu grass combined with spineless cactus increased (P < 0.05) the intake of nonfibrous carbohydrates and did not interfere (P > 0.05) with the final weight or average daily gain of the crossbred Holstein × Zebu heifers. The standardized potentially degradable fraction (Bp) of the NDF was 13.91% higher (P < 0.01) for BSS and BSS + SC (61.6%) compared to the others (53.0%). A diet based on BSS + SC is recommended for feeding crossbred heifers in the growing phase.


Subject(s)
Opuntia , Sorghum , Cattle , Animals , Female , Poaceae , Brazil , Silage , Diet/veterinary , Dietary Fiber , Edible Grain
2.
Oral Dis ; 29(7): 2658-2666, 2023 Oct.
Article in English | MEDLINE | ID: mdl-35796645

ABSTRACT

OBJECTIVE: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival. MATERIALS AND METHODS: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC. RESULTS: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors. CONCLUSION: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival.


Subject(s)
Carcinoma, Squamous Cell , Head and Neck Neoplasms , Mouth Neoplasms , Humans , Squamous Cell Carcinoma of Head and Neck/genetics , Carcinoma, Squamous Cell/pathology , Transcriptome , Mouth Neoplasms/metabolism , Gene Expression Regulation, Neoplastic , Survival Analysis , Biomarkers, Tumor/genetics , Head and Neck Neoplasms/genetics , Prognosis
3.
PLoS Negl Trop Dis ; 16(4): e0010356, 2022 04.
Article in English | MEDLINE | ID: mdl-35421085

ABSTRACT

Chagas disease (CD) is recognized by the World Health Organization as one of the thirteen most neglected tropical diseases. More than 80% of people affected by CD will not have access to diagnosis and continued treatment, which partly supports the high morbidity and mortality rate. Machine Learning (ML) can identify patterns in data that can be used to increase our understanding of a specific problem or make predictions about the future. Thus, the aim of this study was to evaluate different models of ML to predict death in two years of patients with CD. ML models were developed using different techniques and configurations. The techniques used were: Random Forests, Adaptive Boosting, Decision Tree, Support Vector Machine, and Artificial Neural Networks. The adopted settings considered only interview variables, only complementary exam variables, and finally, both mixed. Data from a cohort study with CD patients called SaMi-Trop were analyzed. The predictor variables came from the baseline; and the outcome, which was death, came from the first follow-up. All models were evaluated in terms of Sensitivity, Specificity and G-mean. Among the 1694 individuals with CD considered, 134 (7.9%) died within two years of follow-up. Using only the predictor variables from the interview, the different techniques achieved a maximum G-mean of 0.64 in predicting death. Using only the variables from complementary exams, the G-mean was up to 0.77. In this configuration, the protagonism of NT-proBNP was evident, where it was possible to observe that an ML model using only this single variable reached G-mean of 0.76. The configuration that mixed interview variables and complementary exams achieved G-mean of 0.75. ML can be used as a useful tool with the potential to contribute to the management of patients with CD, by identifying patients with the highest probability of death. Trial Registration: This trial is registered with ClinicalTrials.gov, Trial ID: NCT02646943.


Subject(s)
Chagas Disease , Machine Learning , Chagas Disease/diagnosis , Cohort Studies , Humans
4.
Gene ; 800: 145839, 2021 Oct 20.
Article in English | MEDLINE | ID: mdl-34274470

ABSTRACT

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.


Subject(s)
COVID-19/genetics , RNA, Antisense/genetics , SARS-CoV-2/genetics , Algorithms , COVID-19/virology , Computer Simulation , Gene Expression Regulation, Viral , Humans
5.
Rev Paul Pediatr ; 39: e2019129, 2021.
Article in Portuguese, English | MEDLINE | ID: mdl-32756759

ABSTRACT

OBJECTIVE: To determine new body mass index (BMI) reference values to classify the nutritional status of children aged six to ten years old from the city of Montes Claros (state of Minas Gerais), Southeast Brazil. METHODS: The sample consisted of 3,863 individuals from both genders. Body mass and height were measured to determine the BMI. We adopted the Lambda, Mu, and Sigma (LMS) method to obtain the cut-off points. After that, each stratum curve was smoothed using quartic polynomials by gender. Average interpolation was used to determine the biannual distribution values. We calculated the 3rd, 85th, and 95th centiles to classify underweight, overweight, and obesity, respectively, according to gender and age. RESULTS: After tabulating the LMS parameters at biannual intervals by gender, we plotted a graphic with seven centiles of BMI distribution and calculated the new BMI parameters for children aged 6-10 years old from the city of Montes Claros. The cut-off values for underweight, overweight, and obesity classification were, respectively, 17.5, 25 and 30 kg/m2. CONCLUSIONS: For the studied children, the use of traditional BMI references may result in the overestimation of underweight and underestimation of overweight and obesity. Studies should be carried out with periodic updates, respecting the characteristics of each location in order to use BMI reference values to classify the nutritional status of children and adolescents.


Subject(s)
Body Mass Index , Nutritional Status , Age Factors , Brazil , Child , Cross-Sectional Studies , Female , Humans , Male , Pediatric Obesity/diagnosis , Pregnancy , Reference Values , Thinness/diagnosis
6.
Sci Rep ; 10(1): 9530, 2020 06 12.
Article in English | MEDLINE | ID: mdl-32533013

ABSTRACT

Oral Mucositis (OM) is a common adverse effect of head and neck squamous cell carcinoma (HNSCC) treatment. The purpose of this study was to investigate the significance of early changes in tissue electrical parameters (TEPs) in predicting the development of OM in HNSCC patients receiving radiation therapy (RT). The current study combined two study designs. The first was a case-control study. The control group comprised of RT patients who did not receive head and neck RT, and patients with HNSCC who received RT comprised the case group. In the second part of the study, the case group was included in a parallel cohort. A total of 320 patients were assessed for eligibility, and 135 patients were enrolled. Double blinding was performed, and neither the patients nor the care providers knew the measured parameters. The primary outcome was the detection of between-group changes in local TEPs over the follow-up period. The secondary outcome was the appearance of OM grades II, III, or IV and the predictive value of local TEPs in determining the incidence of OM after RT. The variables, impedance module, resistance, reactance, phase angle, and capacitance, were analyzed by the receiver operator curves (ROC). The case and control groups did not differ in demographic and clinical characteristics. Radiation therapy increased the local impedance module, resistance, reactance, and phase angle and reduced the local tissue capacitance in both groups. Evaluation of TEPs in the first week of RT correlated with the development of OM lesions during cancer therapy. ROC analysis showed that local impedance module and resistance presented higher specificity than did other parameters in predicting OM. In conclusion, local tissue electrical parameters measured at the first RT week can be useful tools to predict oral mucositis.


Subject(s)
Electrophysiological Phenomena/radiation effects , Squamous Cell Carcinoma of Head and Neck/radiotherapy , Stomatitis/diagnosis , Stomatitis/etiology , Adult , Aged , Aged, 80 and over , Female , Humans , Male , Middle Aged , Sensitivity and Specificity , Squamous Cell Carcinoma of Head and Neck/pathology , Squamous Cell Carcinoma of Head and Neck/physiopathology
7.
Exp Gerontol ; 134: 110881, 2020 Feb 19.
Article in English | MEDLINE | ID: mdl-32084535

ABSTRACT

INTRODUCTION: Gallic acid (GA) is a natural endogenous polyphenol found in a variety of fruits, vegetables and wines, with beneficial effects on the energetic homeostasis. AIM: The present study aimed to investigate oral gallic acid effects on liver steatosis and hepatic lipogenesis markers in obese mice evaluating new possible molecular related mechanisms. METHODS: Twenty-four Swiss male mice were divided into four groups and fed for 60 days with standard diet (ST), standard diet plus gallic acid (ST + GA), high-fat diet (HFD), and high-fat diet plus gallic acid (HFD + GA). We evaluated the relationship between body weight, food intake and serum levels of total cholesterol, triglycerides, insulin, aspartate and alanine transaminases. Liver histology was analyzed by hematoxylin and eosin staining. These results were accompanied by bioinformatics analyses. The acetyl-CoA carboxylase (ACC), sterol regulatory element binding protein-1 (SREBP-1) and fatty acid synthase (FAS) expression was assessed by quantitative real-time reverse transcriptase PCR (qRT-PCR). RESULTS: The main findings of the present study showed that GA reduced liver steatosis, body weight and plasma insulin levels. Analyzes of hepatic steatosis related genes expression showed that ACC and FAS mRNA were significantly suppressed in liver of HFD + GA mice. These data was corroborated by bioinformatics analysis. CONCLUSION: These data suggest an important clinical application of GA in the prevention and treatment of liver diseases.

8.
Tumour Biol ; 36(12): 9259-65, 2015 Dec.
Article in English | MEDLINE | ID: mdl-26099726

ABSTRACT

It is estimated that 7.6 million people will die as a consequence of head and neck squamous cell carcinoma (HNSCC). Genetic predisposition has emerged as an important risk factor in the development and prognosis of HNSCC. Considering this, the aim of the current study is to assess whether codon 72 SNP of the TP53 gene (rs1042522) is associated with an increased odds ratio of developing HNSCC or with a worse prognosis in patients with HNSCC. Analysis of the rs1042522 in HNSCC patients and in control individuals. Differences between the case and control groups were determined using chi-squared tests. Multivariate analysis was performed to evaluate the odds ratio of HNSCC. Fussy C Means Clustering was to cluster HNSCC patients for survival analyses. Time of survival was calculated using the Kaplan-Meier estimator and comparing this to the log rank test. Statistical significance was set at p < 0.05. A total of 71.4 % of the Arg/Arg genotype were from HNSCC patients, while only 28.6 % of Arg/Arg genotype were found in the control group. Logistic regression demonstrated that the Arg/Arg genotype, smoking, and alcohol consumption increase the odds ratio of HNSCC. No association between TP53 codon 72 polymorphism and P53 expression. No association between rs1042522 and survival or prognoses was observed. This study identified that individuals carrying the arginine allele at rs1042522 have an increased odds ratio of HNSCC. However, no association between codon 72 SNP of the TP53 gene and HNSCC prognosis or P53 expression was observed.


Subject(s)
Carcinoma, Squamous Cell/genetics , Genetic Predisposition to Disease , Head and Neck Neoplasms/genetics , Prognosis , Tumor Suppressor Protein p53/genetics , Adult , Aged , Aged, 80 and over , Carcinoma, Squamous Cell/pathology , Carcinoma, Squamous Cell/radiotherapy , Codon , Female , Gene Expression Regulation, Neoplastic , Gene Frequency , Genetic Association Studies , Genotype , Head and Neck Neoplasms/pathology , Head and Neck Neoplasms/radiotherapy , Humans , Kaplan-Meier Estimate , Male , Middle Aged , Polymorphism, Single Nucleotide/genetics , Risk Factors , Squamous Cell Carcinoma of Head and Neck , Tumor Suppressor Protein p53/biosynthesis
9.
J Endod ; 41(6): 877-83, 2015 Jun.
Article in English | MEDLINE | ID: mdl-25873079

ABSTRACT

INTRODUCTION: Bioinformatics has emerged as an important tool to analyze the large amount of data generated by research in different diseases. In this study, gene expression for radicular cysts (RCs) and periapical granulomas (PGs) was characterized based on a leader gene approach. METHODS: A validated bioinformatics algorithm was applied to identify leader genes for RCs and PGs. Genes related to RCs and PGs were first identified in PubMed, GenBank, GeneAtlas, and GeneCards databases. The Web-available STRING software (The European Molecular Biology Laboratory [EMBL], Heidelberg, Baden-Württemberg, Germany) was used in order to build the interaction map among the identified genes by a significance score named weighted number of links. Based on the weighted number of links, genes were clustered using k-means. The genes in the highest cluster were considered leader genes. Multilayer perceptron neural network analysis was used as a complementary supplement for gene classification. RESULTS: For RCs, the suggested leader genes were TP53 and EP300, whereas PGs were associated with IL2RG, CCL2, CCL4, CCL5, CCR1, CCR3, and CCR5 genes. CONCLUSIONS: Our data revealed different gene expression for RCs and PGs, suggesting that not only the inflammatory nature but also other biological processes might differentiate RCs and PGs.


Subject(s)
Computational Biology/methods , Gene Expression , Neural Networks, Computer , Periapical Granuloma/genetics , Radicular Cyst/genetics , Algorithms , Gene Regulatory Networks , Humans
SELECTION OF CITATIONS
SEARCH DETAIL
...