Prospecting sugarcane resistance to Sugarcane yellow leaf virus by genome-wide association.

KEY MESSAGE: Using GWAS approaches, we detected independent resistant markers in sugarcane towards a vectored virus disease. Based on comparative genomics, several candidate genes potentially involved in virus/aphid/plant interactions were pinpointed. Yellow leaf of sugarcane is an emerging viral disease whose causal agent is a Polerovirus, the Sugarcane yellow leaf virus (SCYLV) transmitted by aphids. To identify quantitative trait loci controlling resistance to yellow leaf which are of direct relevance for breeding, we undertook a genome-wide association study (GWAS) on a sugarcane cultivar panel (n = 189) representative of current breeding germplasm. This panel was fingerprinted with 3,949 polymorphic markers (DArT and AFLP). The panel was phenotyped for SCYLV infection in leaves and stalks in two trials for two crop cycles, under natural disease pressure prevalent in Guadeloupe. Mixed linear models including co-factors representing population structure fixed effects and pairwise kinship random effects provided an efficient control of the risk of inflated type-I error at a genome-wide level. Six independent markers were significantly detected in association with SCYLV resistance phenotype. These markers explained individually between 9 and 14 % of the disease variation of the cultivar panel. Their frequency in the panel was relatively low (8-20 %). Among them, two markers were detected repeatedly across the GWAS exercises based on the different disease resistance parameters. These two markers could be blasted on Sorghum bicolor genome and candidate genes potentially involved in plant-aphid or plant-virus interactions were localized in the vicinity of sorghum homologs of sugarcane markers. Our results illustrate the potential of GWAS approaches to prospect among sugarcane germplasm for accessions likely bearing resistance alleles of significant effect useful in breeding programs.

Epiphytic Populations of Xanthomonas albilineans and Subsequent Sugarcane Stalk Infection Are Linked to Rainfall in Guadeloupe.

Three separate field trials were established in Guadeloupe under different agronomic and rainfall conditions to study phyllosphere contamination and infection of sugarcane plants by Xanthomonas albilineans, the causal agent of sugarcane leaf scald. Disease-free and leaf scald susceptible cv. B69566 was planted and monitored during three 1-year crop cycles. Presence of leaf scald contaminated sugarcane fields in the proximity of the disease-free trials appeared critical in early contamination of the sugarcane phyllosphere. Later on, particular meteorological events, such as tropical storms, were also important in aerial spread of the pathogen. A positive correlation was found between epiphytic populations of X. albilineans and severity of leaf necrotic symptoms, but occurrence of leaf symptoms was not always related to subsequent stalk infection. However, when the data of the three crop seasons were considered together, a high correlation was found between rainfall and maximum epiphytic populations of X. albilineans, and between rainfall and subsequent stalk infections. Consequently, rainfall is a key factor to be considered in evaluation of risks of leaf scald epidemics, and protocols for propagation of healthy sugarcane material and screening methods for leaf scald resistance may have to be revised in humid tropical locations.

High Variation in Pathogenicity of Genetically Closely Related Strains of Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen, in Guadeloupe.

ABSTRACT Pathogenicity of 75 strains of Xanthomonas albilineans from Guadeloupe was assessed by inoculation of sugarcane cv. B69566, which is susceptible to leaf scald, and 19 of the strains were selected as representative of the variation in pathogenicity observed based on stalk colonization. In vitro production of albicidin varied among these 19 strains, but the restriction fragment length polymorphism pattern of their albicidin biosynthesis genes was identical. Similarly, no genomic variation was found among strains by pulsed-field gel electrophoresis. Some variation among strains was found by amplified fragment length polymorphism, but no relationship between this genetic variation and variation in pathogenicity was found. Only 3 (pilB, rpfA, and xpsE) of 40 genes involved in pathogenicity of bacterial species closely related to X. albilineans could be amplified by polymerase chain reaction from total genomic DNA of all nine strains tested of X. albilineans differing in pathogenicity in Guadeloupe. Nucleotide sequences of these genes were 100% identical among strains, and a phylogenetic study with these genes and housekeeping genes efp and ihfA suggested that X. albilineans is on an evolutionary road between the X. campestris group and Xylella fastidiosa, another vascular plant pathogen. Sequencing of the complete genome of Xanthomonas albilineans could be the next step in deciphering molecular mechanisms involved in pathogenicity of X. albilineans.

Variation in Albicidin Biosynthesis Genes and in Pathogenicity of Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen.

ABSTRACT Total genomic DNA from 137 strains of Xanthomonas albilineans from worldwide locations was hybridized with two DNA probes that together harbor the entire 49-kb albicidin biosynthesis gene cluster and two additional 3-kb genomic regions required for albicidin production. Fourteen haplotypes and two major genetic groups (albicidin [ALB]-restriction fragment length polymorphism [RFLP] A and ALB-RFLP B) were identified, and strains that were isolated after recent outbreaks of leaf scald disease belonged to group ALB-RFLP B. Albicidin genetic diversity was very similar to the previously described genetic diversity of the pathogen based on the whole genome. No relationship was found between variability of albicidin biosynthesis genes and the amount of albicidin produced in vitro by X. albilineans. Leaf scald-susceptible sugarcane cv. H70-144 was inoculated with 20 strains of the pathogen belonging to different ALB-RFLP haplotypes. Among them, 10 strains from Guadeloupe belonged to the same ALB-RFLP group but differed in the amount of albicidin produced in vitro. Strains were distributed in at least three different pathogenicity groups based on symptom severity and pathogen population density in the stalk. These two pathogenicity factors varied concurrently; however, no relationship between variation in albicidin biosynthesis genes, variation in the amount of albicidin produced in vitro, and variation in pathogenicity of X. albilineans was found. Further investigation is necessary to identify other genes involved in pathogenicity of X. albilineans.

First Report of Leifsonia xyli subsp. xyli, Causal Agent of Ratoon Stunting of Sugarcane, in Jamaica.

To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.

Protoporphyrinogen oxidase inhibitor herbicide effects on pythium root rot of sugarcane, pythium species, and the soil microbial community.

ABSTRACT The effects of three protoporphyrinogen oxidase inhibitor herbicides, azafenidin, flumioxazin, and sulfentrazone, on Pythium root rot of sugarcane and the soil microbial community were evaluated in greenhouse experiments. Herbicides were applied as foliar and soil treatments. There were no consistent effects on plant growth or disease parameters. However, some herbicide treatments affected the relative frequency of isolation of Pythium spp. from roots and reduced colonization by the pathogenic species Pythium arrhenomanes. A comparison of sole carbon source utilization profiles indicated that soil-applied herbicides altered the functional diversity of the soil microbial community, with some variation depending on herbicide used. All three herbicides inhibited the in vitro mycelial growth of P. arrhenomanes, P. aphanidermatum, and P. ultimum. Active ingredients were less inhibitory than formulated product for azafenidin and flumioxazin but not for sulfentrazone.

First Report of Sugarcane Yellow Leaf Virus in the French West Indies.

Unusually severe leaf yellowing symptoms, similar to those described for yellow leaf syndrome (1), have been observed in several sugarcane clones in Guadeloupe since 1994, and since 1997 in Martinique. Leaf samples exhibiting various types of yellowing were taken from five different sugarcane clones, and analyzed by immunosorbent electron microscopy. Spherical particles, 24 to 28 nm in diameter and characteristic of luteoviruses, were found in two of five samples. The two infected samples showed yellowing on the underside of the midrib and one had a pinkish coloration on the upper side. The presence of sugarcane yellow leaf virus (ScYLV), the causal agent of sugarcane yellow leaf disease, was confirmed by reverse transcription-polymerase chain reaction (2) in these two samples and in 36 of 184 sugarcane clones bred in Guadeloupe and sent to Cirad's quarantine station in Montpellier, France. Following these observations, surveys were undertaken with a tissue blot enzyme immunoassay to analyze the distribution of ScYLV in sugarcane clones in the French West Indies. The midrib base of the first visible dewlap leaf was used to detect the presence of the virus in the phloem. In a first survey, clones of various origins worldwide were taken from germplasm collections. Two to three leaf samples per clone were analyzed from 78 clones in a collection in Guadeloupe and from 36 in a collection in Mar-tinique. Fifty of the 114 clones were infected by ScYLV, and ScYLV was detected in 21 of the 32 clones exhibiting severe leaf yellowing (score 3 or higher on a 1 to 5 scale). In a second survey, 19 leaf samples were taken from each of 53 clones from plants produced by Cirad's breeding program in Guadeloupe. The virus was detected in at least one sample for 25 of these 53 clones. ScYLV incidence in commercial fields was tested in Martinique in the variety B5992, which constitutes 57% of the cultivated area. Twenty leaves from different stools were sampled in six different fields, five of which had ScYLV-infected plants. The percentage of virus-infected stalks ranged from 0 to 90% whereas the percentage of stalks showing symptoms ranged from 50 to 100%. ScYLV appears widespread in the French West Indies, perhaps because a vector (Melanaphis sacchari) exists in Martinique and Guadeloupe. However, ScYLV was not found in all symptomatic plants, indicating that even if this luteovirus is a causal agent of leaf yellowing in the French West Indies, there may be other causal agents as well. References: (1) J. C. Comstock et al. Sugar J. 3:33, 1994. (2) J. C. Comstock et al. Sugar Cane 4:21, 1998.

A putative major gene for rust resistance linked with a RFLP marker in sugarcane cultivar 'R570'.

Inheritance of resistance to rust was investigated in the self progeny of the sugarcane cultivar 'R570' also used to build a RFLP genetic map. Resistance was evaluated through both field and controlled greenhouse trials. A clear-cut 3 (resistant) ∶ 1 (susceptible) segregation indicative of a probable dominant resistant gene was observed. This is the first documented report of a monogenic inheritance for disease resistance in sugarcane. This gene was found linked at 10 cM with an RFLP marker revealed by probe CDSR29. Other minor factors involved in the resistance were also detected.

Purification and characterization of two basic beta-1,3-glucanases induced in Colletotrichum lindemuthianum-infected bean seedlings.

Two beta-1,3-glucanases which are rapidly induced in the incompatible interaction between bean (cv. Processor) and Colletotrichum lindemuthianum race beta were purified to homogeneity. Characterization of the two enzymes, GE1 and GE2, showed that they both had a basic isolectric point and a similar molecular weight (36,500 for GE1 and 36,000 for GE2), but differed in their pH optimum, thermal stability, and specific activity. GE2 was present in higher amounts but was shown to be less active than GE1 against laminarin and fungal cell walls isolated from race beta of the fungus. Both enzymes were specific for beta-1,3 linkages and showed a strict endolytic mode of action. Further characterization of GE2 was achieved by amino acid sequence analysis of tryptic peptides; the degree of homology shared with other basic beta-1,3-glucanases depended on the plant source. A time-course study showed that GE1 and GE2 were increased during infection. They were also induced by fungal elicitors, thereby indicating that they originate from the host.