Enzymatic treatment of specimens before DNA extraction directly influences molecular detection of infectious agents.

INTRODUCTION: Biological samples, pharmaceuticals or food contain proteins, lipids, polymers, ammoniums and macromolecules that alter the detection of infectious agents by DNA amplification techniques (PCR). Moreover the targeted DNA has to be released from the complex cell walls and the compact nucleoprotein matrixes and cleared from potential inhibitors. The goal of the present work was to assess the efficiency of enzymatic pretreatments on infectious agents to make DNA available for further extraction and amplification. METHODS: Staphylococcus epidermidis, Streptococcus mitis, Propionibacterium acnes, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, Aspergillus niger and Fusarium solani were mixed with an internal control virus and treated with: 1) proteinase K; 2) lyticase and 3) lyticase followed by proteinase K. DNAs was manually extracted using the QIAmp DNA Mini kit or the MagNA Pure Compact automate. DNA extraction yields and the inhibitors were assessed with a phocid Herpesvirus. Bacterial detection was performed using TaqMan real-time PCR and yeasts and filamentous Fungi with HRM (real-time PCR followed by high-resolution melting analysis). RESULTS: Viral DNA was released, extracted and detected using manual and automatic methods without pre enzymatic treatments. Either the manual or the automatic DNA extraction systems did not meet the sensitivity expectations if enzymatic treatments were not performed before: lyticase for Fungi and Proteinase K for Bacteria. The addition of lyticase and proteinase K did not improve results. For Fungi the detection after lyticase was higher than for Proteinase K, for which melting analysis did not allow fungal specification. DISCUSSION: Columns and magnetic beads allowed collecting DNA and separate PCR inhibitors. Detection rates cannot be related to DNA-avidity of beads or to elution but to the lack of proteolysis.

Findings in detection of Herpesviridae by polymerase chain reaction and intraocular antibody production in a case series of anterior uveitis.

PURPOSE: To target the use of two biologic tests in the diagnostic of viral Herpesviridae anterior uveitis (AC) by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humor samples were collected from 42 patients suspected of having AU of infectious origin at presentation. The diagnosis of infectious uveitis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and/or detection of Herpesviridae genomes with PCR. The data were compared with data of 16 uveitis control samples used to calculate the specificity of the tests. RESULTS: Sixteen out of 42 eyes (38%) had a final diagnosis of anterior segment infectious uveitis of viral origin (Herpesviridae) confirmed by PCR positive result (5/14 eyes; 14 of the 16 eyes were tested by PCR) and/or specific intraocular antibody synthesis (14/16 eyes). CONCLUSIONS: While the GWC is progressively less often performed, these findings suggest that it still has a role in AU suspected of herpesvirus etiology.

Rapid detection and simultaneous molecular profile characterization of Acanthamoeba infections.

Diagnosis of Acanthamoeba by microscopic examination, culture, and polymerase chain reactions (PCRs) has several limitations (sensitivity, specificity, lack of detection of several strains, cost of testing for discrimination among strains). We developed a new high-resolution melting real-time PCR (HRM) to detect and characterize Acanthamoeba infections. HRM performances were evaluated with strains from the American Type Culture Collection (ATCC) and with 20 corneal scrapings. The DNA extracted from specimens were amplified, detected, and characterized in 1 run using 2 original primers diluted in a solution containing an intercalating dye. Detection and molecular characterization of Acanthamoeba infections could be achieved in less than 2.5 h with a dramatic reduction in cost of reactants (postamplification procedures and radioactive or fluorescent-labeled molecular probes were unnecessary). HRM detection limits were 0.1 cyst/µL or less (including genotypes T5 and T11), and its sensitivity and specificity were higher than other molecular tests. For the tested strains from the ATCC, the HRM drafted 4 different profiles: Type I (genotypes T2 and T4), Type II (T5 and T7), Type III (T8), and Type IV (T1, T3, T6, T9, T11, T12, and T13).

New strategy for rapid diagnosis and characterization of fungal infections: the example of corneal scrapings.

PURPOSE: The prognosis of people infected with Fungi especially immunocompromised depends on rapid and accurate diagnosis to capitalize on time administration of specific treatments. However, cultures produce false negative results and nucleic-acid amplification techniques require complex post-amplification procedures to differentiate relevant fungal types. The objective of this work was to develop a new diagnostic strategy based on real-time polymerase-chain reaction high-resolution melting analysis (PCR-HRM) that a) detects yeasts and filamentous Fungi, b) differentiates yeasts from filamentous Fungi, and c) discriminates among relevant species of yeasts. METHODS: PCR-HRM detection limits and specificity were assessed with a) isolated strains; b) human blood samples experimentally infected with Fungi; c) blood experimentally infected with other infectious agents; d) corneal scrapings from patients with suspected fungal keratitis (culture positive and negative) and e) scrapings from patients with suspected bacterial, viral or Acanthamoeba infections. The DNAs were extracted and mixed with primers diluted in the MeltDoctor® HRM Master Mix in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn (5'TCCTCCGCTT ATTGATATGCT) and the second for filamentous Fungi, containing the forward primer FilamUn (5'TGCCTGTCCGAGCGTCAT) and FungUn. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were systematically monitored. RESULTS: PCR-HRM detected 0.1 Colony Forming Units (CFU)/µl of yeasts and filamentous Fungi, differentiated filamentous Fungi from yeasts and discriminated among relevant species of yeasts. PCR-HRM performances were higher than haemoculture and sensitivity and specificity was 100% for culture positive samples, detecting and characterizing Fungi in 7 out 10 culture negative suspected fungal keratitis. CONCLUSIONS: PCR-HRM appears as a new, sensitive, specific and inexpensive test that detects Fungi and differentiates filamentous Fungi from yeasts. It allows direct fungal detection from clinical samples and experimentally infected blood in less than 2.30 h after DNA extraction.

New strategy for rapid diagnosis and characterization of keratomycosis.

PURPOSE: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. DESIGN: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. PARTICIPANTS AND CONTROLS: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. METHODS: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. MAIN OUTCOME MEASURES: Detection of fungi in corneal samples by HRM. RESULTS: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. CONCLUSIONS: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.

Real-time polymerase chain reaction and intraocular antibody production for the diagnosis of viral versus toxoplasmic infectious posterior uveitis.

PURPOSE: The aim of this work was to determine the diagnostic performance of real-time polymerase chain reaction (RT-PCR) and to assess intraocular specific antibody secretion (Goldmann-Witmer coefficient) on samples from patients with signs of posterior uveitis presumably of infectious origin and to target the use of these two biologic tests in the diagnostic of Toxoplasma/viral Herpesviridae posterior uveitis by the consideration of clinical behavior and delay of intraocular sampling. METHODS: Aqueous humour and/or vitreous fluid were collected from patients suspected of having posterior uveitis of infectious origin at presentation (140 samples). The diagnosis was confirmed by quantification of antibodies with the Goldmann-Witmer coefficient (GWC) and for detection of Herpesviridae and Toxoplasma gondii genomes with RT-PCR. Forty-one patients had final diagnosis of uveitis of non-Toxoplasma/non-viral origin and 35 among them constituted the control group. The main outcome measures were sensitivity, specificity, and positive and negative predictive values (PPV and NPV). RESULTS: When pre-intraocular testing indication was compared with final diagnosis, GWC was a more sensitive and specific method than RT-PCR, and was successful in detecting T. gondii, especially if the patient is immunocompetent and the testing is carried out later in the disease course, up to 15 months. For viral Herpesviridae uveitis, the sensitivity and PPV of PCR evaluation was higher than detected with GWC with respectively 46% compared with 20% for sensitivity and 85% versus 60% for PPV. In either viral retinitis or toxoplasmosis infection, RT-PCR results were positive from 24 h, although GWC was not significant until 1 week after the onset of signs. In toxoplasmosis patients, positive RT-PCR results were statistically correlated with the chorioretinitis area (more than three disc areas; p = 0.002), with the age older than 50 (p = 0.0034) and with a clinical anterior inflammation (Tyndall ≥1/2+) and panuveitis; (p = 0.0001). CONCLUSIONS: For the diagnosis of viral or toxoplasmosis-associated intraocular inflammation, the usefulness of laboratory diagnosis tools (RT-PCR and GWC) depends on parameters other than the sensitivity of the tests. Certain patient characteristics such as the age of the patients, immune status, duration since the onset of symptoms, retinitis area, predominant site and extent of inflammation within the eye should orientate the rational for the choice of laboratory testing in analysis of intraocular fluids.

In vivo confocal microscopy in fungal keratitis.

BACKGROUND: Fungal keratitis is a major blinding eye disease found throughout the world, particularly in developing countries. Given the recent increase in Fusarium keratitis infections in contact lens wearers owing to contact lens solutions, a warning was recently issued by the Food and Drug Administration, making it a public health concern in developed countries. OBJECTIVE: To show the advantages of in vivo confocal microscopy imaging using the Heidelberg Retina Tomograph II-Rostock Cornea Module (HRTII-RCM) in the early diagnosis of fungal keratitis. METHODS: HRTII-RCM confocal microscopy was performed on five patients presenting with fungal keratitis and on three donor corneas contaminated with Fusarium solani, Aspergillus fumigatus and Candida albicans. RESULTS: Direct microscopic evaluation of corneal smears and culture revealed the presence of F solani in four cases and C albicans in one case. HRTII-RCM examination of the infected patients and contaminated donor corneas revealed numerous high-contrast elements resembling Fusarium, Aspergillus hyphae or Candida pseudofilaments in the anterior stroma. CONCLUSION: HRTII-RCM in vivo confocal microscopy is a new, non-invasive and rapid technique for the early diagnosis of fungal keratitis, showing high-resolution images resembling fungal structures in the early phase of the disease.