Identification of O-Methyltransferases Potentially Contributing to the Structural Diversity of 2-(2-Phenylethyl)chromones in Agarwood.

2-(2-Phenylethyl)chromones (PECs) are the primary constituents responsible for the promising pharmacological activities and unique fragrance of agarwood. However, the O-methyltransferases (OMTs) involved in the formation of diverse methylated PECs have not been reported. In this study, we identified one Mg2+-dependent caffeoyl-CoA-OMT subfamily enzyme (AsOMT1) and three caffeic acid-OMT subfamily enzymes (AsOMT2-4) from NaCl-treated Aquilaria sinensis calli. AsOMT1 not only converts caffeoyl-CoA to feruloyl-CoA but also performs nonregioselective methylation at either the 6-OH or 7-OH position of 6,7-dihydroxy-PEC. On the other hand, AsOMT2-4 preferentially utilizes PECs as substrates to produce structurally diverse methylated PECs. Additionally, AsOMT2-4 also accepts nonPEC-type substrates such as caffeic acid and apigenin to generate methylated products. Protein structure prediction and site-directed mutagenesis revealed that residues of L313 and I318 in AsOMT3, as well as S292 and F313 in AsOMT4 determine the distinct regioselectivity of these two OMTs toward apigenin. These findings provide important biochemical evidence of the remarkable structural diversity of PECs in agarwood.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

The association of depressive symptoms with adverse clinical outcomes in hypertension: Data from SPRINT randomized trail.

OBJECTIVE: This study intends to explore the effect of depressive symptoms on adverse clinical outcomes in middle-aged and elderly hypertensive patients. METHODS: This post hoc analysis was conducted using data from the Systolic Blood Pressure Intervention Trial (SPRINT), and we used cox proportional risk regression to examine the relationship between depressive symptoms and adverse clinical outcomes (primary outcome, all-cause mortality, cardiovascular disease(CVD) mortality, heart failure(HF), myocardial infarction(MI), non-myocardial infarction acute coronary syndrome(non-MI ACS)). RESULTS: In a follow-up study of 9259 participants, we found that depression symptoms was significantly and positively associated with the primary outcome (HR 1.03, 95%CI 1.01-1.05; p for trend = 0.0038), all-cause mortality (HR 1.03, 95%CI 1.01-1.05; p for trend = 0.0308), HF(HR 1.05, 95%CI 1.01-1.08; p for trend = 0.0107), and non-MI ACS(HR 1.06, 95%CI 1.01-1.10; p for trend = 0.0120). Kaplan-Meier survival curves for depression symptoms severity (none, mild, moderate, and above) and adverse clinical outcomes suggested that for all but primary clinical outcomes, the cumulative risk of adverse clinical outcomes increased with increasing depression symptoms severity. CONCLUSION: For middle-aged and elderly hypertensive patients, depression symptoms exacerbates the risk of adverse clinical outcomes (primary outcome, all-cause mortality, CVD death, MI, HF, and non-MI ACS), and the risk increases with the severity of depression symptoms.

The MuSK agonist antibody protects the neuromuscular junction and extends the lifespan in C9orf72-ALS mice.

The disassembly of the neuromuscular junction (NMJ) is an early event in amyotrophic lateral sclerosis (ALS), ultimately leading to motor dysfunction and lethal respiratory paralysis. The hexanucleotide GGGGCC repeat expansion in the C9orf72 gene is the most common genetic mutation, and the dipeptide repeat (DPR) proteins have been shown to cause neurodegeneration. While no drugs can treat ALS patients efficiently, new treatment strategies are urgently needed. Here, we report that a MuSK agonist antibody alleviates poly-PR-induced NMJ deficits in C9orf72-ALS mice. The HB9-PRF/F mice, which express poly-PR proteins in motor neurons, exhibited impaired motor behavior and NMJ deficits. Mechanistically, poly-PR proteins interacted with Agrin to disrupt the interaction between Agrin and Lrp4, leading to attenuated activation of MuSK. Treatment with a MuSK agonist antibody rescued NMJ deficits, and extended the lifespan of C9orf72-ALS mice. Moreover, impaired NMJ transmission was observed in C9orf72-ALS patients. These findings identify the mechanism by which poly-PR proteins attenuate MuSK activation and NMJ transmission, highlighting the potential of promoting MuSK activation with an agonist antibody as a therapeutic strategy to protect NMJ function and prolong the lifespan of ALS patients.

Photothermal Modulation of Gingival Fibroblasts via Polydopamine-Coated Zirconia: A Novel Approach for Promoting Peri-Implant Soft Tissue Integration.

Achieving robust soft tissue integration around dental implants is crucial for long-term clinical success, as it forms a protective biological seal against bacterial invasion. However, the soft tissue attachment to implants is relatively deficient compared to natural teeth, particularly in the connective tissue region lacking sufficient gingival fibroblasts and perpendicular collagen fiber alignment. This study proposes an innovative strategy to enhance peri-implant soft tissue integration by modulating gingival fibroblast behavior via photothermal conversion. Zirconia surfaces were coated with polydopamine (PDA), a melanin-like polymer exhibiting near-infrared (NIR) absorption for photothermal conversion. Under NIR irradiation, the PDA coating enabled mild hyperthermia (42-43°C) on the zirconia surface through its photothermal effect. Remarkably, this mild photothermal stimulation significantly promoted human gingival fibroblast proliferation, adhesion, and collagen expression compared to unmodified zirconia in vitro. The upregulated collagen production was confirmed at both gene transcription and protein levels. By harnessing the photothermal properties of PDA coatings to modulate cellular behaviors beneficial for connective tissue formation, this pioneering approach provides a promising avenue to achieve improved soft tissue integration and long-term stability of dental implants. The findings highlight the innovative potential of combining biomaterial surface engineering with photothermal therapy concepts for applications in regenerative dentistry.

PI3K inhibitor idelalisib enhances the anti-tumor effects of CDK4/6 inhibitor palbociclib via PLK1 in B-cell lymphoma.

Relapsed or refractory diffuse large B cell lymphoma (DLBCL) and mantle cell lymphoma (MCL) patients still faced with poor survival, representing an unmet clinical need. In-depth research into the disease's pathogenesis and the development of targeted treatment strategies are urgently needed. Here, we conducted a comprehensive bioinformatic analysis of gene mutation and expression using data from our center and public databases. Cell cycle-related genes especially for CDKN2A/B-CDK4/6/CCND1 machinery altered frequently in DLBCL and MCL. Clinically, high CDK4 and CDK6 expression were correlated with poor prognosis of DLBCL and MCL patients. Furthermore, we also validated the pharmacological efficacy of CDK4/6 inhibitor palbociclib and its synergy effect with PI3K inhibitor idelalisib utilizing in vitro cell lines and in vivo cell-derived xenograft (CDX) and patient-derived xenograft (PDX) mouse models. Our results provided sufficient pre-clinical evidence to support the potential combination of palbociclib and idelalisib for DLBCL and MCL patients.

Municipal pipeline networks as preferential vapor intrusion pathways: A review.

Recent reports show a rise in instances where municipal networks, such as sewer lines, serve as pathways for vapor intrusion (VI), enabling volatile organic compounds (VOCs) vapors to travel along these networks. These VOCs pose potential health risks to occupants of buildings connected to these networks. Currently, there's a lack of specific technical or regulatory guidance on identifying and assessing the VI risk associated with sewer as preferential VI pathways. This critical review summarizes key findings from studies and site investigations related to sewer VI pathways. These findings cover background VOCs concentration levels in sewers, updates to site conceptual models, advances in sewer sampling techniques, innovative tools for identifying and characterizing sewer VI, and practices for assessing and mitigating sewer VI risk. While significant improvements have been made towards understanding how municipal pipeline networks act as VI pathways, more research is still needed to develop strategies for investigating sites and assessing risks associated with "pipeline VI pathways". Future research could focus on the development of "pipeline VI pathways" data set, the improvement and validation of investigation tools, and improving the understanding of VOCs transportation mechanisms within these "pipeline VI pathways".

Improvement of Performance of CZTSSe Solar Cells by the Synergistic Effect of Back Contact Modification and Ag Doping.

To improve the performance of Cu2ZnSn(S,Se)4 solar cells, a strategy is proposed to improve the quality of absorber and back interface simultaneously by substituting V-doped Mo (Mo:V) for a conventional Mo back electrode and incorporating Ag into the Cu2ZnSn(S,Se)4 (ACZTSSe) absorber in this work. Since p+-type V-doped MoSe2 (MoSe2:V) is formed in the site between the absorber and Mo:V during selenization, the conventional Mo/n-MoSe2 back contact is modified to Mo:V/p+-MoSe2:V, a back surface passivation field (BSPF) is established at the back interface, the band bending of MoSe2:V is downward and that of bottom of the absorber is upward. Further investigation reveals that the back contact modification and Ag doping have a synergistic effect on inhibiting carrier recombination, decreasing series resistance and increasing shunt resistance, thereby leading to the PCE of device without antireflection coating increased from 8.61 to 10.98%, which is larger than the sum of increase in PCE induced by Ag doping alone (8.61 to 9.66%) and back contact modification alone (8.61 to 9.63%). It is demonstrated that the synergistic effect stems mainly from the strengthened BSPF and the further reduced back contact barrier height. The former is due to the increased difference in work function (WF) between MoSe2:V and absorber induced by the reduced WF of the absorber after Ag doping and the raised WF of MoSe2:V after V doping. The latter is due to the downshifted valence band maximum of absorber after Ag doping. This work highlights the synergistic effect of back contact modification and Ag doping on improving the performance of CZTSSe solar cells and also provides an effective way to suppress carrier recombination.

Understanding the Interface Enhancement Mechanisms of CFRP with the Polydopamine-Polyetheramine Interphase at the Molecular Level.

In this work, polydopamine (PDA) and polyetheramine D230 were selected to construct the PDA-D230 interphase between the carbon fiber (CF) and epoxy matrix. Density functional theory (DFT) and molecular dynamics (MD) simulations were performed to explore the interface enhancement mechanisms of a carbon fiber reinforced polymer (CFRP) with the PDA-D230 interphase from the molecular level. The adsorption characteristics of a PDA molecule on the CF surface were investigated using the DFT method. The results show that stronger π-π stacking interactions are formed due to the structure and orientation preference of the PDA molecule. The interfacial structures and properties of CFRP with the PDA-D230 interphase are derived from MD simulations. The PDA-D230 interphase on the CF surface induces stronger interfacial interaction energy, leading to the better load transfer between the CF and epoxy matrix. The existence of the PDA-D230 interphase on the CF surface can decrease the mean-square displacement (MSD) value and the free volume fraction of CFRP, which restricts the movement of epoxy atoms and inhibits the translational and rotational motion of epoxy chains. Compared with the epoxy using pristine CFs as reinforcement, the interfacial shear stress (ISS) of CFRP with the PDA-D230 interphase is improved by 13.1%. Our results provide valuable insights into the interface characteristics of CFRP with the PDA-D230 interphase, which are of great significance for exploring the strengthening mechanisms for CFRPs with the PDA-D230 interphase.

A conserved Pol II elongator SPT6L mediates Pol V transcription to regulate RNA-directed DNA methylation in Arabidopsis.

In plants, the plant-specific RNA polymerase V (Pol V) transcripts non-coding RNAs and provides a docking platform for the association of accessory proteins in the RNA-directed DNA methylation (RdDM) pathway. Various components have been uncovered that are involved in the process of DNA methylation, but it is still not clear how the transcription of Pol V is regulated. Here, we report that the conserved RNA polymerase II (Pol II) elongator, SPT6L, binds to thousands of intergenic regions in a Pol II-independent manner. The intergenic enrichment of SPT6L, interestingly, co-occupies with the largest subunit of Pol V (NRPE1) and mutation of SPT6L leads to the reduction of DNA methylation but not Pol V enrichment. Furthermore, the association of SPT6L at Pol V loci is dependent on the Pol V associated factor, SPT5L, rather than the presence of Pol V, and the interaction between SPT6L and NRPE1 is compromised in spt5l. Finally, Pol V RIP-seq reveals that SPT6L is required to maintain the amount and length of Pol V transcripts. Our findings thus uncover the critical role of a Pol II conserved elongator in Pol V mediated DNA methylation and transcription, and shed light on the mutual regulation between Pol V and II in plants.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

In vivo study of chelating agent-modified nano zero-valent iron: Biodistribution and toxicity in mice.

In this study, the distribution and toxicity of nanoscale zero valent iron (nZVI) and nZVIs coated with citric acid and sodium tripolyphosphate (CA-nZVI and STPP-nZVI) in mice were investigated. nZVIs were primarily found in the livers and spleens, followed by the lungs, hearts, and kidneys. Histologic analysis revealed no significant histopathologic abnormalities or lesions in all organs except the liver at 14th d gavage. nZVIs did not have a noticeable impact on the body weight of the mice or the weight of their organs. Compared with the control group, there were no significant changes in hematology indexes in the nZVIs groups. However, the nZVIs groups exhibited varying levels of elevation in alanine aminotransferase, aspartate aminotransferase, and creatinine, suggesting liver and kidney inflammation in mice. The up-regulation of Nuclear Factor erythroid 2-Related Factor 2 and Heme oxygenase 1 in the nZVIs groups may be a response to nZVIs-induced oxidative stress. Immunohistochemical analysis confirmed the inflammatory response induced by the three nZVI groups. Chelating agents did not have a significant impact on the distribution or toxicity of nZVIs in mice. This study contributes to a comprehensive and detailed insight into nZVI toxicity in the environmental field.

The synthesis and preliminary immunological evaluation of a dual-adjuvant SARS-CoV-2 RBD vaccine: Covalent integration of TLR7/8 and iNKT cell agonists.

Covalently linking an adjuvant to an antigenic protein enhances its immunogenicity by ensuring a synergistic delivery to the immune system, fostering a more robust and targeted immune response. Most adjuvant-protein conjugate vaccines incorporate only one adjuvant due to the difficulties in its synthesis. However, there is a growing interest in developing vaccines with multiple adjuvants designed to elicit a more robust and targeted immune response by engaging different aspects of the immune system for complex diseases where traditional vaccines fall short. Here, we pioneer the synthesis of a dual-adjuvants protein conjugate Vaccine 1 by assembling a toll-like receptor 7/8 (TLR7/8) agonist, an invariant natural killer T cell (iNKT) agonist with a clickable bicyclononyne (BCN). The BCN group can bio-orthogonally react with azide-modified severe acute respiratory syndrome coronavirus-2 receptor-binding domain (SARS-CoV-2 RBD) trimer antigen to give the three-component Vaccine 1. Notably, with a mere 3 µg antigen, it elicited a balanced subclass of IgG titers and 20-fold more IgG2a than control vaccines, highlighting its potential for enhancing antibody-dependent cellular cytotoxicity. This strategy provides a practicable way to synthesize covalently linked dual immunostimulants. It expands the fully synthetic self-adjuvant protein vaccine that uses a single adjuvant to include two different types of adjuvants.

Design, synthesis and evaluation of novel prostate-specific membrane antigen-targeted aryl [18F]fluorosulfate PET tracers.

The expression of prostate-specific membrane antigen (PSMA) in prostate cancer is 100-1000 times higher than that in normal tissues, and it has shown great advantages in the diagnosis and treatment of prostate cancer. The combination of PSMA and PET imaging technology based on the principle of metabolic imaging can achieve high sensitivity and high specificity for diagnosis. Due to its suitable half-life (109 min) and good positron abundance (97%), as well as its cyclotron accelerated generation, 18F has the potential to be commercialize, which has attracted much attention. In this article, we synthesized a series of fluorosulfate PET tracers targeting PSMA. All four analogues have shown high affinity to PSMA (IC50 = 1.85-5.15 nM). After the radioisotope exchange labeling, [18F]L9 and [18F]L10 have PSMA specific cellular uptake (0.65 ± 0.04% AD and 1.19 ± 0.03% AD) and effectively accumulated in 22Rv1 xenograft mice model. This study demonstrates that PSMA-1007-based PSMA-targeted aryl [18F]fluorosulfate novel tracers have the potential for PET imaging in tumor tissues.

Serum Lactate Is an Indicator for Short-Term and Long-Term Mortality in Patients with Acute Pancreatitis.

BACKGROUND: Serum lactate, as a single and an easily available biomarker, has been applied in various diseases. AIMS: In this study, we aimed to explore the predictive value of serum lactate for short-term and long-term prognosis in acute pancreatitis (AP) admitted in intensive care unit (ICU) based on a large-scale database. METHODS: AP patients admitted in ICU in the MIMIC-IV database were included. We constructed three different models to investigate the relationships between serum lactate and clinical outcomes, including 30-day, 180-day and 1-year mortality in AP. Smooth fitting curves were performed for intuitively demonstrating the relationship between serum lactate and different outcomes in AP by the generalized additive model. RESULTS: A total of 895 AP patients admitted in ICU were included. The mortalities of 30 days, 180 days, and 1 year were 12.63% (n = 113), 16.87% (n = 151), and 17.54% (n = 157). In model B, with 1-mmol/L increment in serum lactate, the values of OR in 30-day, 180-day and 1-year mortality were 1.20 (95%CI 1.04-1.37, P = 0.0094), 1.21 (95%CI 1.06-1.37, P = 0.0039), and 1.21 (95%CI 1.07-1.38, P = 0.0035). The AUCs of serum lactate for predicting 30-day, 180-day, and 1-year mortality in AP were 0.688 (95%CI 0.633-0.743), 0.655 (95%CI 0.605-0.705), and 0.653 (95%CI 0.603-0.701), respectively. The cut-off value of serum lactate predicting 30-day, 180-day and 1-year mortality in AP was 2.4 mmol/L. CONCLUSION: Serum lactate could be an indicator for short-term and long-term mortality in patients with AP admitted in ICU.

A case report on pheochromocytoma mimicking as fulminant myocarditis-a diagnostic challenge.

We present an exceptional case of a 53-year-old female, initially misdiagnosed with fulminant myocarditis, but later correctly diagnosed with pheochromocytoma. The presentation of the patient included a spectrum of symptoms such as headache, chest discomfort, palpitations, and dyspnea, following the intake of Domperidone. Two weeks prior to admission, the patient had experienced episodes of diarrhea and a low-grade fever. Unresolved symptoms and an unmanageable surge in blood pressure despite comprehensive fulminant myocarditis treatment prompted further investigation. The discovery of an adrenal mass via a CT scan and subsequent biochemical tests led to the confirmation of pheochromocytoma. Implementation of alpha-blockade therapy and a successful laparoscopic adrenalectomy resulted in significant clinical improvement. This case underscores the diagnostic intricacies of pheochromocytoma and highlights the need for vigilance when faced with severe, unresponsive cardiovascular symptoms.

Drug repurposing-based nanoplatform via modulating autophagy to enhance chemo-phototherapy against colorectal cancer.

Multi-modal combination therapy is regarded as a promising approach to cancer treatment. Combining chemotherapy and phototherapy is an essential multi-modal combination therapy endeavor. Ivermectin (IVM) is a potent antiparasitic agent identified as having potential antitumor properties. However, the fact that it induces protective autophagy while killing tumor cells poses a challenge to its further application. IR780 iodide (IR780) is a near-infrared (NIR) dye with outstanding photothermal therapy (PTT) and photodynamic therapy (PDT) effects. However, the hydrophobicity, instability, and low tumor uptake of IR780 limit its clinical applications. Here, we have structurally modified IR780 with hydroxychloroquine, an autophagy inhibitor, to synthesize a novel compound H780. H780 and IVM can form H780-IVM nanoparticles (H-I NPs) via self-assembly. Using hyaluronic acid (HA) to modify the H-I NPs, a novel nano-delivery system HA/H780-IVM nanoparticles (HA/H-I NPs) was synthesized for chemotherapy-phototherapy of colorectal cancer (CRC). Under NIR laser irradiation, HA/H-I NPs effectively overcame the limitations of IR780 and IVM and exhibited potent cytotoxicity. In vitro and in vivo experiment results showed that HA/H-I NPs exhibited excellent anti-CRC effects. Therefore, our study provides a novel strategy for CRC treatment that could enhance chemo-phototherapy by modulating autophagy.

Construction of an Escherichia coli chassis for efficient biosynthesis of human-like N-linked glycoproteins.

The production of N-linked glycoproteins in genetically engineered Escherichia coli holds significant potential for reducing costs, streamlining bioprocesses, and enhancing customization. However, the construction of a stable and low-cost microbial cell factory for the efficient production of humanized N-glycosylated recombinant proteins remains a formidable challenge. In this study, we developed a glyco-engineered E. coli chassis to produce N-glycosylated proteins with the human-like glycan Gal-ß-1,4-GlcNAc-ß-1,3-Gal-ß-1,3-GlcNAc-, containing the human glycoform Gal-ß-1,4-GlcNAc-ß-1,3-. Our initial efforts were to replace various loci in the genome of the E. coli XL1-Blue strain with oligosaccharyltransferase PglB and the glycosyltransferases LsgCDEF to construct the E. coli chassis. In addition, we systematically optimized the promoter regions in the genome to regulate transcription levels. Subsequently, utilizing a plasmid carrying the target protein, we have successfully obtained N-glycosylated proteins with 100% tetrasaccharide modification at a yield of approximately 320 mg/L. Furthermore, we constructed the metabolic pathway for sialylation using a plasmid containing a dual-expression cassette of the target protein and CMP-sialic acid synthesis in the tetrasaccharide chassis cell, resulting in a 40% efficiency of terminal α-2,3- sialylation and a production of 65 mg/L of homogeneously sialylated glycoproteins in flasks. Our findings pave the way for further exploration of producing different linkages (α-2,3/α-2,6/α-2,8) of sialylated human-like N-glycoproteins in the periplasm of the plug-and-play E. coli chassis, laying a strong foundation for industrial-scale production.