Identification of the first homozygous 1-bp deletion in GDF9 gene leading to primary ovarian insufficiency by using targeted massively parallel sequencing.

Targeted massively parallel sequencing (TMPS) has been used in genetic diagnosis for Mendelian disorders. In the past few years, the TMPS has identified new and already described genes associated with primary ovarian insufficiency (POI) phenotype. Here, we performed a targeted gene sequencing to find a genetic diagnosis in idiopathic cases of Brazilian POI cohort. A custom SureSelectXT DNA target enrichment panel was designed and the sequencing was performed on Illumina NextSeq sequencer. We identified 1 homozygous 1-bp deletion variant (c.783delC) in the GDF9 gene in 1 patient with POI. The variant was confirmed and segregated using Sanger sequencing. The c.783delC GDF9 variant changed an amino acid creating a premature termination codon (p.Ser262Hisfs*2). This variant was not present in all public databases (ExAC/gnomAD, NHLBI/EVS and 1000Genomes). Moreover, it was absent in 400 alleles from fertile Brazilian women screened by Sanger sequencing. The patient's mother and her unaffected sister carried the c.783delC variant in a heterozygous state, as expected for an autosomal recessive inheritance. Here, the TMPS identified the first homozygous 1-bp deletion variant in GDF9. This finding reveals a novel inheritance pattern of pathogenic variant in GDF9 associated with POI, thus improving the genetic diagnosis of this disorder.

Malignant testicular germ cell tumors in postpubertal individuals with androgen insensitivity: prevalence, pathology and relevance of single nucleotide polymorphism-based susceptibility profiling.

STUDY QUESTION: What is the prevalence of malignant testicular germ cell tumors (TGCT) and its precursors, (pre-) germ cell neoplasia in situ (GCNIS), in late teenagers and adults who have androgen insensitivity syndrome (AIS) and the impact of an individual's genetic susceptibility to development of TGCT? SUMMARY ANSWER: No GCNIS or TGCT was diagnosed, but pre-GCNIS was identified in 14 and 10% of complete and partial AIS patients, respectively, and was associated with a higher genetic susceptibility score (GSS), with special attention for KITLG (rs995030) and ATFZIP (rs2900333). WHAT IS KNOWN ALREADY: Many adult women with AIS decline prophylactic gonadectomy, while data regarding the incidence, pathophysiology and outcomes of TGCT in postpubertal individuals with AIS are lacking. The relevance of genetic factors, such as single nucleotide polymorphisms (SNPs), in predisposing AIS individuals to TGCT is unknown. STUDY DESIGN, SIZE, DURATION: This multicenter collaborative study on prophylactically removed gonadal tissue was conducted in a pathology lab specialized in germ cell tumor biology. PARTICIPANTS/MATERIALS, SETTING, METHODS: Material from 52 postpubertal individuals with molecularly confirmed AIS (97 gonadal samples) was included; the median age at surgery was 17.5 (14-54) years. Immunohistochemical studies and high-throughput profiling of 14 TGCT-associated SNPs were performed. The main outcome measures were the prevalence of pre-GCNIS, GCNIS and TGCT, and its correlation with a GSS, developed based on the results of recent genome-wide association studies. MAIN RESULTS AND ROLE OF CHANCE: The earliest recognizable change preceding GCNIS, referred to as pre-GCNIS, was present in 14% of individuals with complete and 10% of those with partial AIS at a median age of 16 years. No GCNIS or invasive TGCT were found. The median GSS was significantly greater for those with, compared to those without, pre-GCNIS (P = 0.01), with an overlap between groups. Our data suggest important roles for risk alleles G at KITLG (rs995030) and C at ATFZIP (rs2900333), among the 14 studied TGCT-associated SNPs. LARGE SCALE DATA: N/A. LIMITATIONS REASONS FOR CAUTION: A limited number of cases were included. WIDER IMPLICATIONS OF THE FINDINGS: Our data suggest that the prevalence of pre-GCNIS in individuals with AIS beyond puberty is around 15%. Genetic susceptibility likely contributes to pre-GCNIS development in AIS but factors related to malignant progression remain unclear. Although data in older patients remain scarce, malignant progression appears to be a rare event, although the natural history of the premalignant lesion remains unknown. Therefore, the practice of routine prophylactic gonadectomy in adults with AIS appears questionable and the patient's preference, after having been fully informed, should be decisive in this matter. STUDY FUNDING/COMPETING INTEREST(S): This study was supported by research grants from the Research Foundation Flanders (FWO) (to M.C.), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq G0D6713N) (to B.B.M. and M.C.) and the European Society for Pediatric Endocrinology (ESPE), granted by Novo Nordisk AB (to J.K.). There are no competing interests.

Discriminating between virilizing ovary tumors and ovary hyperthecosis in postmenopausal women: clinical data, hormonal profiles and image studies.

BACKGROUND: The presence of virilizing signs associated with high serum androgen levels in postmenopausal women is rare. Virilizing ovarian tumors (VOTs) and ovarian stromal hyperthecosis (OH) are the most common etiologies in virilized postmenopausal women. The differential diagnosis between these two conditions is often difficult. OBJECTIVE: To evaluate the contribution of clinical features, hormonal profiles and radiological studies to the differential diagnosis of VOT and OH. DESIGN: A retrospective study. SETTING: A tertiary center. MAIN OUTCOME MEASURES: Clinical data, hormonal status (T, E2, LH and FSH), pelvic images (transvaginal sonography and MRI) and anatomopathology were reviewed. PATIENTS: Thirty-four postmenopausal women with a diagnosis of VOT (13 women) and OH (21 women) were evaluated retrospectively. RESULTS: Clinical signs of hyperandrogenism were more prevalent in the VOT group than the OH group. Although the VOT group showed higher T and E2 levels and lower gonadotropin levels than the OH group, a great overlap occurred among the hormone levels. A pelvic MRI provided an accurate differentiation of these two conditions. CONCLUSION: In this group of patients, the main features contributing to the differential diagnosis of VOT and OH were serum levels of testosterone and gonadotropins and the presence of an ovarian nodule identified on the MRI. Although the association of clinical, hormonal and radiological features contributes to the differential diagnosis of these two conditions, histopathological analysis remains the gold standard for the diagnosis of ovarian hyperandrogenism in postmenopausal women.

Diagnosis of prolactinoma in two male-to-female transsexual subjects following high-dose cross-sex hormone therapy.

Male-to-female transsexual persons use oestrogens + antiandrogens to adapt their physical bodies to the female sex. Doses are usually somewhat higher than those used by hypogonadal women receiving oestrogen replacement. Particularly in cases of self-administration of cross-sex hormones, doses may be very high. Oestrogens are powerful stimulators of synthesis and release of prolactin and serum prolactin levels are usually somewhat increased following oestrogen treatment. Prolactinomas have been reported in male-to-female transsexual persons, both after use of high and conventional doses of oestrogens but remain rare events. We report two new cases of prolactinomas in male-to-female transsexual persons, one in a 41-year-old subject who had used nonsupervised high-dose oestrogen treatment since the age of 23 years and another one in a 42 year old who had initiated oestrogen treatment at the age of 17 years. Their serum prolactin levels were strongly increased, and the diagnosis of a pituitary tumour was confirmed by imaging techniques. Both cases responded well to treatment with cabergoline treatment whereupon serum prolactin normalised. Our two cases are added to the three cases of prolactinomas in the literature in persons who had used supraphysiological doses of oestrogens.

Mutations in the SRY, DAX1, SF1 and WNT4 genes in Brazilian sex-reversed patients

In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade

Clinical and molecular analysis of human reproductive disorders in Brazilian patients

Several genes that influence the development and function of the hypothalamic-pituitary-gonadal-axis (HPG) have been identified. These genes encode an array of transcription factors, matrix proteins, hormones, receptors, and enzymes that are expressed at multiple levels of the HPG. We report the experience of a single Endocrinology Unit in the identification and characterization of naturally occurring mutations in families affected by HPG disorders, including forms of precocious puberty, hypogonadism and abnormal sexual development due to impaired gonadotropin function. Eight distinct genes implicated in HPG function were studied: KAL, SF1, DAX1, GnRH, GnRHR, FSHá, FSHR, and LHR. Most mutations identified in our cohort are described for the first time in literature. New mutations in SF1, DAX1 and GnRHR genes were identified in three Brazilian patients with hypogonadism. Eight boys with luteinizing hormone- (LH) independent precocious puberty due to testotoxicosis were studied, and all have their LH receptor (LHR) defects elucidated. Among the identified LHR molecular defects, three were new activating mutations. In addition, these mutations were frequently associated with new clinical and hormonal aspects, contributing significantly to the knowledge of the molecular basis of reproductive disorders. In conclusion, the naturally occurring genetic mutations described in the Brazilian families studied provide important insights into the regulation of the HPG.

Clinical and molecular analysis of human reproductive disorders in Brazilian patients.

Several genes that influence the development and function of the hypothalamic-pituitary-gonadal-axis (HPG) have been identified. These genes encode an array of transcription factors, matrix proteins, hormones, receptors, and enzymes that are expressed at multiple levels of the HPG. We report the experience of a single Endocrinology Unit in the identification and characterization of naturally occurring mutations in families affected by HPG disorders, including forms of precocious puberty, hypogonadism and abnormal sexual development due to impaired gonadotropin function. Eight distinct genes implicated in HPG function were studied: KAL, SF1, DAX1, GnRH, GnRHR, FSHbeta, FSHR, and LHR. Most mutations identified in our cohort are described for the first time in literature. New mutations in SF1, DAX1 and GnRHR genes were identified in three Brazilian patients with hypogonadism. Eight boys with luteinizing hormone- (LH) independent precocious puberty due to testotoxicosis were studied, and all have their LH receptor (LHR) defects elucidated. Among the identified LHR molecular defects, three were new activating mutations. In addition, these mutations were frequently associated with new clinical and hormonal aspects, contributing significantly to the knowledge of the molecular basis of reproductive disorders. In conclusion, the naturally occurring genetic mutations described in the Brazilian families studied provide important insights into the regulation of the HPG.

Mutations in the SRY, DAX1, SF1 and WNT4 genes in Brazilian sex-reversed patients.

In most mammals, male development is triggered by the transient expression of the SRY gene, which initiates a cascade of gene interactions ultimately leading to the formation of a testis from the indifferent fetal gonad. Mutation studies have identified several genes essential for early gonadal development. We report here a molecular study of the SRY, DAX1, SF1 and WNT4 genes, mainly involved in sexual determination, in Brazilian 46,XX and 46,XY sex-reversed patients. The group of 46,XX sex-reversed patients consisted of thirteen 46,XX true hermaphrodites and four 46,XX males, and was examined for the presence of the SRY gene and for the loss of function (inactivating mutations and deletions) of DAX1 and WNT4 genes. In the second group consisting of thirty-three 46,XY sex-reversed patients we investigated the presence of inactivating mutations in the SRY and SF1 genes as well as the overexpression (duplication) of the DAX1 and WNT4 genes. The SRY gene was present in two 46,XX male patients and in none of the true hermaphrodites. Only one mutation, located outside homeobox domain of the 5' region of the HMG box of SRY (S18N), was identified in a patient with 46,XY sex reversal. A novel 8-bp microdeletion of the SF1 gene was identified in a 46,XY sex-reversed patient without adrenal insufficiency. The dosage of DAX1 and WNT4 was normal in the sex-reversed patients studied. We conclude that these genes are rarely involved in the etiology of male gonadal development in sex-reversed patients, a fact suggesting the presence of other genes in the sex determination cascade.

An inherited mutation outside the highly conserved DNA-binding domain of the p53 tumor suppressor protein in children and adults with sporadic adrenocortical tumors.

Mutations of the p53 tumor suppressor gene are the single most common genetic alterations in human cancers. Recently, a distinct nucleotide substitution was identified in exon 10 of the p53 gene, leading to an Arg337His mutation in 97% of children with adrenocortical tumors from Southern Brazil. In the present study, we investigated the presence of this mutation in a larger series of 55 patients (37 adults and 18 children) with benign and malignant sporadic adrenocortical tumors. None of the patients had family cancer histories that conformed to the criteria for Li-Fraumeni syndrome. Twenty-one asymptomatic close relatives of patients with p53 mutations and 60 normal unrelated individuals were also studied. The missense Arg337His mutation was identified in 19 patients (14 children and 5 adults), and 8 of 11 cases studied had LOH. Among the 19 patients with the Arg337His mutation, only one boy and three adults showed fatal evolution or recurrent metastases. This mutation was also identified in heterozygous state in asymptomatic first-degree relatives of the patients, indicating that Arg337His mutation was inherited in most cases. In contrast, this mutation was not found in 120 alleles of normal unrelated controls. In conclusion, the germ line Arg337His mutation of p53 protein is present at a high frequency (77.7%) in children with benign or malignant sporadic adrenocortical tumors, but it is not restricted to the pediatric group, since 13.5% of adults with adrenocortical tumors also had this mutation. The presence of this mutation was related to unfavorable prognosis in most of the adults, but not in the children with adrenocortical tumors.

Adrenocorticotropin-dependent precocious puberty of testicular origin in a boy with X-linked adrenal hypoplasia congenita due to a novel mutation in the DAX1 gene.

Primary adrenal insufficiency is a rare condition in pediatric age, and its association with precocious sexual development is very uncommon. We report a 2-yr-old Brazilian boy with DAX1 gene mutation whose first clinical manifestation was isosexual gonadotropin-independent precocious puberty. He presented with pubic hair, enlarged penis and testes, and advanced bone age. T levels were elevated, whereas basal and GnRH-stimulated LH levels were compatible with a prepubertal pattern. Chronic GnRH agonist therapy did not reduce T levels, supporting the diagnosis of gonadotropin-independent precocious puberty. Testotoxicosis was ruled out after normal sequencing of exon 11 of the LH receptor gene. At age 3 yr he developed clinical and hormonal features of severe primary adrenal insufficiency. The entire coding region of the DAX1 gene was analyzed through direct sequencing. A nucleotide G insertion between nucleotides 430 and 431 in exon 1, resulting in a novel frameshift mutation and a premature stop codon at position 71 of DAX-1, was identified. Surprisingly, steroid replacement therapy induced a clear decrease in testicular size and T levels to the prepubertal range. These findings suggest that chronic excessive ACTH levels resulting from adrenal insufficiency may stimulate Leydig cells and lead to gonadotropin-independent precocious puberty in some boys with DAX1 gene mutations.

Molecular analysis of SRY gene in Brazilian 46,XX sex reversed patients: absence of SRY sequence in gonadal tissue.

BACKGROUND: The importance of the Y chromosome in male determination has been well established for a long time. The presence of a translocation of chromosomal material encoding the Testis-Determining Factor from Y to another chromosome has been one of the hypothesis to explain testicular development in XX sex-reversed patients. MATERIAL AND METHODS: In the present study, we searched for SRY sequence in genomic DNA isolated from peripheral leukocytes in eleven 46,XX true hermaphrodites and four 46,XX males (only one with ambiguous genitalia). We also analyzed the presence of SRY sequence in fresh gonadal tissues from two 46,XX true hermaphrodites. RESULTS: SRY sequence was absent in DNA blood samples of all true hermaphrodites and in testicular and ovarian tissues of two cases studied. Of the four 46,XX males, two with normal male external genitalia were SRY positive. CONCLUSIONS: We did not identify the SRY gene in 46,XX true hermaphrodites and 46,XX males with ambiguous genitalia, therefore SRY translocation to X chromosome or autosome is unlikely. Hidden Y mosaicism in gonadal tissues was also ruled out in two cases, suggesting that cryptic SRY mosaicism in gonadal tissues is not the usual mechanism responsible for testicular development in patients with 46,XX true hermaphroditism. However, SRY gene was identified in two 46,XX males with male external genitalia showing that SRY gene determined their male phenotype. Despite the recent advances in the knowledge of the role of several genes involved in sexual determination we are still unable to explain the cause of most of Y-chromosome-negative 46,XX sex-reversed patients.

Treatment of gonadotropin dependent precocious puberty due to hypothalamic hamartoma with gonadotropin releasing hormone agonist depot.

The gonadotropin releasing hormone (GnRH) secreting hypothalamic hamartoma (HH) is a congenital malformation consisting of a heterotopic mass of nervous tissue that contains GnRH neurosecretory neurons attached to the tuber cinereum or the floor of the third ventricle. HH is a well recognised cause of gonadotropin dependent precocious puberty (GDPP). Long term data are presented on eight children (five boys and three girls) with GDPP due to HH. Physical signs of puberty were observed before 2 years of age in all patients. At presentation with sexual precocity, the mean height standard deviation (SD) for chronological age was +1.60 (1.27) and the mean height SD for bone age was -0.92 (1.77). Neurological symptoms were absent at presentation and follow up. The hamartoma diameter ranged from 5 to 18 mm and did not change in six patients who had magnetic resonance imaging follow up. All patients were treated clinically with GnRH agonists (GnRH-a). The duration of treatment varied from 2.66 to 8.41 years. Seven of the eight children had satisfactory responses to treatment, shown by regression of pubertal signs, suppression of hormonal levels, and improvement of height SD for bone age and predicted height. One patient had a severe local reaction to GnRH-a with failure of hormonal suppression and progression of pubertal signs. It seems that HH is benign and that GnRH-a treatment provides satisfactory and safe control for most children with GDPP due to HH.

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.

A novel missense mutation (S18N) in the 5' non-HMG box region of the SRY gene in a patient with partial gonadal dysgenesis and his normal male relatives.

Mutations in the sex-determining region of the Y chromosome (the SRY gene) have been reported in low frequency in patients with 46,XY gonadal dysgenesis. We investigated 21 Brazilian 46,XY sex-reversed patients, who presented either complete or partial gonadal dysgenesis or embryonic testicular regression syndrome. Using Southern blotting, polymerase chain reaction, denaturing gradient gel electrophoresis and direct sequencing, we analyzed deletions and point mutations in the SRY gene. We found a missense mutation at codon 18 upstream of the 5' border of the HMG box of the SRY gene in one patient with partial gonadal dysgenesis. This variant sequence was also found in DNA obtained from blood and sperm cells of his father and in blood cells of his normal brother. The S18N mutation was not found in 50 normal males, ruling out the possibility of a common polymorphism. We identified a novel familial missense mutation (S18N) in the 5' non-HMG box of the SRY gene in 1 of 21 patients with 46,XY sex reversal.

Long-acting gonadotropin-releasing hormone agonists in the differential diagnosis of male precocious puberty.

Male sexual precocity is defined as the development of secondary sexual characteristics before 9 years of age. It can be classified as gonadotropin-dependent precocious puberty (GnDP) or gonadotropin-independent precocious puberty (GnIP) and sometimes the differential diagnosis between these entities is difficult. To determine whether long-acting GnRH agonists (GnRH-a) are effective in differential diagnosis of male precocious puberty, we measured gonadotropins and testosterone levels 30 days after a single administration of depot GnRH-a (triptorelin, gosereline or leuprolide) in 10 boys with sexual precocity of different etiologies. Testosterone levels 30 days after depot GnRH-a were in the prepubertal range in patients with GnDP but not in GnIP. We conclude that measurement of testosterone levels 30 days after long-acting GnRH-a is effective in the differential diagnosis of male sexual precocity.

Clinical, hormonal and pathological findings in a comparative study of adrenocortical neoplasms in childhood and adulthood.

PURPOSE: We reviewed clinical and laboratory findings in 6 male and 32 female patients with functional adrenocortical neoplasms, and compared pediatric and adult data. MATERIALS AND METHODS: Hormonal measurements were performed by radioimmunoassay, histological analysis was based on Weiss criteria and staging was done according to previously established guidelines. RESULTS: Children had a higher incidence of virilization (72%), whereas in adults the predominant feature was Cushing's syndrome (60%). A high testosterone level was the most common finding in adults and children with virilization followed by high dehydroepiandrosterone sulfate, androstenedione and dehydroepiandrosterone levels. High 11-deoxycortisol levels were frequently associated with tumor recurrence. Cortisol suppression after dexamethasone was altered in 93% of patients with virilization and no clinical features, suggesting autonomous cortisol secretion. CONCLUSIONS: No statistically significant relation was noted between tumor weight and prognosis but there was a negative correlation between patient age and prognosis since children had a more favorable followup than adults. Mixed features in both groups resulted in the worst prognosis. A Weiss criteria grade IV or greater correlated well with a poor prognosis in adults but not children, while staging was more reliable in children.

A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty.

Familial male-limited precocious puberty (FMPP) is an autosomal dominant gonadotropin-independent disorder. Affected males generally develop signs of precocious puberty in early childhood. They typically show Leydig cell hyperplasia and increased testosterone production typical for their age, whereas circulating LH concentrations remain prepubertal. Several dominant point mutations of the LH receptor gene were identified in pedigrees with familial male-limited precocious puberty and were shown to cosegregate with the disease. Here we report a novel heterozygote point mutation in the LH receptor gene of a Brazilian boy with gonadotropin-independent precocious puberty. This mutation substitutes alanine 568 with valine at the carboxyterminus of the third cytosolic loop of the LH receptor. The unoccupied mutant receptors confer constitutive activation of adenyl cyclase activity when expressed in COS-7 cells, resulting in 4-fold higher cAMP concentrations over baseline compared with cells expressing an equivalent number of wild-type receptors. The affinity of the mutant receptors to 125I-labeled human LH was not altered compared with the wild type. Mutations of the homologue alanine residue in the alpha 1-adrenergic (in vitro), FSH (in vitro), and TSH (naturally occurring) receptors also result in constitutive adenyl cyclase activation, suggesting that this alanine residue is crucial for signal transduction and a potential site for upregulatory/oncogenic mutations in G-protein coupled receptors.

Sleep characteristics of adolescents: a longitudinal study.

The aim of the present research was to study sleep/wake cycle parameters of adolescents and to examine biologic and social influences on their changing sleep patterns. This was a longitudinal study of sleep characteristics of a group of 66 adolescents (mean age, 13 years and 6 months). The adolescents underwent a physical examination, had their pubertal development classified according to Tanner stages, and answered a sleep questionnaire on three timepoints at 6-month intervals. Sleep onset occurred about 1.0 hr later, wake-up time about 3.0 hr later, and sleep length was 1.0-1.5 hr longer on weekends when compared with weekdays. About 60% of the adolescents reported daytime sleepiness, mainly from 8:00 a.m. to 10:00 a.m. and from 2:00 p.m. to 4:00 p.m. on school days. Morning sleepiness on school days occurred at a time of the day that corresponded to sleep on non-school days. Additionally, there was a displacement toward later hours of the wake-up time and a sleep-length increase during weekends from the first to the third timepoint. Social factors such as home conditions and scheduling of school and non-school activities did not change throughout the period of pubertal development studied. Changes of sleep patterns detected may therefore represent an ontogenetic trend along puberty.

Adrenal autografts following bilateral adrenalectomy.

Bilateral adrenalectomy followed by immediate transplantation of adrenal slices into muscular tissue was performed in 7 patients with Cushing's disease and 1 with bilateral pheochromocytoma. Patients were followed for 1 to 7 years and only 1 had evidence of a functional graft (serum cortisol level at the lower limit of normality). Low levels of dehydroepiandrosterone sulfate, aldosterone and cortisol were found in the remaining patients. Acute stimulation with adrenocorticotropichormone did not increase either cortisol or aldosterone levels in any patient. We conclude that prospective studies are needed to elucidate factors that could improve the success of adrenal implantation, since the literature shows examples of functional grafts, while the majority of the cases are unsuccessful.