Investigation of the MDM2-binding potential of de novo designed peptides using enhanced sampling simulations.

The tumor suppressor p53 plays a crucial role in cellular responses to various stresses, regulating key processes such as apoptosis, senescence, and DNA repair. Dysfunctional p53, prevalent in approximately 50 % of human cancers, contributes to tumor development and resistance to treatment. This study employed deep learning-based protein design and structure prediction methods to identify novel high-affinity peptide binders (Pep1 and Pep2) targeting MDM2, with the aim of disrupting its interaction with p53. Extensive all-atom molecular dynamics simulations highlighted the stability of the designed peptide in complex with the target, supported by several structural analyses, including RMSD, RMSF, Rg, SASA, PCA, and free energy landscapes. Using the steered molecular dynamics and umbrella sampling simulations, we elucidate the dissociation dynamics of p53, Pep1, and Pep2 from MDM2. Notable differences in interaction profiles were observed, emphasizing the distinct dissociation patterns of each peptide. In conclusion, the results of our umbrella sampling simulations suggest Pep1 as a higher-affinity MDM2 binder compared to p53 and Pep2, positioning it as a potential inhibitor of the MDM2-p53 interaction. Using state-of-the-art protein design tools and advanced MD simulations, this study provides a comprehensive framework for rational in silico design of peptide binders with therapeutic implications in disrupting MDM2-p53 interactions for anticancer interventions.

CHAPERONg: A tool for automated GROMACS-based molecular dynamics simulations and trajectory analyses.

Molecular dynamics (MD) simulation is a powerful computational tool used in biomolecular studies to investigate the dynamics, energetics, and interactions of a wide range of biological systems at the atomic level. GROMACS is a widely used free and open-source biomolecular MD simulation software recognized for its efficiency, accuracy, and extensive range of simulation options. However, the complexity of setting up, running, and analyzing MD simulations for diverse systems often poses a significant challenge, requiring considerable time, effort, and expertise. Here, we introduce CHAPERONg, a tool that automates the GROMACS MD simulation pipelines for protein and protein-ligand systems. CHAPERONg also integrates seamlessly with GROMACS modules and third-party tools to provide comprehensive analyses of MD simulation trajectories, offering up to 20 post-simulation processing and trajectory analyses. It also streamlines and automates established pipelines for conducting and analyzing biased MD simulations via the steered MD-umbrella sampling workflow. Thus, CHAPERONg makes MD simulations more accessible to beginner GROMACS users whilst empowering experts to focus on data interpretation and other less programmable aspects of MD simulation workflows. CHAPERONg is written in Bash and Python, and the source code is freely available at https://github.com/abeebyekeen/CHAPERONg. Detailed documentation and tutorials are available online at dedicated web pages accessible via https://abeebyekeen.com/chaperong-online.

Delineation of the CENP-LN sub-complex dissociation mechanism upon multisite phosphorylation during mitosis.

Phosphorylation is the most prevalent form of regulation in cells, organizing virtually all cellular functions, including survival, motility, differentiation, proliferation, and metabolism. This regulatory function has been largely conserved from the primitive single-cell to the more complex multicellular organisms. More than a third of proteins in eukaryotes are phosphorylated, and essentially every class of protein undergoes regulation by phosphorylation. A decline in the cellular level of CENP-L and CENP-N (components of the constitutive centromere associated network) has earlier been reported and linked to cyclin-dependent kinase (CDK) phosphorylation upon transition into mitosis. Given the importance of posttranslational modifications in cell cycle regulation, mechanistic comprehension of the impact of phosphorylation on both proteins (CENP-L and CENP-N) is of high significance. Through the application of diverse computational analytical techniques, including atomistic molecular dynamics simulations, the mechanism of kinetochore mis-localization and dissociation of the CENP-LN sub-complex in mitosis was delineated. We showed that the phosphorylation of both components of the sub-complex induces global conformational destabilizing effects on the proteins, combined with changes in the electrostatic potential and increase in steric clashes around the protein-protein interaction interface. This, consistent with earlier experimental reports, suggest that the multisite phosphorylation of the CENP-LN sub-complex plays a crucial role in the regulation of cell division.Communicated by Ramaswamy H. Sarma.

CSC01 shows promise as a potential inhibitor of the oncogenic G13D mutant of KRAS: an in silico approach.

About 30% of malignant tumors include KRAS mutations, which are frequently required for the development and maintenance of malignancies. KRAS is now a top-priority cancer target as a result. After years of research, it is now understood that the oncogenic KRAS-G12C can be targeted. However, many other forms, such as the G13D mutant, are yet to be addressed. Here, we used a receptor-based pharmacophore modeling technique to generate potential inhibitors of the KRAS-G13D oncogenic mutant. Using a comprehensive virtual screening workflow model, top hits were selected, out of which CSC01 was identified as a promising inhibitor of the oncogenic KRAS mutant (G13D). The stability of CSC01 upon binding the switch II pocket was evaluated through an exhaustive molecular dynamics simulation study. The several post-simulation analyses conducted suggest that CSC01 formed a stable complex with KRAS-G13D. CSC01, through a dynamic protein-ligand interaction profiling analysis, was also shown to maintain strong interactions with the mutated aspartic acid residue throughout the simulation. Although binding free energy analysis through the umbrella sampling approach suggested that the affinity of CSC01 with the switch II pocket of KRAS-G13D is moderate, our DFT analysis showed that the stable interaction of the compound might be facilitated by the existence of favorable molecular electrostatic potentials. Furthermore, based on ADMET predictions, CSC01 demonstrated a satisfactory drug likeness and toxicity profile, making it an exemplary candidate for consideration as a potential KRAS-G13D inhibitor.

MasitinibL shows promise as a drug-like analog of masitinib that elicits comparable SARS-Cov-2 3CLpro inhibition with low kinase preference.

SARS-CoV-2 infection has led to several million deaths worldwide and ravaged the economies of many countries. Hence, developing therapeutics against SARS-CoV-2 remains a core priority in the fight against COVID-19. Most of the drugs that have received emergency use authorization for treating SARS-CoV-2 infection exhibit a number of limitations, including side effects and questionable efficacy. This challenge is further compounded by reinfection after vaccination and the high likelihood of mutations, as well as the emergence of viral escape mutants that render SARS-CoV-2 spike glycoprotein-targeting vaccines ineffective. Employing de novo drug synthesis or repurposing to discover broad-spectrum antivirals that target highly conserved pathways within the viral machinery is a focus of current research. In a recent drug repurposing study, masitinib, a clinically safe drug against the human coronavirus OC43 (HCoV-OC43), was identified as an antiviral agent with effective inhibitory activity against the SARS-CoV-2 3CLpro. Masitinib is currently under clinical trial in combination with isoquercetin in hospitalized patients (NCT04622865). Nevertheless, masitinib has kinase-related side effects; hence, the development of masitinib analogs with lower anti-tyrosine kinase activity becomes necessary. In this study, in an attempt to address this limitation, we executed a comprehensive virtual workflow in silico to discover drug-like compounds matching selected pharmacophore features in the SARS-CoV-2 3CLpro-bound state of masitinib. We identified a novel lead compound, "masitinibL", a drug-like analog of masitinib that demonstrated strong inhibitory properties against the SARS-CoV-2 3CLpro. In addition, masitinibL further displayed low selectivity for tyrosine kinases, which strongly suggests that masitinibL is a highly promising therapeutic that is preferable to masitinib.

A New Variant of Mutational and Polymorphic Signatures in the ERG11 Gene of Fluconazole-Resistant Candida albicans.

Background: Resistance to antifungal drugs for treating Candida infections remains a major concern globally despite the range of medications available. Most of these drugs target key proteins essential to the life cycle of the organism. An enzyme essential for fungal cell membrane integrity, lanosterol 14-α demethylase (CYP51), is encoded by the ERG11 gene in Candida species. This enzyme is the target of azole-based drugs. The organism has, however, devised molecular adaptations to evade the activity of these drugs. Materials and Methods: Classical methods were employed to characterize clinical isolates sampled from women and dogs of reproductive age. For fluconazole efficacy studies, CLSI guidelines on drug susceptibility testing were used. To understand the susceptibility pattern, various molecular and structural analytic approaches, including sequencing, in silico site-directed mutagenesis, and protein-ligand profiling, were applied to the ERG11 gene and CYP51 protein sequences. Several platforms, comprising Clustal Omega, Pymol plugin manager, Pymol molecular visualizer, Chimera-curated Dynameomics rotamer library, protein-ligand interaction profiler, Charmm36 force field, GROMACS, Geneious, and Mega7, were employed for this analysis. Results: The following Candida species distribution was obtained: 37.84% C. albicans, 8.12% C. glabrata, 10.81% C. krusei, 5.41% C. tropicalis, and 37.84% of other unidentified Candida species. Two codons in the nucleotide sequence of the wild-type (CTC and CCA) coding for LEU-370 and PRO-375, respectively, were mutated to L370S and P375H in the resistant strain. The mutation stabilized the protein at the expense of the heme moiety. We found that the susceptible isolate from dogs (Can-iso-029/dog) is closely related to the most resistant isolate from humans. Conclusion: Taken together, our results showed new mutations in the heme-binding pocket of caCYP51 that explain the resistance to fluconazole exhibited by the Candida isolates. So far, the L370S and P375H resistance-linked mutations have not been previously reported.

Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.

The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.

Mad2 promotes Cyclin B2 recruitment to the kinetochore for guiding accurate mitotic checkpoint.

Accurate mitotic progression relies on the dynamic phosphorylation of multiple substrates by key mitotic kinases. Cyclin-dependent kinase 1 is a master kinase that coordinates mitotic progression and requires its regulatory subunit Cyclin B to ensure full kinase activity and substrate specificity. The function of Cyclin B2, which is a closely related family member of Cyclin B1, remains largely elusive. Here, we show that Mad2 promotes the kinetochore localization of Cyclin B2 and that their interaction at the kinetochores guides accurate chromosome segregation. Our biochemical analyses have characterized the Mad2-Cyclin B2 interaction and delineated a novel Mad2-interacting motif (MIM) on Cyclin B2. The functional importance of the Cyclin B2-Mad2 interaction was demonstrated by real-time imaging in which MIM-deficient mutant Cyclin B2 failed to rescue the chromosomal segregation defects. Taken together, we have delineated a previously undefined function of Cyclin B2 at the kinetochore and have established, in human cells, a mechanism of action by which Mad2 contributes to the spindle checkpoint.

Elucidation of the underlying mechanism of SARS-CoV-2-mediated cytokine storm syndrome towards enhancing COVID-19 therapeutic modalities

Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) has demonstrated a similar infection pattern (with a faster rate of transmission) and clinical features compared to Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and Middle East Respiratory Syndrome Coronavirus (MERS-CoV). However, it is of utmost interest that acute respiratory distress syndrome (ARDS), systemic inflammatory response syndrome (SIRS) and acute lung injury (ALI) occurred in both MERS-CoV- and SARS-CoV-infected individuals, as well as Coronavirus Disease-19 (COVID-19) patients.1 Specific cytokines have been observed at the core of inflammation development and have also been found to play critical roles in facilitating the exhibition of the aforementioned clinical features. According to reports from previous studies, cytokines such as Tumor Necrosis Factor-α (TNF-α), Macrophage Inflammatory Protein-1A (MIP-1A), monocyte chemoattractant protein-1 (MCP-1), IFN-γ-Inducible Protein 10 (IP10), Granulocyte colony-stimulating factor (GSCF), Interleukin-2 (IL-2), Interleukin-7 (IL-7), Interleukin-10 (IL-10) and Interleukin-17 (IL-17) are significantly increased in COVID-19 patients, with the attributes of a cytokine storm.2 Upon infection by SARS-CoV-2, the inflammatory response plays an antiviral function, but an intense cytokine storm as a result of imbalanced response, could have a harmful effect on patients.1 Therefore, employing approaches that suppresse effectively cytokine storm is required for saving the COVID-19 patients' lives and to prevent...(AU)

Oral cavity infection by the SARS-CoV-2: emphasizing the essence of masking and peptide therapeutics.

The SARS-CoV-2 has infected many people globally with the ravaging COVID-19; a disease, which has become challenging for every aspect of modern healthcare. The saliva and oral mucosa are sites of high risk for increased viral loads, and aside from the usual epithelial functions like lining and protection, the oral mucosa is also specialized for crucial functions, such as secretion, mastication, sensory perception, and taste perception. The human ACE2 receptor has been extensively studied for its essential role in the regulation of blood pressure homeostasis. However, scRNA-Seq studies have revealed high expression levels of the protein in keratinized epithelial surfaces of the oral cavity. The SARS-CoV-2 have access to the host's body by binding to the ACE2 receptor, leading to the cleavage and major conformational changes in the viral spike glycoprotein for the release of its nucleocapsid into the cellular cytoplasm. This proteolytic cleavage is carried out by the TMPRSS2 and cathepsin L. In this study, we harnessed the information from the binding interface of TMPRSS2 and PAI-1 (a protease inhibitor known to inhibit the TMPRSS2 and several other proteases) to design a potential therapeutic peptide for the inhibition of the TMPRSS2, while also emphasizing the need for preventive masking. Supplementary Information: The online version contains supplementary material available at 10.1186/s43042-022-00213-z.

Intracellular proteome compartmentalization: a biotin ligase-based proximity labeling approach.

Specialized biological processes occur in different regions and organelles of the cell. Additionally, the function of proteins correlate greatly with their interactions and subcellular localization. Understanding the mechanism underlying the specialized functions of cellular structures therefore requires a detailed identification of proteins within spatially defined domains of the cell. Furthermore, the identification of interacting proteins is also crucial for the elucidation of the underlying mechanism of complex cellular processes. Mass spectrometry methods have been utilized systematically for the characterization of the proteome of isolated organelles and protein interactors purified through affinity pull-down or following crosslinking. However, the available methods of purification have limited these approaches, as it is difficult to derive intact organelles of high purity in many circumstances. Furthermore, contamination that leads to the identification of false positive is widespread even when purification is possible. Here, we present a highlight of the BioID proximity labeling approach which has been used to effectively characterize the proteomic composition of several cellular compartments. In addition, an observed limitation of this method based on proteomic spatiotemporal dynamics, was also discussed.

Gene therapy in PIDs, hemoglobin, ocular, neurodegenerative, and hemophilia B disorders.

A new approach is adopted to treat primary immunodeficiency disorders, such as the severe combined immunodeficiency (SCID; e.g., adenosine deaminase SCID [ADA-SCID] and IL-2 receptor X-linked severe combined immunodeficiency [SCID-X1]). The success, along with the feasibility of gene therapy, is undeniable when considering the benefits recorded for patients with different classes of diseases or disorders needing treatment, including SCID-X1 and ADA-SCID, within the last two decades. ß-Thalassemia and sickle cell anemia are two prominent monogenic blood hemoglobin disorders for which a solution has been sought using gene therapy. For instance, transduced autologous CD34+ HSCs via a self-inactivating (SIN)-Lentivirus (LV) coding for a functional copy of the ß-globin gene has become a feasible procedure. adeno-associated virus (AAV) vectors have found application in ocular gene transfer in retinal disease gene therapy (e.g., Leber's congenital amaurosis type 2), where no prior treatment existed. In neurodegenerative disorders, successes are now reported for cases involving metachromatic leukodystrophy causing severe cognitive and motor damage. Gene therapy for hemophilia also remains a viable option because of the amount of cell types that are capable of synthesizing biologically active FVIII and FIX following gene transfer using AAV vectors in vivo to correct hemophilia B (FIX deficiency), and it is considered an ideal target, as proven in preclinical studies. Recently, the clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9 gene-editing tool has taken a center stage in gene therapy research and is reported to be efficient and highly precise. The application of gene therapy to these areas has pushed forward the therapeutic clinical application.

Computer-aided screening for potential TMPRSS2 inhibitors: a combination of pharmacophore modeling, molecular docking and molecular dynamics simulation approaches.

Transmembrane serine protease 2 (TMPRSS2) has been established as one of the host proteins that facilitate entry of coronaviruses into host cells. One of the approaches often employed towards preventing the entry and proliferation of viruses is computer-aided inhibition studies to identify potent compounds that can inhibit activity of viral targets in the host through binding at the active site. In this study, we developed a pharmacophore model of reportedly potent drugs against severe acute respiratory syndrome coronaviruses 1 and 2 (SARS-CoV-1 and -2). The model was used to screen the ZINC database for commercially available compounds having similar features with the experimentally tested drugs. The top 3000 compounds retrieved were docked into the active sites of a homology-modelled TMPRSS2. Docking scores of the top binders were validated and the top-ranked compounds were subjected to ADME, Lipinski's and medicinal Chemistry property predictions for druglikeness analyses. Two lead compounds, ZINC64606047 and ZINC05296775, were identified having binding affinities higher than those of the reference inhibitors, favorable interactions with TMPRSS2 active site residues and good ADME and medicinal chemistry properties. Molecular dynamics simulation was used to assess the stability and dynamics of the interactions of these compounds with TMPRSS2. Binding free energy and contribution energy evaluations were determined using MMPBSA method. Analyses of the trajectory dynamics collectively established further that the lead compounds bound and interacted stably with active site residues of TMPRSS2. Nonetheless, experimental studies are needed to further assess the potentials of these compounds as possible therapeutics against coronaviruses.Communicated by Ramaswamy H. Sarma.

Characterization of the SARS-CoV-2 coronavirus X4-like accessory protein.

Background: The novel coronavirus SARS-CoV-2 is currently a global threat to health and economies. Therapeutics and vaccines are in rapid development; however, none of these therapeutics are considered as absolute cure, and the potential to mutate makes it necessary to find therapeutics that target a highly conserved regions of the viral structure. Results: In this study, we characterized an essential but poorly understood coronavirus accessory X4 protein, a core and stable component of the SARS-CoV family. Sequence analysis shows a conserved ~ 90% identity between the SARS-CoV-2 and previously characterized X4 protein in the database. QMEAN Z score of the model protein shows a value of around 0.5, within the acceptable range 0-1. A MolProbity score of 2.96 was obtained for the model protein and indicates a good quality model. The model has Ramachandran values of φ = - 57o and ψ = - 47o for α-helices and values of φ = - 130o and ψ = + 140o for twisted sheets. Conclusions: The protein data obtained from this study provides robust information for further in vitro and in vivo experiment, targeted at devising therapeutics against the virus. Phylogenetic analysis further supports previous evidence that the SARS-CoV-2 is positioned with the SL-CoVZC45, BtRs-BetaCoV/YN2018B and the RS4231 Bat SARS-like corona viruses.

Efficacy of Kigelia africana Lam. (Benth.) leaf and stem bark ethanolic extracts on adult cowpea seed beetle, [Callosobruchus maculatus Fabricius (Coleoptera: Chrysomelidae)] affecting stored cowpea seeds (Vigna unguiculata).

Callosobruchus maculatus is the most damaging insect pest of stored cowpea (Vigna unguiculata) seeds in Nigeria. Thus, this present research work was put in place to assess the insecticidal activities of the extracts obtained from the leaf and stem bark of Kigelia africana (Lam.) Benth against the cowpea seed beetle, C. maculatus. The parameters that were assessed were adult mortality, oviposition and adult emergence of C. maculatus. The experiments were conducted under laboratory conditions of 28±2 °C temperature and 75 ± 5% relative humidity. The extracts were applied at dosages of 0.3, 0.6, 0.9 and 1.2 mL per 20 g of cowpea seeds. The two extracts of K. africana were found to be toxic to the survival of the C. maculatus. However, the extract obtained from the leaf was more potent to the beetle than the extract obtained from the stem bark of the same plant. The two extracts also reduced ovipositipon and completely suppressed adult emergence at the highest dose of 1.2 mL per 50 g of cowpea seeds. The results obtained in the present research work showed that the two extracts of K. africana were effective in suppressing the population of the infamous stored pest of cowpea seed beetle, C. maculatus and could therefore be recommended to replace the harmful synthetic chemical insecticides in protecting cowpea seeds in storage.

Evaluation of botanical powders and extracts from Nigerian plants as protectants of maize grains against maize weevil, Sitophilus zeamais (Motschulsky) [Coleoptera: Curculionidae].

Toxicities of leaf powders and extracts of Acanthus montanus, Acanthospermum hispidum, Alchornea laxiflora and Argyreia nervosa against maize weevil (Sitophilus zeamais) were evaluated. Powders were tested at dose 3.0g/20g while extracts were tested at concentration 3%/20g of maize grains. Mortality, oviposition, and adult emergence rates as well as weight loss, seeds damage and weevil perforation index (WPI) were evaluated. Phytochemical constituents of the experimental plants were also carried out. The results showed that Acanthus montanus powder was the most potent with 65% adult mortality after 24 h of treatment. This is followed by Argyreia nervosa powder that evoked 52.5% weevil mortality. The least toxic to S. zeamais was Acanthospermum hispidum powder with 32.5% adult mortality. Extracts were more toxic than the powders of the tested plants. Acanthus montanus extract was the most toxic since it promoted 80% adult mortality after 24 h of treatment. Acanthus montanus, Alchornea laxiflora and Argyreia nervosa leaf powders and extracts completely prevented oviposition by adult insect, adult emergence, weight loss and seeds damaged. The phytochemicals present in Acanthus montanus were alkaloids (3.67 mg/g), saponin (3.33 mg/g), tannin (3.00 mg/g) and flavonoid (2.67 mg/g) contents. Acanthospermum hispidum had the least alkaloid (2.67 mg/g), saponin (1.67 mg/g), tannin (1.33 mg/g) and flavonoid (1.00 mg/g) contents. Acanthus montanus, Argyreia nervosa, Alchornea laxiflora and Acanthospermum hispidum were efficacious against S. zeamais instead of synthetic chemical insecticides that have environmental health hazards and they can be used in integrated pest management by farmers and foods merchants.

Celastrol inhibits ezrin-mediated migration of hepatocellular carcinoma cells.

Progression of hepatocellular carcinoma involves multiple genetic and epigenetic alterations that promote cancer invasion and metastasis. Our recent study revealed that hyperphosphorylation of ezrin promotes intrahepatic metastasis in vivo and cell migration in vitro. Celastrol is a natural product from traditional Chinese medicine which has been used in treating liver cancer. However, the mechanism of action underlying celastrol treatment was less clear. Here we show that ROCK2 is a novel target of celastrol and inhibition of ROCK2 suppresses elicited ezrin activation and liver cancer cell migration. Using cell monolayer wound healing, we carried out a phenotype-based screen of natural products and discovered the efficacy of celastrol in inhibiting cell migration. The molecular target of celastrol was identified as ROCK2 using celastrol affinity pull-down assay. Our molecular docking analyses indicated celastrol binds to the active site of ROCK2 kinase. Mechanistically, celastrol inhibits the ROCK2-mediated phosphorylation of ezrin at Thr567 which harnesses liver cancer cell migration. Our findings suggest that targeting ROCK2-ezrin signaling is a potential therapeutic niche for celastrol-based intervention of cancer progression in hepatocellular carcinoma.

Potential therapeutic target identification in the novel 2019 coronavirus: insight from homology modeling and blind docking study.

Background: The 2019-nCoV which is regarded as a novel coronavirus is a positive-sense single-stranded RNA virus. It is infectious to humans and is the cause of the ongoing coronavirus outbreak which has elicited an emergency in public health and a call for immediate international concern has been linked to it. The coronavirus main proteinase which is also known as the 3C-like protease (3CLpro) is a very important protein in all coronaviruses for the role it plays in the replication of the virus and the proteolytic processing of the viral polyproteins. The resultant cytotoxic effect which is a product of consistent viral replication and proteolytic processing of polyproteins can be greatly reduced through the inhibition of the viral main proteinase activities. This makes the 3C-like protease of the coronavirus a potential and promising target for therapeutic agents against the viral infection. Results: This study describes the detailed computational process by which the 2019-nCoV main proteinase coding sequence was mapped out from the viral full genome, translated and the resultant amino acid sequence used in modeling the protein 3D structure. Comparative physiochemical studies were carried out on the resultant target protein and its template while selected HIV protease inhibitors were docked against the protein binding sites which contained no co-crystallized ligand. Conclusion: In line with results from this study which has shown great consistency with other scientific findings on coronaviruses, we recommend the administration of the selected HIV protease inhibitors as first-line therapeutic agents for the treatment of the current coronavirus epidemic.