Systemic infection and symptom development of agro-inoculated cDNA clone of cherry rusty mottle-associated virus in sweet cherry (Prunus avium).

Cherry rusty mottle-associated virus (CRMaV), which belongs the genus Robigovirus of the family Betaflexiviridae, is strongly associated with cherry rusty mottle disease of sweet cherry, Prunus avium. Here, we report on the successful development of an Agrobacterium-based inoculation system for a cloned CRMaV cDNA construct. Agro-inoculation of virus-free cherry rootstock 'Krymsk6' [P. cerasus x (P. cerasus x P. maackii)] resulted in the development of chlorotic yellow mottle symptoms on systemic leaves beginning at 50 days post inoculation. The presence of CRMaV in 'Krymsk6' agro-inoculated plants was confirmed by RT-PCR and ELISA. Subsequently, CRMaV from agro-inoculated 'Krymsk6' was graft-transmissible onto virus-free sweet cherry rootstock P. avium 'Mazzard' as evidenced by the production of typical cherry rusty mottle symptoms beginning at 35 days post grafting, and further confirmed by western blotting and RT-PCR. These results showed conclusively that CRMaV is the causal agent of cherry rusty mottle disease in sweet cherry. The reverse genetic system presented in this study can be used as a tool to investigate the molecular biology of CRMaV and also a template for infectious clone development for other viruses in the genus Robigovirus.

High throughput sequencing reveals a novel fabavirus infecting sweet cherry.

The genus Fabavirus currently consists of five species represented by viruses that infect a wide range of hosts but none reported from temperate climate fruit trees. A virus with genomic features resembling fabaviruses (tentatively named Prunus virus F, PrVF) was revealed by high throughput sequencing of extracts from a sweet cherry tree (Prunus avium). PrVF was subsequently shown to be graft transmissible and further identified in three other non-symptomatic Prunus spp. from different geographical locations. Two genetic variants of RNA1 and RNA2 coexisted in the same samples. RNA1 consisted of 6,165 and 6,163 nucleotides, and RNA2 consisted of 3,622 and 3,468 nucleotides.

High-Throughput Sequencing Identifies Novel Viruses in Nectarine: Insights to the Etiology of Stem-Pitting Disease.

Recent studies have shown the superiority of high-throughput sequencing (HTS) technology over many standard protocols for pathogen detection. HTS was initiated on fruit tree accessions from disparate sources to improve and advance virus-testing procedures. A virus with genomic features resembling most closely that of the recently described Nectarine stem-pitting-associated virus, putative member of genus Luteovirus, was found in three nectarine trees (Prunus persica cv. nectarina), each exhibiting stem-pitting symptoms on the woody cylinder above the graft union. In these samples, HTS also revealed the presence of a coinfecting virus with genome characteristics typical of members of the genus Marafivirus. The same marafivirus- and luteovirus-like viruses were detected in nonsymptomatic nectarine and peach selections, indicating only a loose relationship between these two viruses with nectarine stem-pitting disease symptoms. Two selections infected with each of these viruses had previously tested free of known virus or virus-like agents using the current biological, serological, and molecular tests employed at the Clean Plant Center Northwest. Overall, this study presents the characterization by HTS of novel marafivirus- and luteovirus-like viruses of nectarine, and provides further insights into the etiology of nectarine stem-pitting disease. The discovery of these new viruses emphasizes the ability of HTS to reveal viruses that are not detected by existing protocols.

Genomic analyses of cherry rusty mottle group and cherry twisted leaf-associated viruses reveal a possible new genus within the family betaflexiviridae.

It is demonstrated that closely related viruses within the family Betaflexiviridae are associated with a number of diseases that affect sweet cherry (Prunus avium) and other Prunus spp. Cherry rusty mottle-associated virus (CRMaV) is correlated with the appearance of cherry rusty mottle disease (CRMD), and Cherry twisted leaf-associated virus (CTLaV) is linked to cherry twisted leaf disease (CTLD) and apricot ringpox disease (ARPD). Comprehensive analysis of previously reported full genomic sequences plus those determined in this study representing isolates of CTLaV, CRMaV, Cherry green ring mottle virus, and Cherry necrotic rusty mottle virus revealed segregation of sequences into four clades corresponding to distinct virus species. High-throughput sequencing of RNA from representative source trees for CRMD, CTLD, and ARPD did not reveal additional unique virus sequences that might be associated with these diseases, thereby further substantiating the association of CRMaV and CTLaV with CRMD and CTLD or ARPD, respectively. Based on comparison of the nucleotide and amino acid sequence identity values, phylogenetic relationships with other triple-gene block-coding viruses within the family Betaflexiviridae, genome organization, and natural host range, a new genus (Robigovirus) is suggested.

First Report of Infection of Cherry Rusty Mottle Associated Virus in Portuguese Laurel (Prunus lusitanica) in Washington State.

During late spring of 2012 in Snohomish County of Washington State, chlorotic yellow leaf blotch symptoms suggestive of a virus infection were observed on Portuguese laurel (Prunus lusitanica) planted in a hedge row. Leaf samples from representative trees were initially tested for the presence of Cherry leaf roll virus (CLRV) and Plum pox virus (PPV) by ELISA with antibodies specific to CLRV and general potyvirus, respectively (Agdia, Inc., Elkhart, IN). The ELISA test yielded negative results for both viruses. Reverse transcription (RT)-PCR was pursued to detect other viruses known to infect Prunus spp., namely American plum line pattern virus (APLPV), Apple chlorotic leafspot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry raspleaf virus (CRLV), Cherry virus A (CVA), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV), as well as CLRV and PPV. None of these viruses were detected. However, RT-PCR with a generic primer pair Fovea2/AdPr (3) that amplifies the coat protein (CP) coding sequence and 3'-untranslated regions (3'-UTR) of several members of the family Betaflexiviridae yielded a 1.4-kb amplicon that was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. KF356396). The sequences from three clones were 99.8% identical to each other at the nucleotide level. Comparison of the consensus CP coding region with the nucleotide sequence database revealed 86 to 93% identity to Cherry rusty mottle associated virus (CRMaV), and only 73 to 75% identities to Cherry necrotic rusty mottle virus (CNRMV) (1) and 71 to 76% identities to Cherry green ring mottle virus (CGRMV) (4) isolates from sweet cherry (P. avium). This result suggested that the cloned fragment represents a strain of CRMaV. Prunus avium 'Bing' and 'Sam,' and P. serrulata 'Kwanzan' were grafted with bark patches from the symptomatic tree and observed for induction of cherry rusty mottle disease (CRMD) symptoms. Ninety days after grafting, symptoms typical of CRMD consisting of chlorotic yellow mottle appeared on 'Bing,' 'Sam,' and 'Kwanzan' indicators. Small necrotic spots also appeared on the leaves of the latter. Angular necrotic lesions on 'Sam' and epinasty of 'Kwanzan' that are diagnostic symptoms of cherry necrotic rusty mottle disease (CNRMD) and cherry green ring mottle disease (CGRMD), respectively, were absent from graft inoculated indicators. Further RT-PCR tests on the indicators using primers specific to CNRMV, CGRMV, and CRMaV (2) yielded negative results for CNRMV and CGRMV but showed positive amplification for CRMaV. The results of the woody indexing corroborate the presence of CRMaV but the absence of CNRMV and CGRMV in the symptomatic Portuguese laurel. To our knowledge, this is the first report of CRMaV in Portuguese laurel in the United States and the first description of symptoms associated with CRMaV in this host. As a potential reservoir of CRMaV, Portuguese laurel could play an important component in management of CRMD in cherry production areas where this ornamental cherry is also present. References: (1) M. E. Rott and W. Jelkmann. Arch. Virol. 146:395, 2001. (2) D. E. V. Villamor and K. C. Eastwell. Phytopathology 103:1287, 2012. (3) D. V. Villamor et al. Arch. Virol. 158:1805, 2013. (4) Y. P. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Viruses associated with rusty mottle and twisted leaf diseases of sweet cherry are distinct species.

Virus RNA sequences related to those of the family Betaflexiviridae were amplified from trees affected with the following diseases: cherry twisted leaf, apricot ring pox, cherry necrotic rusty mottle, cherry rusty mottle, and cherry green ring mottle. Phylogenetic analysis of virus sequences obtained from these diseased trees from western North America, along with published sequences of Cherry green ring mottle virus (CGRMV) and Cherry necrotic rusty mottle virus (CNRMV), revealed four major clades. Segregation into these four populations correlated with distinct symptom expression on woody indicators, suggesting that each clade represents a distinct virus species within the family Betaflexiviridae. The viruses occupying each clade were designated clade I: Cherry twisted leaf associated virus, clade II: CNRMV, clade III: Cherry rusty mottle associated virus, and clade IV: CGRMV. Potential recombination events were predicted to occur within and between these viruses, the latter being strongly supported by incongruent phylogenies. Examination of frequency distribution data derived from pairwise sequence comparisons of coat protein coding sequences resulted in a proposal for alternative guidelines for species demarcation for this family of viruses.

Complete nucleotide sequence of a virus associated with rusty mottle disease of sweet cherry (Prunus avium).

Cherry rusty mottle is a disease of sweet cherries first described in 1940 in western North America. Because of the graft-transmissible nature of the disease, a viral nature of the disease was assumed. Here, the complete genomic nucleotide sequences of virus isolates from two trees expressing cherry rusty mottle disease symptoms are characterized; the virus is designated cherry rusty mottle associated virus (CRMaV). The biological and molecular characteristics of this virus in comparison to those of cherry necrotic rusty mottle virus (CNRMV) and cherry green ring mottle virus (CGRMV) are described. CRMaV was subsequently detected in additional sweet cherry trees expressing symptoms of cherry rusty mottle disease.

First Report of Transmission of Little cherry virus 2 to Sweet Cherry by Pseudococcus maritimus (Ehrhorn) (Hemiptera: Pseudococcidae).

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Characterization of Cherry leafroll virus in Sweet Cherry in Washington State.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain '37B', which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3'-untranslated region (3'-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3'-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3'-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

First Report of Seedborne Cherry leaf roll virus in Wild Potato, Solanum acaule, from South America.

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3' untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2). References: (1) K. Hosaka and D. M. Spooner. Theor. Appl. Genet. 84:851, 1992. (2) R. A. C. Jones et al. Phytopathology 73:195, 1983. (3) J. R. Thompson et al. Arch. Virol. 149:2141, 2004. (4) B. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Helleborus net necrosis virus: A New Carlavirus Associated with 'Black Death' of Helleborus spp.

Symptoms of 'black death' were observed on Helleborus spp. in each of three independent nurseries from across the United States. A new virus of the genus Carlavirus was identified in association with this disease. Symptomatic plants contained curved, rod-shaped particles averaging 800 by 17 nm, and yielded predominant bands of double-stranded (ds)RNA corresponding to approximately 9.0, 2.6, and 1.7 kbp. Amplification with degenerate primers for carlaviruses yielded a product of approximately 3,000 bp from diseased plants. Complete genomic sequences of two virus isolates were determined. Particle size, dsRNA patterns, genome organization, and sequence were consistent with members of the family Flexiviridae, genus Carlavirus. The name Helleborus net necrosis virus (HeNNV) is proposed for the virus associated with black death of Helleborus spp. in the United States. The sequence of the 3' terminus of Helleborus mosaic virus (HeMV) (genus Carlavirus) was also determined. Nucleotide sequences of HeNNV and HeMV were only 49% identical, revealing the distinct nature of these viruses. Assays for other viruses failed to reveal a consistent association of any other virus with black death symptoms. Cucumber mosaic virus was detected in hellebore specimens both with and without distinct black death symptoms.

Molecular characterization of a new tymovirus from Diascia ornamental plants.

Two tymoviruses were identified in plants of Diascia x hybrida 'Sun Chimes Coral' that exhibited chlorotic mottling and reduced growth. A strain of Nemesia ring necrosis virus (NeRNV) designated NeRNV-WA was detected in symptomatic plants; the deduced amino acid sequence is virtually identical to that of the previously reported NeRNV-Nf from Nemesia fruticosa. Sequence analysis also revealed the presence of a new tymovirus, and the entire genomic sequence of this virus was determined. The genome of 6,290 nucleotides was organized into three potential open reading frames (ORFs) typical of viruses in the genus Tymovirus. Based on sequence identity to tymovirus sequences, ORFs I to III encoded the replicase, movement protein and coat protein, respectively. Amino acid sequence identities to those of NeRNV-Nf were 84.8, 50.3 and 94.8%, respectively. The 5'-untranslated region could potentially form four hairpin structures. Secondary structure analysis of the 3'-terminus showed that the RNA can form a transfer-RNA-like structure that has an anticodon specific for histidine. Only 77.9% nucleotide identity was found when complete genomic sequences of this tymovirus from diascia and NeRNV-Nf were compared. The name Diascia yellow mottle virus (DiaYMV) is proposed for this new tymovirus.

Genome structure and organization of a member of a novel and distinct species of the genus Caulimovirus associated with dahlia mosaic.

The genome structure and organization of a new and distinct caulimovirus that is widespread in dahlia (Dahlia variabilis) was determined. The double-stranded DNA genome was ca. 7.0 kb in size and shared many of the features of the members of the genus Caulimovirus, such as the presence of genes potentially coding for the movement protein, the inclusion body protein, and the reverse transcriptase (RT), and an intergenic region consisting of a potential 35S promoter. However, the virus differed from the previously described dahlia mosaic caulimovirus and other known caulimoviruses in that the aphid transmission factor (ATF) was absent and the putative coat protein contained a C-terminal deletion and was fused in-frame with the RT. Sequence identity at the amino acid level with known caulimoviruses including a previously reported caulimovirus from dahlia was low and ranged from 32 to 72%. The absence of an ATF and the highly divergent nature of the genomic sequence are characteristics of this new caulimovirus that is widely associated with dahlia.

First Report of Infection of Poison Hemlock and Celery by Apium virus Y in Washington State.

A commercial field of celery (Apium graveolens var. dulce) cvs. Conquistador and Sabroso was planted with sets between 1 June and 10 July 2004 in Pierce County in western Washington (WA). In late August, many plants were stunted and showed chlorotic line patterns. One symptomatic plant and five nonsymptomatic plants were transferred to a greenhouse and grown at 22°C with supplemental lighting to extend day length to 16 h; foliage was trimmed back. The symptomatic plant and three nonsymptomatic plants developed a distinctive chlorotic line pattern when new foliage emerged in February. Two plants remained nonsymptomatic. Young foliage was tested by ELISA with the general potyvirus monoclonal antibody (Agdia, Inc., Elkhart, IN). All symptomatic plants yielded a positive result and the two nonsymptomatic plants were negative. Celery mosaic virus (CeMV) was previously reported to be widespread in WA (3), but primers specific for CeMV did not yield amplicons in reverse transcription (RT)-PCR from RNA isolated from symptomatic leaf tissue (RNeasy Plant Mini Kit: QIAGEN, Valencia, CA). General potyvirus primers (1) were used to amplify ≈1,700 nucleotides from the 3' terminus of the virus genome adjacent to the poly-A tail. Six amplicons from each of three independent reactions were cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. FJ010827). Comparison with the nucleotide sequence database revealed 98 and 97% identity to Australian isolates of Apium virus Y (ApVY) (family Potyviridae) from parsley (GenBank Accession No. AF207594) and poison hemlock (Conium maculatum) (GenBank Accession No. AY049716) (4) and 91% identity to North American isolates of ApVY from celery and Ammi majus reported from California (GenBank Accession No. EU515126) and Florida (GenBank Accession No. EU255632), respectively. To our knowledge, this is the first report of a natural infection of celery by ApVY in WA. No other potyvirus sequences were identified in RT-PCR products from symptomatic celery. In 2008, in an effort to locate local samples of CeMV, poison hemlock plants were randomly collected in Benton, Walla Walla, and Whitman counties of eastern WA. No symptoms were observed and no CeMV was detected by RT-PCR in any of these plants. No ApVY was detected in 10 of 10 poison hemlock collected from Walla Walla County, but based on sequence analysis of RT-PCR amplicons, two of two plants collected from Benton and Whitman counties were infected with ApVY. In contrast to the WA isolates from celery, sequences from these poison hemlock plants (GenBank Accession No. FJ010828) were 98% identical to previously reported North American isolates of ApVY (GenBank Accession Nos. EU515126 and EU255632) and only 91% identical to Australian isolates (GenBank Accession Nos. AF207594 and AY049716). To our knowledge, this is the first report of ApVY in WA and the first report of a natural infection of poison hemlock in the United States. The celery and poison hemlock isolates reported in this study were from different geographic regions of the state and were only 91% identical. As is the case for other potyviruses (2), weeds such as poison hemlock may serve as a reservoir of ApVY in eastern WA where many plants of the family Apiaceae are grown commercially. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) W. E. Howell and G. I. Mink. Plant Dis. Rep. 61:217, 1977. (3) W. E. Howell and G. I. Mink. Plant Dis. 65:277, 1981. (4) J. Moran et al. Arch. Virol. 147:1855, 2002.

Occurrence of Two Little Cherry Viruses in Sweet Cherry in Washington State.

Little cherry disease, one of the major viral diseases of sweet cherry (Prunus avium) worldwide, is associated with either of two closteroviruses, Little cherry virus 1 (LChV-1) and Little cherry virus 2 (LChV-2). Two sets of primers corresponding to a portion of the replicase gene of LChV-1 and LChV-2 were used in one-tube reverse-transcription polymerase chain reactions to detect these viruses in total RNA extracts of field-collected sweet cherry tissues. LChV-1 and LChV-2 were detected both alone and in combination in five sweet cherry orchards in Washington State. Sequence analysis of a 240-nucleotide (nt) fragment of the replicase open reading frame (ORF)1b and a 232-nt fragment from a portion of ORF8 and the 3' untranslated region (UTR) of LChV-1 indicated that North American (NA) isolates shared 90 to 99% nucleotide identity in both genome segments analyzed. In contrast, comparisons of NA isolates to two Eurasian isolates of LChV-1 indicated shared nucleotide identities of 79 to 82% in the replicase fragment and 89 to 90% in the ORF8/3'UTR fragment. Sequence variation in the replicase region did not affect detection of LChV-1 in 12 isolates using the replicase-specific primers reported here. This article represents the first report of LChV-1 and LChV-2 in sweet cherry in Washington.

Canna yellow mottle virus in Canna spp. in Washington State.

Canna (Canna indica) is an important nursery/landscape plant in Washington State with several nurseries producing canna plants for wholesale and retail businesses. Canna plants showing symptoms such as mottling, general yellowing, and veinal chlorosis were found to be widespread (40% symptomatic plants in a nursery of more than 2,000 plants) in Grant County, WA in September 2007. Symptomatic leaves from five plants of each of the following cultivars were tested: Richard Wallace, Crimson Beauty, Wyoming, Petoria, Pink Beauty, Robert Kemp, and Black Knight. Electron microscopic examination of leaf-dip preparations from symptomatic leaves showed badnavirus-like particles of approximately 120 × 30 nm. A badnavirus, Canna yellow mottle virus (CaYMV) (family Caulimoviridae, genus Badnavirus) from canna was first reported from Japan (4) and later in the United States (1,3). Most recently, CaYMV was reported from Italy and the Netherlands (2). Samples were tested for CaYMV by PCR using CaYMV-specific primers, CaYMV-3 (5'- GAC TTC CTG GGT GCA ACA AT -3') and CaYMV-4 (5'- TCT GTG CAA TCT TGG CGT AG -3') (2), which produced a 565-bp amplicon. All samples tested gave the amplicon of expected size. The amplicon from one leaf sample from each of the cultivars was cloned and sequenced. Sequence comparisons with those available in the GenBank confirmed that the sequence obtained was that of CaYMV (95% sequence identity). Increased awareness of the prevalence of CaYMV in nurseries and avoiding the propagation and distribution of infected plants are necessary to minimize the further spread of this virus in canna. References: (1) B. E. L. Lockhart. Acta Hortic. 234:69, 1988. (2) M. T. Marino et al. Online publication. New Disease Reports. http://www.bspp.org.uk/NDR/july2007/2007-08.asp , 2007. (3) M. T. Momol et al. Online publication. doi:10.1094/PHP-2004-0809-01-HN. Plant Health Progress, 2004. (4) S. Yamashita et al. Ann. Phytopathol. Soc. Jpn. 51:642, 1985.

First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State.

Washington State is the largest producer of juice grapes (Vitis labruscana 'Concord' and Vitis labrusca 'Niagara') and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of 'Concord' and three samples from one nursery of 'Niagara' were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5'-CGC TAG GGC TGT GGA AGT ATT-3') and LC 2 (5'-GTT GTC CCG GGT ACC AGA TAT-3'), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One 'Niagara' nursery sample and eleven 'Concord' samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The 'Niagara' and six of the 'Concord' RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from 'Concord' and 'Niagara' share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the 'Niagara' and two of the 'Concord' isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

Incidence and transmission of a granulovirus in a large codling moth [Cydia pomonella L. (Lepidoptera: Tortricidae)] rearing facility.

Incidences of potential per os Cydia pomonella granulovirus (CpGV) transmission within a large codling moth colony were identified. CpGV was detected in the water which is used to wash egg sheets. When pre-neonates were extracted from eggs prior to emergence and tested for the presence of CpGV, 40% were found to carry amounts of CpGV detectable by a polymerase chain reaction (PCR) assay, suggesting possible transovarial transmission of the virus. Although symptoms typical of virus infection and larval death were found infrequently within communal rearing trays, the frequency with which CpGV DNA was detected by PCR assays increased from a mean of 31% of 10-day-old larvae to 94% of 25-day-old larvae. CpGV in codling moth cadavers remained virulent after being held at 60 degrees C for 3 days under conditions similar to the treatment of spent diet at the rearing facility before its disposal. PCR tests of surface samples taken from air filters and rearing rooms of the rearing facility were found to contain CpGV. Bioassays of surface samples from the diet trash bin and a filter through which outside air is passed before entering the rearing chambers resulted in significant codling moth neonate mortality. The virulence of CpGV in dust from the spent diet and the original inadvertent positioning of the diet trash bin directly below one of the air intake ducts are suggested as a possible additional source of CpGV contamination within the facility.

Survey for Viruses of Grapevine in Oregon and Washington.

Grapevines (Vitis spp.) in Washington and Oregon were surveyed for the prevalence of key grapevine viruses. Samples collected from 1,522 vines in Washington were tested for Rupestris stem pitting associated virus (RSPaV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV), and Grapevine leafroll associated virus-3 (GLRaV-3). Tests were also conducted for GLRaV-1 and -2 on 420 samples from Washington. Two hundred forty samples collected from wine grape vineyards in Oregon were tested for GLRaV-1, -2, and -3, and an additional 2,880 samples were collected from 40 vineyards known to have high populations of Xiphinema americanum nematodes. The latter were tested for ArMV, ToRSV, and GFLV. GLRaV-1, -2, and -3 were detected in 2.6, 0.2, and 6.5% of the Washington samples and in 3.0, 0.4, and 4.4% of the Oregon samples. RSPaV was detected in 4.6% of the samples from Washington. No ToRSV, ArMV, or GFLV was detected in any of the samples from Oregon or Washington. Transmission of field isolates of GLRaV-3 from Washington by the grape mealybug also was demonstrated.