Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 24
Filter
Add more filters











Publication year range
1.
Toxicol Lett ; 401: 13-23, 2024 Aug 27.
Article in English | MEDLINE | ID: mdl-39197506

ABSTRACT

BACKGROUND: Nowadays, the use of food additives, such as Sunset Yellow (SY), is growing, which attracted attention to the potential relationship between some diseases and food additives. AIM: The study aimed to investigate the role of Sunset Yellow during chemically-induced mammary gland carcinogenesis in Sprague-Dawley rats. MATERIAL AND METHODS: Three groups of female rats were intraperitoneally administered with N-methyl-N-nitrosourea (MNU). Group 1 was set on a basal diet. Group 2 was treated with 161.4 mg\kg\day Sunset Yellow (SY). Group 3 was given SY at 80.7 mg\kg\day. Groups 4-6 were not administered MNU; Group 4 received vehicles only. Groups 5 and 6 were administered SY similarly to groups 2 and 3 respectively. RESULTS: Sunset Yellow at both doses exerted a significant dose-dependent increase in tumor incidences, multiplicities, volumes, and decreased tumor latency as compared with control. Immunolabeling indexes of the proliferating cell nuclear antigen, estrogen receptor alpha, and progesterone receptor were significantly increased after SY treatment. Oxidative stress markers, serum estrogen, progesterone, and prolactin levels were significantly modified by SY treatment. The mRNA expression of estrogen receptor alpha and epidermal growth factor was up-regulated in SY groups versus control. CONCLUSION: Collectively, SY has significantly promoted MNU-induced mammary tumors in rats with underlying mechanisms correlating SY consumption with estrogen disruption and subsequent antioxidative stress discrepancy.

2.
Front Bioeng Biotechnol ; 12: 1415645, 2024.
Article in English | MEDLINE | ID: mdl-39205857

ABSTRACT

Objectives: This study determines gender variation, comparing the significance level between men and women related to functional ambulation characteristics after hip arthroplasty. The study focuses on the broader female pelvis and how it affects the rehabilitation regimen following total hip arthroplasty. Materials and Methods: In this cross-sectional study, 20 cases of right hip arthroplasty were divided into 10 male and 10 female cases, aged 40-65 years. The functional ambulation parameters (walking cadence, gait speed, stride length, and gait cycle time) were acquired from the GAITRite device, as well as kinematic values for hip frontal plane displacement and kinetic parameters for ground response force in the medial-lateral direction. Results: An independent t-test showed a significant difference in the kinematic parameter variables for the anterior superior iliac spine, more significant trochanter displacement, and hip abduction angle between the operated and non-operated limbs for each group separately. Regarding the functional ambulation parameters, there was a significant difference in the walking cadence between the operated and non-operated limbs of both male and female groups. Moreover, the output variables of ground reaction force measures revealed significant differences between their operated and non-operated limbs. The linear regression model used was consistent with the current results, demonstrating a weak negative correlation between the abduction angle of the operated hip and gait speed for both male and female groups. Conclusion: Based on the findings, we draw the conclusion that improving a rehabilitated physical therapy program for the abductors of both male and female patients' operated and non-operated limbs is essential for normalizing the ground reaction force value, avoiding focus on the operated hip, and reducing the amount of time that the operated hip's abductors must perform. This involves exposing the surgically repaired limb to the risk of post-operative displacement or dislocation, particularly in female patients.

3.
Tissue Cell ; 88: 102420, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38795506

ABSTRACT

Peripheral and central neuropathies frequently complicate worldwide diabetes. Compared to peripheral neuropathy, central neuropathy didn`t gain a major research interest. Angiotensin II is reported to be involved in diabetic neuropathic pain but its role in the central pathological changes in the spinal cord is not clear. Here, we study the role of Losartan; an Angiotensin II receptor 1 (AT1) antagonist in suppression of the diabetes-induced changes in the spinal cord. Three groups of rats were applied; a negative control group, a streptozotocin (STZ) diabetic group, and a group receiving STZ and Losartan. After two months, the pathological alteration in the spinal cord was investigated, and an immunohistochemical study was performed for neuronal, astrocytic, and microglial markers; nuclear protein (NeuN), Glial fibrillary acidic protein (GFAP), and Ionized calcium-binding adaptor molecule 1 (Iba1), respectively, and for an apoptosis marker; caspase-3, and the inflammatory marker; nuclear factor kappa B (NF-kB) signaling, heme oxygenase-1 (HO-1) and nuclear factor erythroid 2-related factor 2 (Nrf2); physiological antioxidant system. The results showed that Losartan caused recovery of spinal cord changes, by inhibiting the microglial and astrocytic activation, suppressing neuronal apoptosis and NF-kB expression with activation of Nrf2/HO-1 (P<0.0005). It is suggested, herein, that Losartan can suppress diabetes-induced glial activation, inflammation, neuronal apoptosis, and oxidative stress in the spinal cord; the mechanisms that may underlie the role of AT1 antagonism in suppressing diabetic neuropathic pain.


Subject(s)
Angiotensin II Type 1 Receptor Blockers , Diabetes Mellitus, Experimental , Losartan , NF-E2-Related Factor 2 , Spinal Cord , Animals , Spinal Cord/pathology , Spinal Cord/metabolism , Spinal Cord/drug effects , Diabetes Mellitus, Experimental/pathology , Diabetes Mellitus, Experimental/metabolism , Diabetes Mellitus, Experimental/drug therapy , Diabetes Mellitus, Experimental/complications , NF-E2-Related Factor 2/metabolism , Angiotensin II Type 1 Receptor Blockers/pharmacology , Rats , Male , Losartan/pharmacology , Heme Oxygenase-1/metabolism , Diabetic Neuropathies/pathology , Diabetic Neuropathies/metabolism , Diabetic Neuropathies/drug therapy , Signal Transduction/drug effects , Rats, Wistar , Apoptosis/drug effects , NF-kappa B/metabolism , Oxidative Stress/drug effects
4.
Front Pharmacol ; 15: 1384834, 2024.
Article in English | MEDLINE | ID: mdl-38751780

ABSTRACT

Introduction: Administration of high doses of acetaminophen (APAP) results in liver injury. Oxidative stress and iron overload play roles in the pathogenesis of APAP-induced hepatotoxicity. The present study assessed the potential hepatoprotective effects of phytic acid (PA), a natural antioxidant and iron chelator, on APAP-induced hepatotoxicity and the possible underlying mechanism through its effects on CYP2E1 gene expression, iron homeostasis, oxidative stress, and SIRT-1 expression levels. Methods: Twenty-four adult male albino mice were used in this study. Mice were divided into four groups (six mice in each group): control, APAP-treated, PA-treated and APAP + PA-treated groups. Liver function tests, serum and liver tissue iron load were evaluated in all the study groups. Hepatic tissue homogenates were used to detect oxidative stress markers, including malondialdehyde (MDA) and reduced glutathione (GSH). Histological hepatic evaluation and immunohistochemistry of SIRT-1 were performed. Quantitative real-time PCR was used for the assessment of CYP2E1 and SIRT-1 gene expressions. APAP-induced biochemical and structural hepatic changes were reported. Results: PA administration showed beneficial effects on APAP-induced hepatotoxicity through improvements in liver functions, decreased CYP2E1 gene expression, decreased serum and liver iron load, decreased MDA, increased GSH, increased SIRT-1 expression level and improvement in hepatic architecture. Conclusion: Conclusively, PA can be considered a potential compound that can attenuate acetaminophen-induced hepatotoxicity through its role as an iron chelator and antioxidant, as well as the up-regulation of SIRT-1 and down-regulation of CYP2E1.

5.
Tissue Cell ; 88: 102385, 2024 Jun.
Article in English | MEDLINE | ID: mdl-38678740

ABSTRACT

BACKGROUND: Metabolic syndrome (MetS) is commonly associated with increased risk of cardiac disease that affects a large number of world populations. OBJECTIVE: This research attempted to investigate the efficacy of fennel seeds extract (FSE) in preventing development of cardiac dysfunction in rats on fructose enriched diet for 3 months, as a model of MetS. MATERIALS & METHODS: Thirty adult Wistar male rats (160-170 g) were assigned into 5 groups including control, vehicle, FSE (200 mg/kg BW) and fructose (60%) fed rats with and without FSE. Following the last treatment, blood pressure, ECG and heart rate were measured. Next, blood and cardiac tissues were taken for biochemical and histological investigations. RESULTS: Feeding fructose exhibited characteristic features of MetS involving, hypertension, abnormal ECG, elevated heart rate, serum glucose, insulin, lipids and insulin resistance, accompanied by abdominal obesity, cardiac hypertrophy and hyperuricemia. Fructose fed rats also showed significant reduction in cardiac antioxidants (GSH, SOD, CAT) with elevation in oxidative stress indices (NADPH oxidase, O2.-, H2O2, MDA, PCO), NF-κß, pro-inflammatory cytokines (TNF-α, IL-1ß, IL-6), adhesion molecules (ICAM-1, VCAM-1) and serum cardiac biomarkers (AST, LDH, CK-MB, cTn-I). Histopathological changes evidenced by destruction of cardiac myofibrils, cytoplasmic vacuolization, and aggregation of inflammatory cells were also detected. Consumption of FSE showed high ability to alleviate fructose-induced hypertension, ECG abnormalities, cardiac hypertrophy, metabolic alterations, oxidative stress, inflammation and histological injury. CONCLUSION: Findings could suggest FSE as a complementary supplement for preventing MetS and associated cardiac outcomes. However, well controlled clinical studies are still needed.


Subject(s)
Disease Models, Animal , Foeniculum , Fructose , Hyperuricemia , Inflammation , Metabolic Syndrome , NF-kappa B , Plant Extracts , Rats, Wistar , Seeds , Animals , Metabolic Syndrome/metabolism , Metabolic Syndrome/pathology , Metabolic Syndrome/chemically induced , Metabolic Syndrome/drug therapy , Fructose/adverse effects , Plant Extracts/pharmacology , Male , NF-kappa B/metabolism , Seeds/chemistry , Rats , Hyperuricemia/chemically induced , Hyperuricemia/drug therapy , Foeniculum/chemistry , Inflammation/pathology , Inflammation/metabolism , Oxidative Stress/drug effects , Signal Transduction/drug effects
6.
Tissue Cell ; 84: 102192, 2023 Oct.
Article in English | MEDLINE | ID: mdl-37579617

ABSTRACT

Aging is a highly complicated natural process. Brain aging is associated with remarkable neurodegenerative changes and oxidative damage. Whey protein (WP) has been mentioned to have an antioxidant property. Nuclear factor erythrogen-2 associated factor 2 (Nrf2) signaling pathway is an antioxidant defense system. Nrf2 activity declines with age so, its activation could be a promising therapeutic strategy for aging. This study aimed to explore the anti-aging role of WP against D-galactose (D-gal) induced age-related degenerative changes and oxidative damage in the prefrontal cortex (PFC) and investigate its underlying mechanisms. Forty adult male rats were divided into 4 groups; control, WP group received WP (28.77 mg/kg/day) by gastric tube on the 4th experimental week; D-gal (model group) received D-gal (300 mg/kg/day) intraperitoneally for 8 weeks and D-gal +WP group received WP on the 4th week of D-gal treatment. Specimens from PFC were obtained for biochemical, histological, immunohistochemical and western blot analysis. WP treatment in D-gal +WP group reduced lipid peroxidation, enhanced antioxidant enzyme activities, decreased advanced glycation end products level and improved the histological and ultrastructural alterations. Moreover, the number of neurons expressed the senescence marker; p21 and percentage area of the astrocytic marker; glial fibrillary acidic protein were significantly reduced. WP also enhanced Nrf2 pathway and its downstream targets; heme oxygenase-1 and NADPH quinone oxidoreductase 1. In conclusion WP alleviates the D-gal-induced PFC aging through activating Nrf2 pathway, reducing cell senescence and gliosis. So, it may be a potential therapeutic target to retard the aging process.


Subject(s)
Antioxidants , NF-E2-Related Factor 2 , Rats , Male , Animals , Antioxidants/metabolism , NF-E2-Related Factor 2/metabolism , Whey Proteins/pharmacology , Whey Proteins/metabolism , Aging/metabolism , Oxidative Stress , Signal Transduction , Prefrontal Cortex/metabolism , Galactose/pharmacology
7.
Front Neuroanat ; 17: 1094301, 2023.
Article in English | MEDLINE | ID: mdl-36968023

ABSTRACT

Introduction: Diabetes is a global disease, commonly complicated by neuropathy. The spinal cord reacts to diabetes by neuronal apoptosis, microglial activation, and astrocytosis, with a disturbance in neuronal and glial Nuclear factor erythroid 2-related factor/Heme oxygenase-1 (Nrf2/HO-1) and Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) signaling. Curcumin, a bioactive natural substance, showed neuroprotective role in many diseases. However, its role in the treatment of the diabetic central neuropathy of spinal cord and the underlying mechanisms still need clarification. The present study tried to evaluate the role of curcumin in diabetes-induced central neuropathy of the spinal cord in rats. Methods: Twenty rats were divided into three groups; group 1: a negative control group; group 2: received streptozotocin (STZ) to induce type I diabetes, and group 3: received STZ + Curcumin (150 mg/kg/day) for eight weeks. The spinal cords were examined for histopathological changes, and immunohistochemical staining for Glia fibrillary acidic protein (GFAP); an astrocyte marker, Ionized calcium-binding adaptor molecule 1 (Iba1), a microglial marker, neuronal nuclear protein (NeuN); a neuronal marker, caspase-3; an apoptosis marker, Nrf2/HO-1, NF-kB, and oxidative stress markers were assessed. Results: Curcumin could improve spinal cord changes, suppress the expression of Iba1, GFAP, caspase-3, and NF-kB, and could increase the expression of NeuN and restore the Nrf2/HO-1 signaling. Discussion: Curcumin could suppress diabetic spinal cord central neuropathy, glial activation, and neuronal apoptosis with the regulation of Nrf2/HO-1 and NF-kB signaling.

8.
Int J Mol Sci ; 23(21)2022 Oct 24.
Article in English | MEDLINE | ID: mdl-36361584

ABSTRACT

Methotrexate (MTX) is a potent anti-cancer drug, commonly associated with nephrotoxicity via the induction of oxidative stress and apoptosis with alteration of renal water channel proteins, namely aquaporins (AQPs). Omega-3 long-chain polyunsaturated fatty acids (LC-PUFA) have shown cytoprotective effects through their anti-oxidant and antiapoptotic activities. The present study aims for the first time to explore the role of LC-PUFA against MTX-induced nephrotoxicity. Rats were divided into the following groups: saline control, LC-PUFA control, MTX, MTX + LC-PUFA (150 mg/kg), or MTX + LC-PUFA (300 mg/kg). Then, H&E staining and immunohistochemical staining for the anti-apoptosis marker B-cell lymphoma 2 (BCL-2), the apoptosis marker BCL2-Associated X Protein (BAX), the proinflammatory marker Nuclear factor kappa B (NF-kB), AQPs 1 and 2 were performed in kidney sections with an assessment of renal oxidative stress. The MTX caused a renal histopathological alteration, upregulated renal BAX and NF-kB, downregulated Bcl-2 and AQP1, altered the distribution of AQP2, and caused oxidative stress. The LC-PUFA attenuated the pathological changes and decreased renal BAX and NF-kB, increased BCL-2 and AQP1, restored the normal distribution of AQP2, and decreased the oxidative stress. Therefore, LC-PUFA is a good adjuvant to MTX to prevent its adverse effects on kidneys through its antiapoptotic, antioxidant, and anti-inflammatory effect and its role in the restoration of the expression of AQPs 1 and 2.


Subject(s)
Fatty Acids, Omega-3 , Methotrexate , Rats , Animals , Methotrexate/metabolism , bcl-2-Associated X Protein/genetics , bcl-2-Associated X Protein/metabolism , NF-kappa B/metabolism , Aquaporin 2/metabolism , Oxidative Stress , Kidney/metabolism , Antioxidants/pharmacology , Antioxidants/metabolism , Proto-Oncogene Proteins c-bcl-2/genetics , Proto-Oncogene Proteins c-bcl-2/metabolism , Fatty Acids, Omega-3/pharmacology , Fatty Acids, Omega-3/metabolism , Dietary Supplements
9.
Front Cell Neurosci ; 16: 967813, 2022.
Article in English | MEDLINE | ID: mdl-36187296

ABSTRACT

Parkinson's disease (PD) is the second most common neurodegenerative disease. Treatment of PD is challenging, as current treatment strategies are only symptomatic and do not stop disease development. Recent studies reported neuroprotective effects of calcitriol in PD through its antioxidant and anti-inflammatory properties. The exact pathomechanisms of PD are not yet fully understood. So, investigation of different molecular pathways is challenging. Sirtuin-1 (Sirt1) modulates multiple physiological processes, including programmed cell death, DNA repair, and inflammation. Furthermore, defective autophagy is considered a key pathomechanism in PD as it eliminates protein aggregation and dysfunctional cell organelles. The present study investigated the involvement of autophagy and Sirt1/NF-κB molecular pathway in rotenone-induced PD and explored the protective and restorative effects of calcitriol through these mechanisms. Therefore, behavioral tests were used to test the effect of calcitriol on motor disability and equilibrium. Furthermore, the histological and neuronal architecture was assessed. The expression of genes encoding neuroinflammation and autophagy markers was determined by qPCR while their protein levels were determined by Western blot analysis and immune-histochemical staining. Our results indicate that behavioral impairments and dopaminergic neuron depletion in the rotenone-induced PD model were improved by calcitriol administration. Furthermore, calcitriol attenuated rotenone-induced neuroinflammation and autophagy dysfunction in PD rats through up-regulation of Sirt1 and LC3 and down-regulation of P62 and NF-κB expression levels. Thus, calcitriol could induce a neuro-protective and restorative effect in the rotenone-induced PD model by modulating autophagy and Sirt1/NF-κB pathway.

10.
Cells ; 11(16)2022 08 11.
Article in English | MEDLINE | ID: mdl-36010575

ABSTRACT

Long-term use of Glucocorticoids produces skeletal muscle atrophy and microvascular rarefaction. Hydrogen sulfide (H2S) has a potential role in skeletal muscle regeneration. However, the mechanisms still need to be elucidated. This is the first study to explore the effect of Sodium hydrosulfide (NaHS) H2S donor, against Dexamethasone (Dex)-induced soleus muscle atrophy and microvascular rarefaction and on muscle endothelial progenitors and M2 macrophages. Rats received either; saline, Dex (0.6 mg/Kg/day), Dex + NaHS (5 mg/Kg/day), or Dex + Aminooxyacetic acid (AOAA), a blocker of H2S (10 mg/Kg/day) for two weeks. The soleus muscle was examined for contractile properties. mRNA expression for Myostatin, Mechano-growth factor (MGF) and NADPH oxidase (NOX4), HE staining, and immunohistochemical staining for caspase-3, CD34 (Endothelial progenitor marker), vascular endothelial growth factor (VEGF), CD31 (endothelial marker), and CD163 (M2 macrophage marker) was performed. NaHS could improve the contractile properties and decrease oxidative stress, muscle atrophy, and the expression of NOX4, caspase-3, Myostatin, VEGF, and CD31 and could increase the capillary density and expression of MGF with a significant increase in expression of CD34 and CD163 as compared to Dex group. However, AOAA worsened the studied parameters. Therefore, H2S can be a promising target to attenuate muscle atrophy and microvascular rarefaction.


Subject(s)
Hydrogen Sulfide , Microvascular Rarefaction , Animals , Caspase 3 , Dexamethasone/adverse effects , Hydrogen Sulfide/metabolism , Hydrogen Sulfide/pharmacology , Macrophages/metabolism , Muscular Atrophy , Myostatin , NADPH Oxidase 4 , NADPH Oxidases , Rats , Vascular Endothelial Growth Factor A
11.
Ann Med ; 54(1): 1938-1951, 2022 12.
Article in English | MEDLINE | ID: mdl-35801810

ABSTRACT

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.


Subject(s)
Epilepsy , NAV1.1 Voltage-Gated Sodium Channel , Epilepsy/drug therapy , Epilepsy/genetics , Humans , NAV1.1 Voltage-Gated Sodium Channel/genetics , NAV1.2 Voltage-Gated Sodium Channel/genetics , NAV1.3 Voltage-Gated Sodium Channel/genetics , Polymorphism, Genetic , Prognosis , Saudi Arabia , Sodium Channels/genetics , Voltage-Gated Sodium Channel beta-1 Subunit/genetics
12.
J Integr Neurosci ; 21(1): 21, 2022 Jan 28.
Article in English | MEDLINE | ID: mdl-35164457

ABSTRACT

The current study investigated the effects of stevia extracts on a PTZ-induced epileptic rat model and its potential mechanism. Thirty male Sprague-Dawley rats were equally subdivided into 3 groups; (1) normal control (NC) group, (2) PTZ-group: received PTZ (50 mg/kg, i.p. every other day) for 2 weeks, and (3) PTZ+ Stevia group: received PTZ and stevia (200 mg/kg orally daily) for 4 weeks (2 weeks before the start of PTZ treatment and 2 weeks with PTZ administration). The first jerk latency and the seizure score were assessed in rats. Also, brain tissue samples were collected by the end of the experiment, and oxidative stress markers (catalase, MDA, and total antioxidant capacity (TAC)) were measured by biochemical analysis in hippocampal brain homogenates. Also, in the hippocampus, the expression of IL6 and Bcl-2 at the mRNA level and expression of Sirt-1, P53, caspase-3, GFAP, and NF-kB in CA3 hippocampal region by immunohistochemistry was investigated. PTZ substantially increased the seizure score and decreased the seizure latency. Also, PTZ significantly increased MDA, GFAP, IL-6, NF-kB, caspase-3, and p53 and significantly reduced Sirt-1, TAC, and Bcl-2 in hippocampal tissues compared to the control group (p < 0.01). However, Stevia Rebaudiana Bertoni (Stevia R.) significantly attenuated the PTZ-induced seizures, improved oxidative stress markers, downregulated GFAP, IL-6, NF-kB, caspase-3, and p53, and upregulated Sirt-1 and Bcl-2 in the CA3 hippocampal region (p < 0.01). In conclusion, Stevia R. exhibits neuroprotective and antiepileptic actions in PTZ-induced epilepsy due to its antioxidant, anti-apoptotic, and anti-inflammatory effects. Additionally, the Sirt-1 pathway might be involved in the antiepileptic and neuroprotective effects of stevia in PTZ-kindled epileptic rat model.


Subject(s)
Anticonvulsants/pharmacology , Antioxidants/pharmacology , Epilepsy/drug therapy , Hippocampus/drug effects , Neuroinflammatory Diseases/drug therapy , Plant Extracts/pharmacology , Stevia , Animals , Anticonvulsants/administration & dosage , Antioxidants/administration & dosage , Apoptosis , Convulsants/pharmacology , Disease Models, Animal , Epilepsy/chemically induced , Epilepsy/immunology , Epilepsy/metabolism , Hippocampus/immunology , Hippocampus/metabolism , Male , Neuroinflammatory Diseases/immunology , Neuroinflammatory Diseases/metabolism , Pentylenetetrazole/pharmacology , Plant Extracts/administration & dosage , Rats , Rats, Sprague-Dawley , Sirtuin 1/drug effects , Sirtuin 1/metabolism
13.
Cells ; 10(9)2021 09 18.
Article in English | MEDLINE | ID: mdl-34572126

ABSTRACT

Autophagy is a key metabolic process where cells can recycle its proteins and organelles to regenerate its own cellular building blocks. Chemotherapy is indispensable for cancer treatment but associated with various side-effects, including organ damage. Stem cell-based therapy is a promising approach for reducing chemotherapeutic side effects, however, one of its main culprits is the poor survival of transplanted stem cells in damaged tissues. Here, we aimed to test the effects of activating autophagy in adipose-derived mesenchymal stem/stromal cells (ADSCs) on the survival of ADSCs, and their therapeutic value in cisplatin-induced liver injury model. Autophagy was activated in ADSCs by rapamycin (50 nM/L) for two hours before transplantation and were compared to non-preconditioned ADSCs. Rapamycin preconditioning resulted in activated autophagy and improved survival of ADSCs achieved by increased autophagosomes, upregulated autophagy-specific LC3-II gene, decreased protein degradation/ubiquitination by downregulated p62 gene, downregulated mTOR gene, and finally, upregulated antiapoptotic BCL-2 gene. In addition, autophagic ADSCs transplantation in the cisplatin liver injury model, liver biochemical parameters (AST, ALT and albumin), lipid peroxidation (MDA), antioxidant profile (SOD and GPX) and histopathological picture were improved, approaching near-normal conditions. These promising autophagic ADSCs effects were achieved by modulation of components in TGF-ß1/Smad and PI3K-AKT signaling pathways, besides reducing NF-κB gene expression (marker for inflammation), reducing TGF-ß1 levels (marker for fibrosis) and increasing SDF-1 levels (liver regeneration marker) in liver. Therefore, current results highlight the importance of autophagy in augmenting the therapeutic potential of stem cell therapy in alleviating cisplatin-associated liver damage and opens the path for improved cell-based therapies, in general, and with chemotherapeutics, in particular.


Subject(s)
Autophagy , Chemical and Drug Induced Liver Injury, Chronic/prevention & control , Mesenchymal Stem Cells/cytology , Phosphatidylinositol 3-Kinases/metabolism , Proto-Oncogene Proteins c-akt/metabolism , Smad Proteins/metabolism , Stem Cell Transplantation/methods , Transforming Growth Factor beta1/metabolism , Animals , Antineoplastic Agents/toxicity , Chemical and Drug Induced Liver Injury, Chronic/etiology , Chemical and Drug Induced Liver Injury, Chronic/metabolism , Chemical and Drug Induced Liver Injury, Chronic/pathology , Cisplatin/toxicity , Female , Male , Phosphatidylinositol 3-Kinases/genetics , Proto-Oncogene Proteins c-akt/genetics , Rats , Rats, Sprague-Dawley , Smad Proteins/genetics , Transforming Growth Factor beta1/genetics
14.
J Histochem Cytochem ; 69(9): 575-596, 2021 09.
Article in English | MEDLINE | ID: mdl-34448436

ABSTRACT

Non-alcoholic steatohepatitis (NASH) is a worldwide health problem. Alternate-day fasting (ADF), although thought to be aggressive, has proven safety and efficacy. We aimed to evaluate the effect of short-term ADF against already established high-fat-fructose (HFF)-induced NASH, independent of the amount of calorie intake, and to study the effect of ADF on lipogenesis, apoptosis, and hepatic inflammation. Male Sprague Dawley rats were divided into two groups: (1) negative control and (2) NASH group fed on HFF for 9 weeks, and then randomized into two subgroups of either HFF alone or with ADF protocol for 3 weeks. The ADF could improve HFF-related elevation in serum lactate dehydrogenase and could decrease the mRNA expression of lipogenesis genes; acetyl CoA carboxylase, peroxisome proliferator-activated receptor γ, and peroxisome proliferator-activated receptor α; apoptotic genes caspase-3, p53, and inflammatory cyclo-oxygenase 2; and immunohistochemical staining for their proteins in liver with upregulation of LC3 and downregulation of P62 immunoexpression. Moreover, ADF ameliorated HFF-induced steatosis, inflammation, ballooning, and fibrosis through hematoxylin and eosin, Oil Red O, and Sirius Red staining, confirmed by morphometric analysis, without significant weight loss. Significant correlation of morphometric parameters with levels of gene expression was found. These findings suggest ADF to be a safe effective therapeutic agent in the management of NASH.


Subject(s)
Eating , Fasting , Inflammation/metabolism , Non-alcoholic Fatty Liver Disease/metabolism , Animals , Apoptosis , Autophagy , Biomarkers/metabolism , Lipogenesis , Male , Rats , Rats, Sprague-Dawley
15.
J Mol Histol ; 52(4): 781-798, 2021 Aug.
Article in English | MEDLINE | ID: mdl-34046766

ABSTRACT

Vigabatrin is the drug of choice in resistant epilepsy and infantile spasms. Ataxia, tremors, and abnormal gait have been frequently reported following its use indicating cerebellar involvement. This study aimed, for the first time, to investigate the involvement of necroptosis and apoptosis in the VG-induced cerebellar cell loss and the possible protective role of combined omega-3 and vitamin B12 supplementation. Fifty Sprague-Dawley adult male rats (160-200 g) were divided into equal five groups: the control group received normal saline, VG200 and VG400 groups received VG (200 mg or 400 mg/kg, respectively), VG200 + OB and VG400 + OB groups received combined VG (200 mg or 400 mg/kg, respectively), vitamin B12 (1 mg/kg), and omega-3 (1 g/kg). All medications were given daily by gavage for four weeks. Histopathological changes were examined in H&E and luxol fast blue (LFB) stained sections. Immunohistochemical staining for caspase-3 and receptor-interacting serine/threonine-protein kinase-1 (RIPK1) as well as quantitative real-time polymerase chain reaction (qRT-PCR) for myelin basic protein (MBP), caspase-3, and receptor-interacting serine/threonine-protein kinase-3 (RIPK3) genes were performed. VG caused a decrease in the granular layer thickness and Purkinje cell number, vacuolations, demyelination, suppression of MBP gene expression, and induction of caspases-3, RIPK1, and RIPK3 in a dose-related manner. Combined supplementation with B12 and omega-3 improved the cerebellar histology, increased MBP, and decreased apoptotic and necroptotic markers. In conclusion, VG-induced neuronal cell loss is dose-dependent and related to both apoptosis and necroptosis. This could either be ameliorated (in low-dose VG) or reduced (in high-dose VG) by combined supplementation with B12 and omega-3.


Subject(s)
Anticonvulsants/adverse effects , Caspase 3/metabolism , Cerebellar Diseases/chemically induced , Receptor-Interacting Protein Serine-Threonine Kinases/metabolism , Vigabatrin/adverse effects , Animals , Apoptosis , Caspase 3/genetics , Cerebellar Diseases/drug therapy , Cerebellar Diseases/metabolism , Cerebellar Diseases/pathology , Dose-Response Relationship, Drug , Fatty Acids, Omega-3/administration & dosage , Gene Expression Regulation/physiology , Male , Myelin Basic Protein/genetics , Necroptosis , RNA, Messenger/genetics , Rats , Rats, Sprague-Dawley , Real-Time Polymerase Chain Reaction , Receptor-Interacting Protein Serine-Threonine Kinases/genetics , Vitamin B 12/administration & dosage
16.
Life Sci ; 273: 119297, 2021 May 15.
Article in English | MEDLINE | ID: mdl-33689686

ABSTRACT

Stress-induced gastritis is a common problem in the intensive care unit. Zeaxanthin (ZE), a non-provitamin A carotenoid has been known to exert antioxidant and anti-inflammatory effects. In this study, we examined the effect of ZE on water avoidance stress (WAS)-induced gastritis in rats. 24 Sprague' Dawley male rats were divided into four groups; control, ZE, WAS and WAS+ZE. In the stressed rats, treatment with ZE effectively downregulated the gastric levels of total oxidant status (TOS), myeloperoxidase (MPO) and malondialdehyde (MDA), with significant upregulation of the antioxidant enzymes' activities and gastric levels of prostagladin-E2 (PGE2) as compared to the untreated stressed one. As noticed in the present study, ZE significantly decrease the gastric levels of interleukin-1 ß (IL-1ß) and IL-6 as well as suppression of nuclear transcription factor kappa-B (NF-κB) immunohistochemical expression together with upregulation of trefoil factor-1 (TFF-1) gene expression. Moreover, in the untreated WAS-induced gastritis group, gastrin and corticosterone levels were significantly increased together with upregulation of the gene expression of hypoxia inducible factor-1α (HIF-1α), matrix metalloproteinase-9 (MMP-9), PI3K, Akt and JNK in the gastric tissues, which significantly improved by ZE administration. These all positive effects of ZE reflected on reduction of microscopic gastric mucosal damage and inflammatory cell infiltration with improvement of ulcer score. Our results discover that ZE has a new gastroprotective effect against stress-induced gastritis in rats, primarily through its antioxidative and anti-inflammatory effects, which are expressed in the regulation of the MMP-9 and HIF-1α signaling pathways.


Subject(s)
Biomarkers/analysis , Gastritis/drug therapy , Gene Expression Regulation/drug effects , Protective Agents/pharmacology , Stress, Physiological , Zeaxanthins/pharmacology , Animals , Antioxidants/metabolism , Cytokines/metabolism , Gastritis/etiology , Gastritis/metabolism , Gastritis/pathology , Hypoxia-Inducible Factor 1, alpha Subunit/genetics , Hypoxia-Inducible Factor 1, alpha Subunit/metabolism , MAP Kinase Kinase 4/genetics , MAP Kinase Kinase 4/metabolism , Male , Matrix Metalloproteinase 9/genetics , Matrix Metalloproteinase 9/metabolism , Oxidative Stress , Phosphatidylinositol 3-Kinases/genetics , Phosphatidylinositol 3-Kinases/metabolism , Proto-Oncogene Proteins c-akt/genetics , Proto-Oncogene Proteins c-akt/metabolism , Rats , Rats, Sprague-Dawley , Trefoil Factor-1/genetics , Trefoil Factor-1/metabolism
17.
Ann Anat ; 234: 151626, 2021 Mar.
Article in English | MEDLINE | ID: mdl-33144268

ABSTRACT

BACKGROUND: Non-alcoholic fatty liver disease (NAFLD) is a worldwide disease that progresses into steatohepatitis (NASH) that has no current effective treatment. This study aimed, for the first time, to investigate the effect of Dasatinib; a tyrosine kinase inhibitor showing anti-PDGFR activity with a macrophage modulating efficacy, on NASH. METHODS: NASH was induced, in C57BL/6 mice by western diet (WD). Control groups received either DMSO or Dasatinib. After 12 weeks, WD-fed mice received DMSO, Dasatinib (4 mg/kg) or Dasatinib (8 mg/kg) once daily, for four weeks. Serum was examined for ALT and lipid profile. Immunohistochemical staining for SREBP1 (lipogenesis marker), iNOS, arginase-1, CD68, CD163 (macrophage polarization markers), TGF-ß (fibrosis marker) and ASMA (a marker for activated hepatic stellate cell), hepatic mRNA expression for SREBP-1, iNOS, arginase-1, TGF-ß and PDGFA genes; and western blotting for phosphorylated PDGFR α and ß, SREBP1, iNOS, arginase-1, IL1α, COX2, TGF-ß and ASMA were performed. Liver sections were stained also for H & E, Oil red O and Sirius red. RESULTS: Dasatinib could ameliorate the WD-induced disturbance of serum ALT, lipid profile and significantly reduced hepatic expression of PDGFA, phosphorylated PDGFR α and ß, IL1α, COX2, SREBP-1, iNOS, CD68, TGF-ß and ASMA but increased expression for arginase-1 and CD163 (M2 macrophage markers). Moreover, Dasatinib reduced the steatosis, inflammation, hepatocellular ballooning, hepatic fibrosis and the high NAFLD activity scoring induced by WD. CONCLUSION: Dasatinib can prevent the progression of WD-induced NASH by attenuating lipogenesis, and inducing M2 macrophage polarization with antifibrotic activity.


Subject(s)
Diet, Western , Non-alcoholic Fatty Liver Disease , Animals , Dasatinib , Liver , Mice , Mice, Inbred C57BL , Non-alcoholic Fatty Liver Disease/drug therapy
18.
Ultrastruct Pathol ; 43(6): 290-300, 2019.
Article in English | MEDLINE | ID: mdl-31791174

ABSTRACT

Background and objectives: Hepatocyte ultra-structure is influenced by feeding status, circadian rhythm, and zone location. The goal of the present study was to study the effect of overnight fasting on the hepatocyte ultrastructure and the zonal heterogeneity and to discuss the functional correlation.Methods: A total of 14 male albino rats were divided into two groups: negative control group fed ad libitum and overnight fasting rats for 16 hours. The different subcellular structures of both centrilobular and periportal hepatocytes in both control and fasted groups were compared by transmission electron microscopy. Morphometric analysis of the electron micrographs was also done using imageJ software.Results: The lysosomes surface density, mitochondrial volume and surface densities were significantly higher in periportal hepatocytes however surface density of smooth endoplasmic reticulum (SER) and peroxisomes were significantly higher in centrilobular hepatocytes of the control group. Fasting caused a significant decrease in the surface density of rough endoplasmic reticulum and glycogen volume density but with significant increase in SER surface density with more mitochondrial fusion and stronger mitochondrial ER contacts, isolation membranes, and autophagosomes. The zonal differences were maintained after fasting. The organelles appeared normal with no signs of degeneration.Conclusion: The organelles appeared normal with no signs of degeneration and the zonal differences were maintained after fasting. The change in hepatocyte ultrastructure after fasting may be related to autophagy.


Subject(s)
Fasting , Hepatocytes/ultrastructure , Animals , Liver/ultrastructure , Male , Microscopy, Electron, Transmission , Rats
19.
Gen Physiol Biophys ; 38(6): 545-556, 2019 Nov.
Article in English | MEDLINE | ID: mdl-31588916

ABSTRACT

Vascular dysfunctions in chronic kidney disease (CKD) include endothelial dysfunctions and vascular calcification (VC). In the present study, we examined the possible protective effect of nicorandil (potassium channel opener) on renal and vascular dysfunctions in a rat model of adenine-induced nephropathy and its underlying mechanisms. Thirty-four male Sprague-Dawley rats were randomly allocated into 3 groups: Control group, Adenine group (animals received high-adenine diet for 4 weeks), and Nicorandil group (animals received adenine for 4 weeks and nicorandil 1 mg/kg per oral for 4 weeks). The results showed significant reduction in the body weight, heart rate (HR), hemoglobin contents, serum Ca2+ and reduction in the expression of mRNA of endothelial nitric oxide synthase (eNOS) and nuclear factor erythroid related factor 2 (nrf2) genes in aortic tissues with significant increase in arterial blood pressure (ABP), serum creatinine, blood urea nitrogen (BUN), plasma renin activity (PRA), K+ and phosphate (PO43-), urinary albumin excretion (UAE) and aortic VC in Adenine group compared to normal group (p < 0.05). On the other hand, coadminsitration of nicorandil caused significant improvement in the studied parameters compared to Adenine group (p < 0.05). We concluded that nicorandil has a potential protective effect against the vascular and renal impairment induced by adenine, which might be due to attenuation of vascular calcifications, activation of Nrf2 and eNOS genes in aortic tissues.


Subject(s)
Renal Insufficiency, Chronic , Adenine , Animals , Kidney , Male , Nicorandil , Rats , Rats, Sprague-Dawley
SELECTION OF CITATIONS
SEARCH DETAIL