When Should a Brain MRI Be Performed in Children with New-Onset Seizures? Results of a Large Prospective Trial.

BACKGROUND AND PURPOSE: There is a paucity of data regarding the incidence of structural brain lesions in children with new-onset unprovoked seizures. Our aim was to determine the frequencies and types of epileptogenic lesions detected on a dedicated epilepsy protocol MR imaging according to age group, the presence of developmental delay, and the number and types of seizures. MATERIALS AND METHODS: Consecutive children between 6 months and 18 years of age with new-onset unprovoked seizures were included. The frequencies and types of epileptogenic lesions were determined and then stratified according to sex, age groups, the presence of developmental delay, and the number and types of seizures at presentation. Multivariate analysis was used to identify variables significantly associated with the presence of epileptogenic lesions. RESULTS: One thousand children were included. An epileptogenic lesion was identified in 26%, with malformations of cortical development being the most common lesion (32%), followed by hypoxic-ischemic injury (20%) and vascular etiologies (16%). Univariate analysis showed a significant increase in the frequency of epileptogenic lesions with decreasing age, the presence of developmental delay, and the number and types of seizures at presentation. The presence of developmental delay and seizure type at presentation remained significant in a multivariate analysis. CONCLUSIONS: We documented a relatively high rate of epileptogenic lesions in children with new-onset seizures, with the presence of developmental delay and specific seizure types being associated with a higher likelihood of detecting an epileptogenic lesion on neuroimaging. This study fulfills the requirements of the study design recommended by the Practice Committee of the American Academy of Neurology, and we hope that our results will assist the relevant societies and committees in formulating neuroimaging guidelines for children with new-onset seizures.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

[Bilateral frontal polymicrogyria and Ehlers-Danlos syndrome]. / Polymicrogyrie bifrontale et syndrome d'Ehlers-Danlos.

The authors describe the case of a six-year-old girl with Ehlers-Danlos syndrome associated to bilateral symmetrical frontal polymicrogyria. Several extracellular matrix components, including collagen, are directly implicated in the neuronal migration. We think that a defect in collagen or in another extracellular matrix protein during fetal development could result in this association.