Molecular features of new Peach Latent Mosaic Viroid variants suggest that recombination may have contributed to the evolution of this infectious RNA.

Nucleotide sequences of a broad range of Peach Latent Mosaic Viroid (PLMVd) variants were determined. The variants were isolated from peach, pear, and almond tree samples collected in Tunisia. Sequence analysis confirmed the high variability of PLMVd, as no less than 119 new variants were identified. Variations included new polymorphic positions, insertions of 11 to 14 nucleotides, and new mutations within the hammerhead self-cleavage motifs. We provide the first covariation-based evidence for certain stems within the proposed secondary structure. Our covariation analysis also strengthens the view that a pseudoknot closes the replication domain. On the basis of phylogenetic tree studies and informative positions, PLMVd variants are proposed to cluster into groups and subgroups likely to have resulted from recombination events. PLMVd thus emerges as a suitable viroid for retracing the evolution of an RNA genome.

Detection and epidemiological characteristics of peach latent mosaic viroid in Tunisia.

A rapid and sensitive assay was developed for the detection and identification of Peach latent mosaic viroid (PLMVd) by reverse transcription-polymerase chain reaction (RT-PCR) in infected tissues from Tunisian orchards. The test was initially performed by using total RNA preparations from selected isolates and then applied on total RNA preparations from leaf or bark tissues of fruit trees collected in 2003 in 20 orchards in the North of Tunisia and the Sahel. PLMVd occurred in peach and pear trees. The identity of the detected viroid was confirmed by comparison of its sequence with other isolates previously characterized. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues are identical to those obtained from total RNA preparations. Epidemiological characteristics of PLMVd on peach trees have been investigated. A survey of peach trees was carried out in 32 orchards in May 2004. The obtained results showed that (1) PLMVd is highly and equally present in several regions of the north of Tunisia rather than the central, the Sahel and the southern regions, (2) infection percentage increases with the age of the tree and (3) the studied cultivars are classified into three groups of sensitivity.

First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia.

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.