Divergent molecular and growth responses of young "Cabernet Sauvignon" (Vitis vinifera) plants to simple and mixed infections with Grapevine rupestris stem pitting-associated virus.

Grapevine rupestris stem pitting associated virus (GRSPaV) is one of the most widely distributed viruses; even so, little is known about its effect on Vitis vinifera. To provide new insights, the effects of single and mixed GRSPaV infections on the V. vinifera cultivar "Cabernet Sauvignon" were studied by evaluating growth parameters, such as measurements of the total plant length, the number and distance of internodes and the number of leaves per shoot. In addition, parameters relating to gas exchange, i.e., the stomatal conductance, net photosynthetic rate, internal CO2 concentration and leaf transpiration, were also assessed. All the measurements were performed in one- and two-year-old plants with a single GRSPaV infection or mixed infections of GRSPaV and Grapevine fanleaf virus (GFLV). The results show that the plant phytosanitary status did not significantly alter the growth and gas exchange parameters in one-year-old plants. However, in two-year-old plants, single GRSPaV infections increased shoot elongation, which was accompanied by the overexpression of genes associated with the gibberellic acid response pathway. The gas exchange parameters of these plants were negatively affected, despite exhibiting higher LHCII gene expression. Plants with mixed infections did not have modified growth parameters, although they presented a greater reduction in the primary photosynthetic parameters evaluated with no change in LHCII expression. The results presented here confirm the co-evolution hypothesis for V. vinifera and GRSPaV during the early stages of plant development, and they provide new evidence about the effects of GRSPaV and GFLV co-infections on the "Cabernet Sauvignon" cultivar.

Absence of Transovarial Transmission of 'Candidatus Phytoplasma ulmi' in the Vector Amplicephalus curtulus Linnavuori & DeLong (Hemiptera: Cicadellidae): Is It a Rule More Than an Exception?

'Candidatus Phytoplasma ulmi' (Elm yellows, 16SrV-A), transmitted by Amplicephalus curtulus Linnavuori & DeLong (Hemiptera: Cicadellidae), has been found in native Chilean plants, and transovarial transmission has been considered as a possible form of transmission. An analysis to detect the presence of 'Ca. Phytoplasma ulmi' and other phytoplasmas in A. curtulus eggs, nymphs of the first and fifth instars were carried out in two experiments using nested PCR and DNA sequencing. The first experiment showed the natural acquisition of phytoplasma by adult females, and the second demonstrated the acquisition of phytoplasma in controlled conditions. Results showed that eggs and the first and fifth instars were not positive for phytoplasmas in nested PCR. 'Candidatus Phytoplasma ulmi' was detected and identified on average 10 and 47% of the adult females used in experiments 1 and 2, respectively. Other phytoplasma (X-disease group) was also found in adult females used in the experiment 1. We demonstrate that although gravid females contain phytoplasmas, they are not able to transmit them to their progeny, confirming that transovarial transmission of 'Ca. Phytoplasma ulmi' does not occur in A. curtulus.

First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America.

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

17ß-Estradiol (E-2) administration to male (NZB × SWR)F1 mice results in increased Id(LN)F1-reactive memory T-lymphocytes and accelerated glomerulonephritis.

While it has been shown that estradiol treatment accelerates the onset of lupus nephritis with autoantibody production and kidney damage in both male and female lupus-prone mice, the specific mechanism(s) involved are unknown. Our previous work has shown that alterations in Id(LN)F(1)-reactive T cells and Id(LN)F(1)+ antibodies correlated closely with the onset of autoimmune nephritis in female F(1) progeny of SWR and NZB (SNF(1)) mice, supporting a critical role for the Id(LN)F(1) idiotype in the development of disease. Since male SNF(1) mice normally do not develop nephritis, we tested whether administration of 17ß-estradiol (E-2) to male SNF(1) mice would increase Id(LN)F(1) IgG levels and autoreactive T cells, and further, induce nephritis. We found that E-2-treated male SNF(1) mice developed nephritis with the same time course and mean survival as normal female SNF(1) mice. Moreover, it appeared that the mechanism involved increased serum Id(LN)F(1)(+)IgG and its deposition in kidney glomeruli, preceded by a striking twofold increase in T-lymphocytes expressing the memory phenotype (CD44(+)CD45RB(lo)) predominantly in the Id(LN)F(1)-reactive T-cell population. In addition, we noted that cells with this phenotype were increased in the nephritic kidneys of treated mice, suggesting a direct involvement of those cells in the renal pathology. E-2 treatment also induced increased numbers of pathogenic Id(LN)F(1)+ antibody-producing B cells and elevated presentation of pathogenic Id(LN)F(1)+ peptide. Taken together, these results suggest a mechanism of E-2-induced acceleration of autoimmune disease in lupus-prone mice may involve expansion of autoreactive idiotypic T and B-cell populations.

Microgeographic variations in Burkitt's lymphoma incidence correlate with differences in malnutrition, malaria and Epstein-Barr virus.

BACKGROUND: Endemic Burkitt's lymphoma (eBL) has been associated with Epstein-Barr virus (EBV) and holoendemic Plasmodium falciparum malaria. But recent evidence suggests that other risk factors are involved. METHODS: We hypothesised that selenoprotein glutathione peroxidase (GPx), a surrogate of nutritional status, is an important biomarker for eBL risk. We measured plasma GPx, anthropometric markers of malnutrition, EBV viral loads and malaria parasitaemia in children aged 1-9 years (n=258) from two locations in Nyanza Province, Kenya, with higher-than-expected and lower-than-expected incidence of eBL. The study participants were malaria asymptomatic children from the community. RESULTS: Children from eBL high-incidence areas had significantly lower GPx levels, high EBV viral load and more evidence of chronic malnutrition than children from eBL low-incidence areas (all P<0.001). Additionally, GPx levels were significantly lower in children with the highest EBV viral load and for those with P. falciparum infections (P=0.035 and P=0.004, respectively). CONCLUSIONS: These results suggest that selenium deficiency may be a risk factor for eBL.

Phytoplasmas Associated with Grapevine Yellows Disease in Chile.

An extensive survey was performed from 2002 to 2006 to detect and identify phytoplasmas associated with Chilean grapevines. Nested polymerase chain reaction assays using phytoplasma universal primer pairs P1/P7 and R16F2n/R2 detected phytoplasmas in 34 out of the 94 samples tested (36%). Restriction fragment length polymorphism (RFLP) analyses, cloning, and sequencing allowed identification of phytoplasmas belonging to ribosomal subgroups 16SrI-B, 16SrI-C, 16SrVII-A, and 16SrXII-A. The 16SrVII-A phytoplasma represents a new finding in grapevine; moreover, variability of the RFLP profile was observed in some of the 16SrXII-A phytoplasmas, indicating possible new ribosomal subgroups. Mixed phytoplasma infections and infections of phytoplasmas together with one or more viruses also occurred.

First Detection of Grapevine leafroll-associated virus 4 in Chilean Grapevines.

Grapevine leafroll is one of the most widespread and economically relevant viral diseases of grapevines. At least nine distinct Grapevine leafroll-associated viruses (GLRaVs), all members of the Closteroviridae family, have been associated with this disease in grapevine. Grapevine leafroll-associated virus 4 (GLRaV-4), currently classified as a Closteroviridae member under the Ampelovirus genus, was initially described in California. To determine if GLRaV-4 was present in Chilean grapevines, in addition to the previously reported GLRaV-1, -2, -3, -7, and -9 (1,2), 35 dormant cane samples from 12 different cultivars were collected from different regions of Chile and screened by reverse transcription-PCR. Two of the 35 samples (both cv. Thompson Seedless) collected from the III and VI regions of Chile were found to be infected with GLRaV-4 using two different pairs of GLRaV-4 specific primers. The first pair of primers, HSPV-F: 5'- ACA TTC TCC ACC TTG TGC TTT T -3' and HSPC-R: 5'- CAT ACA AGC GAG TGC AAT TAC -3' (3), was used to amplify a 321-bp fragment corresponding to a partial region of the HSP70h gene. The sequence (GenBank Accession Nos. EU746618 and EU746619) from both positive samples shared 98.4% nucleotide identity and approximately 99% identity with the corresponding fragment of a Californian GLRaV-4 isolate (GenBank Accession No. AF039553). Since there are no commercial antibodies available for GLRaV-4 detection, a second pair of primers, LR4CPINT-F: 5'- GAG AGT GAC AAG CAC CAG GTG C -3' and LR4CPFIN-R: 5'- TCA CCT CCT GTT GCC CA -3' (4), that amplified a 492-bp fragment of the coat protein gene was also used. The sequences of the 492-bp fragment from both Chilean samples (GenBank Accession Nos. EU746620 and EU746621) shared 99.6% nucleotide identity with one another and had 96.5% identity with an Israeli GLRaV-4 isolate (GenBank Accession No. AM176759). To our knowledge, this is the first report of GLRaV-4 in Chile. Further studies will help to establish the effects and incidence of this virus in Chilean grapevines. References: (1) E. Engel et al. Plant Dis. 92:1252, 2008 (2) N. Fiore et al. J. Plant Pathol. 90:125, 2008. (3) F. Osman et al. J. Virol. Methods 141:22, 2007. (4) P. Saldarelli et al. J. Plant Pathol. 88:203, 2006.

Evaluation of perioperative cholangiography in one thousand laparoscopic cholecystectomies.

We analyzed a teaching institution's experience with intra-operative cholangiography (IOCG) and endoscopic retrograde cholangiopancreatography (ERCP) and established an algorithm for their timing and use. The records of all patients undergoing LC during a five year period were reviewed. Patients with a history of jaundice or pancreatitis, abnormal bilirubin, alkaline phosphatase, serum glutamic-oxaloacetic transaminase, or radiographic evidence suggestive of choledocholithiasis were considered "at risk" for common bile duct stones (CBDS). The remaining patients were considered to be at low "risk." LC was attempted on 1002 patients during the study period and successfully completed on 941 (94% of the time). The major complication rate was 3.1% and the common bile duct injury rate 0.1%. Eighty eight (9.5%) patients underwent ERCP, 67 in the preoperative period and 19 in the postoperative period. IOCG was attempted in 272 (24%) patients and completed in 234 for a success rate of 86%. Intraoperative cholangiography (IOCG) and preoperative endoscopic retrograde cholangiopancreatography (ERCP) were equivalent in the detection of CBDSs Twelve of the 21 patients (57%) with IOCG positive for stones underwent successful laparoscopic clearance of the common duct, and did not require postop. ERCP. No patients were converted to an open procedure for common bile duct exploration. Because postoperative ERCP was 100% successful in clearing the common duct, reoperation for retained common bile duct stones was not necessary. IOCG is an alternative procedure to ERCP for patients at risk with biochemical, radiological, or clinical evidence of choledocholithiasis. The incidence of CBDS in low-risk patients is 1.7%, a risk that does not warrant routine cholangiography. Preoperative ERCP is recommended in cases of cholangitis unresponsive to antibiotics, suspicion of carcinoma, and biliary pancreatitis unresponsive to supportive care. Although IOCG leads to a similar percentage of nontherapeutic studies as preoperative ERCP, it often allows for one procedure therapy.

Effects of interleukin-11 and epidermal growth factor on residual small intestine after experimental massive small bowel resection.

Interleukin 11 (IL-11) is a multifunctional cytokine derived from bone marrow, which has a trophic effect on small bowel epithelium. This study compares the effects of IL-11 with epidermal growth factor (EGF), a growth factor known to enhance small bowel adaptation. Forty Sprague-Dawley rats (90-100g) underwent an 85% mid-small bowel resection with primary anastomosis on day 0. Rats were divided into four treatment groups: controls (group I) received bovine serum albumin (BSA), group II received IL-11, 125 microg/kg subcutaneously (SC) twice daily, group III received EGF, 0,10 microg/g SC bid, and group IV received EGF and IL-11 in the above doses. Half of the animals (five per group) were killed on day 4 of therapy, and the rest on day 8. Animals were evaluated for weight, mucosal length, and bowel wall muscle thickness on days 4 and 8, and expression of proliferating cell nuclear antigen (PCNA) in intestinal crypt and smooth muscle cells on day 8. Body weight was similar at day 4 and 8. Mucosal thickness in groups 11 (IL-11) and IV (IL-11 and EGF) was significantly increased at day 4 and 8 compared with controls (group I) and EGF (group III, P<.001). Muscle thickness was significantly increased in the EGF and combined group IV compared with the BSA controls and IL-11 groups (P < .001). Thirty-two percent of the mucosal crypt cells in group I stained positive for PCNA, whereas 51%, 53%, and 60% stained positive in groups II (IL-11), III (EGF), and IV (IL-11 and EGF), respectively. In groups I and II, 2% and 1.7% of the myocytes stained positive for PCNA, whereas 11.2% and 5.2% in group III and IV. These data suggest that IL-11 has a trophic effect on small intestinal enterocytes, causing cell proliferation and increased mucosal thickness. EGF has a more generalized effect causing proliferation of both enterocytes and myocytes. IL-11, with or without EGF may be a useful adjunct in treatment of short bowel syndrome.

Biological Behavior and Partial Molecular Characterization of Six Chilean Isolates of Plum pox virus.

Plum pox virus (PPV) strain D was first detected in Chile in 1992 infecting Prunus trees including peaches, nectarines, apricots, and plums. Since then, quarantine efforts have included periodic surveys in the central zone of the country, the main region for stone fruit production. This work describes the characterization of six PPV isolates from this area of Chile, using biological and molecular approaches. PPV isolates were introduced into Prunus tomentosa and Nicotiana benthamiana hosts by grafting and mechanical inoculation, respectively. Symptoms were evaluated by following the appearance of circular necrotic spots and mosaic in leaves of P. tomentosa and mosaic and some leaf deformation in N. benthamiana. Molecular analysis was carried out using reverse transcription-polymerase chain reaction, allowing the cloning and sequencing of 1.34-kb fragments corresponding to the 3' region of the replicase gene, the complete coat protein (CP) gene, and the 3' nontranslated region of the PPV genome. Evolutionary distance analysis of these nucleotide sequences and their deduced coat protein amino acid sequences grouped the six Chilean isolates among strain D isolates, with closest genetic distances to those of Central Germany and Poland. Representative sources of these isolates suggest that strain D could be the only type of PPV currently present in Chile.

Differential effects of diethylstilbestrol and 2,3,7,8-tetrachlorodibenzo-p-dioxin on thymocyte differentiation, proliferation, and apoptosis in bcl-2 transgenic mouse fetal thymus organ culture.

Both the estrogenic drug diethylstilbestrol (DES) and the pervasive environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) inhibit thymocyte development. The mechanisms by which either agent induces thymic atrophy are still undetermined. We previously found that TCDD and DES inhibited C57BL/6 murine fetal thymocyte organ cultures (FTOC) at different stages of development. Now, using bcl-2 transgenic (TG) mice, we have further investigated their effects on FTOC proliferation, differentiation, maturation, and apoptosis. As with C57BL/6 mice, thymocyte development in C3H/bcl-2 FTOCs was inhibited by either TCDD (10 nM) or DES (20 microM) in both bcl-2 TG- and TG+ littermates. However, the percentage reduction of cell number induced by DES in bcl-2 TG+ FTOCs was significantly less than the level of inhibition in TG- FTOCs. There was no difference in the level of reduction from TCDD-exposed TG+ or TG- FTOC. Whereas TCDD increased production of mature CD8 cells in either strain, DES mainly yielded cells in the CD4(-)CD8(-)(DN) stage in TG- mice. The anti-apoptotic bcl-2 transgene overcame some DES blocking of DN thymocyte development, allowing more cells to differentiate into CD4 single-positive cells. Analysis of cell cycle showed that TCDD inhibited entry into S phase, whereas DES blocked cell cycling in the G2/M phase. TCDD did not induce detectable apoptosis in FTOC. However, unlike the effects of 17 beta-estradiol (E2) in vivo, DES induced apoptosis in the TG- FTOC, and these apoptotic cells were mainly in the DN subpopulation. This apoptosis could be prevented by the overexpression of bcl-2 in the TG+ mice. Our results demonstrate that, in addition to inhibition of fetal thymocytes at different stages of development by TCDD and DES, DES also induces thymic atrophy by both bcl-2-inhibitable apoptosis and by inducing cell cycle arrest in G2/M in the latest stage in the stem cell compartment. TCDD, on the other hand, does not induce apoptosis, but inhibits entry into cell cycle in the earliest stage in the stem cell compartment.

Estrogen receptor alpha is necessary in thymic development and estradiol-induced thymic alterations.

Estrogens affect the development, maturation, and function of multiple organ systems, including the immune system. One of the main targets of estrogens in the immune system is the thymus, which undergoes atrophy and phenotypic alterations when exposed to elevated levels of estrogen. To determine how estrogens influence the thymus and affect T cell development, estrogen receptor alpha (ERalpha) knockout (ERKO) mice were examined. ERKO mice have significantly smaller thymi than their wild-type (WT) littermates. Construction of ER radiation bone marrow chimeras indicated that the smaller thymi were due to a lack of ERalpha in radiation-resistant tissues rather than hemopoietic elements. ERKO mice were also susceptible to estradiol-induced thymic atrophy, but the extent of their atrophy was less than what was seen in WT mice. The estradiol-treated ERKO mice failed, however, to manifest alterations in their thymic CD4/CD8 phenotypes compared with WT mice. Therefore, ERalpha is essential in nonhemopoietic cells to obtain a full-sized thymus, and ERalpha also mediates some of the response of the thymus to elevated estrogen levels. Finally, these results suggest that in addition to ERalpha, another receptor pathway is involved in estradiol-induced thymic atrophy.

Overexpression of the anti-apoptotic oncogene, bcl-2, in the thymus does not prevent thymic atrophy induced by estradiol or 2,3,7, 8-tetrachlorodibenzo-p-dioxin.

Dexamethasone (Dex), estradiol (E2), and 2,3,7, 8-tetrachlorodibenzo-p-dioxin (TCDD) all affect the immune system, causing immunosuppression and thymic atrophy. It is still uncertain how and where these compounds act to induce thymic atrophy. However, it has been suggested that these compounds may have similar actions and targets, i.e., apoptosis of immature thymocytes for Dex and TCDD and preferential targeting of double-positive cells by Dex and E2. The lckpr-bcl-2 transgenic mouse has been shown to be protected against Dex-induced thymic atrophy. We used this murine model to determine if bcl-2 expression would also protect against E2- and TCDD-induced thymic atrophy. Our results indicate that, although the bcl-2 transgenic (TG+) mice were fully protected from atrophy induced by a single dose of Dex, atrophy was still induced in these mice following treatment with E2 or TCDD. Phenotypic analysis of thymocytes from TG- and TG+ mice also showed distinct consequences of atrophy induced by Dex, E2, and TCDD. Finally, since there are alternative pathways for apoptosis that are bcl-2 independent, both TG- and TG+ thymocytes were examined directly for indications of apoptosis using the TUNEL assay. After TCDD and E2 treatment there were no detectable signs of apoptosis in either TG- or TG+ mice even at early time points and at elevated dose levels. These results indicate that there are distinct mechanisms for the actions of Dex, E2, and TCDD in the thymus and that apoptosis is not a key mechanism of E2- and TCDD-induced thymic atrophy.

Chordoma of the lumbar L2 vertebra: case report and review of the literature.

We report four new cases of chordoma of "the mobile spine", all at the L2 level. Diagnosis was often delayed due to predominantly nonspecific low back symptoms; however, neurological involvement is more frequent than in chordoma with a sacrococcygeal localization. No pathognomonic images have been described for any imaging modality, and differential diagnosis should include metastases, chondrosarcoma, and giant-cell tumor. Histopathological analysis can be performed on CT-guided puncture biopsy samples, but a high level of suspicion must be present and, if there is any doubt, immunohistochemical studies should be carried out. Despite being the treatment of choice, complete tumor resection by a double-approach spondylectomy is barely feasible at the L2 level.

2,3,7,8-Tetrachlorodibenzo-p-dioxin and diethylstilbestrol affect thymocytes at different stages of development in fetal thymus organ culture.

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and estrogen induce thymic atrophy and alter thymocyte development. In the present study we investigate whether TCDD and the synthetic estrogen diethylstilbestrol (DES) alter intrathymic development by the same or different mechanisms. We compared the effects of TCDD and DES on thymocyte development in fetal thymus organ culture (FTOC) and found that both compounds caused a reduction in cell yield. TCDD- and DES-treated FTOCs yielded fewer CD4 + CD8+ double-positive cells. However TCDD treatment also led to a greater percentage of cells in the CD8+ single-positive compartment. At lower dioxin concentrations, our results demonstrated an actual increase in CD8+ cells, whereas DES-treated fetal thymocytes were mainly enriched in CD4-CD8- double-negative cells. More alpha beta-TCR+ positive cells were seen in TCDD- but not in DES-exposed cultures. Furthermore, in this study we found that TCDD and DES also alter intrathymic development at different stages in the CD4-CD8- double-negative compartment. TCDD induced a relative increase in c-kit + CD44 + CD25-HSA-thymocytes, while DES induced an relative increase in c-kit-CD44-CD25 + HSA+ cells. RT-PCR revealed that TCDD reduced RAG-1, RAG-2, and TdT gene expression in the CD4-CD8- double-negative thymocytes. Co-treatment by TCDD and DES in FTOC yielded a mixture of effects induced by each agent. Taken together, our results demonstrate that TCDD and DES affect thymocytes at different stages of development, suggesting distinct mechanisms for induction of thymic atrophy.

Thymic alterations induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin are strictly dependent on aryl hydrocarbon receptor activation in hemopoietic cells.

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related congeners affect the immune system, causing immunosuppression and thymic atrophy in a variety of animal species. TCDD is believed to exert its effects primarily through the ligand-activated transcription factor, the aryl hydrocarbon receptor (AhR). Although the AhR is found at high levels in both thymocytes and thymic stroma, it is uncertain in which cells TCDD is activating the AhR to cause alterations in the thymus. Some investigators have suggested that stromal elements, primarily epithelial cells, within the thymus are the primary targets for TCDD. Others have suggested that atrophy is due to a direct effect on thymocytes, either by apoptosis or by altering the development of progenitor cells. By producing chimeric mice with TCDD-responsive (AhR[+/+]) stromal components and TCDD-unresponsive (AhR[-/-]) hemopoietic components, or the reverse, we have clarified the role of stromal vs hemopoietic elements in TCDD-induced thymic alterations. Our results show that the targets for TCDD-induced thymic atrophy and phenotypic alterations are strictly in the hemopoietic compartment and that TCDD activation of epithelial cells in the stroma is not required for thymic alterations. Furthermore, changes observed in the putative stem cell populations of these chimeric mice are also dependent on TCDD activation of the AhR in hemopoietic elements.

Comparison of interleukin-11 and epidermal growth factor on residual small intestine after massive small bowel resection.

BACKGROUND/PURPOSE: Interleukin-11 (IL-11) is a multifunctional cytokine derived from bone marrow, which has a trophic effect on small bowel epithelium. This study compares the effects of IL-11 with epidermal growth factor (EGF), a growth factor known to enhance small bowel adaptation. METHODS: Forty Sprague-Dawley rats (90 to 100 g) underwent an 85% mid-small bowel resection with primary anastomosis on day 0. Rats were divided into four treatment groups: controls (group I) received bovine serum albumin (BSA), group II received IL-11, 125 microg/kg subcutaneously (SC) twice daily, group III received EGF, 0.10 microg/g SC bid, and group IV received EGF and IL-11 in the above doses. Half of the animals (five per group) were killed on day 4 of therapy, and the rest were killed on day 8. Animals were evaluated for weight, mucosal length, and bowel wall muscle thickness on days 4 and 8, and expression of proliferating cell nuclear antigen (PCNA) in intestinal crypt and smooth muscle cells on day 8. RESULTS: There were two deaths; both were 8-day controls. Body weight was similar at day 4 and day 8. Mucosal thickness in groups II (IL-11) and group IV (IL-11 and EGF) was significantly increased at day 4 and 8 when compared with controls (group I) and EGF (group III, P < .001). Muscle thickness was significantly increased in the EGF and combined group IV compared with the BSA controls and IL-11 groups (P < .001). Thirty-two percent of the mucosal crypt cells in Group I stained positive for PCNA, whereas 51%, 53%, and 60% stained positive in groups II (IL-11), III (EGF), and IV (IL-11 and EGF), respectively. In groups I and II, 2% and 1.7% of the myocytes stained positive for PCNA, whereas 11.2% and 5.2% of the myocytes in group III and IV stained positive. CONCLUSIONS: These data suggest that IL-11 has a trophic effect on small intestinal enterocytes, causing cell proliferation and increased mucosal thickness. EGF has a more generalized effect on intestine causing proliferation of both enterocytes and myocytes. IL-11, with or without EGF, may be a useful adjunct in instances of short bowel syndrome.

An analysis of perioperative cholangiography in one thousand laparoscopic cholecystectomies.

BACKGROUND: We undertook this retrospective study to ascertain the proper role of perioperative cholangiography in the management of 1002 patients undergoing laparoscopic cholecystectomy for symptomatic cholelithiasis. METHODS: Nine hundred forty-one patients were categorized as being at high or low risk for choledocholithiasis according to the presence or absence of jaundice, pancreatitis, elevated bilirubin, alkaline phosphatase, serum glutamic-oxaloacetic transaminase, or radiographic evidence of common bile duct stones (CBDSs). RESULTS: Intraoperative cholangiography (IOCG) and preoperative endoscopic retrograde cholangiopancreatography (ERCP) were equivalent in the detection of CBDSs, and laparoscopic common bile duct exploration (CBDE) was successful in 12 of the 21 patients (57%) in whom it was attempted. The ducts of the other 52 patients with CBDSs were successfully cleared by preoperative or postoperative ERCP. CONCLUSIONS: Laparoscopic IOCG is successful in detecting CBDS in high-risk patients and half of these ducts can be cleared laparoscopically. The incidence of CBDS in low-risk patients is 1.7%, a risk that does not warrant routine cholangiography. These data suggest ERCP should be reserved for those at-risk individuals in whom IOCG or laparoscopic duct clearance has been unsuccessful.

Intraepithelial neoplasms of the pancreas.

Intraepithelial neoplasms of the pancreas have been recently described and relatively rare, but these lesions represent a distinct, however pathologically heterogeneous entity with shared clinical features. We analyzed the clinicopathologic and cytogenetic characteristics of eight patients with intraepithelial neoplasms. Based on our hypothesis that tumor ploidy pattern correlates with ploidy, synthetic (S) phase and proliferative fractions of each neoplasm by flow cytometry. Analysis of the nuclear DNA content of pancreatic intraepithelial neoplasms in this study supports our hypothesis. Each neoplasm demonstrated diploid stemline, with a low S-phase fraction. The diploid DNA pattern and the low proliferative activity are consistent with the nonaggressive behavior of the tumors and, in part, explain the favorable prognosis of intraepithelial neoplasms. Intraepithelial neoplasms of the pancreas constitute a rare, but surgically curable, localized disease with a good prognosis following radical resection. The most valuable tool in the diagnosis of these preinvasive lesions is ERCP combined with brush cytology. This study supports the potential value of flow cytometric DNA analysis in determining outcome, as the diploid DNA pattern and low S-phase fractions correlate with the nonaggressive biological behavior.