Antimetastatic and Antitumor Activities of Orally Administered NAX014 Compound in a Murine Model of HER2-Positive Breast Cancer.

The natural isoquinoline alkaloid Berberine (BBR) has been shown to possess several therapeutic effects, including anticancer activity. Different BBR derivatives have been designed and synthesized in order to obtain new compounds with enhanced anticancer efficacy. We previously showed that intraperitoneal (IP) administration of the BBR-derived NAX014 compound was able to counteract HER-2 overexpressing mammary tumors onset and progression in transgenic mice. However, the IP administration was found to induce organ toxicity at doses higher than 2.5 mg/Kg. In this study, we evaluated the effect of intragastric (IG) administration of 20 mg/kg of NAX014 on both safety and anticancer efficacy in HER-2/neu transgenic mice. Furthermore, cancer cell dissemination and migration, tumor cell senescence and immunological changes were examined. Our results demonstrated that IG NAX014 administration delayed the onset of mammary tumors with no negative effects on health and survival. NAX014 reduced HER-2 overexpressing BC cells migration in vitro and the frequency of lung metastasis in HER-2/neu transgenic mice. A statistically significant increase of senescence-associated p16 expression was observed in tumors from NAX014-treated mice, and the induction of cell senescence was observed in HER-2 overexpressing BC cells after in vitro treatment with NAX014. Although NAX014 did not modulate the presence of tumor-infiltrating lymphocytes, the level of circulating TNF-α and VEGF was found to be reduced in NAX014-treated mice. The overall results address the NAX014 compound as potential tool for therapeutic strategies against HER-2 overexpressing breast cancer.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Antitumor activity of NAX060: A novel semisynthetic berberine derivative in breast cancer cells.

Breast cancer (BC) is the most common malignancy and the most common cause of cancer death in elderly women. We recently demonstrated that innovative compounds structurally related to and semisynthetically derived from the plant alkaloid berberine represent a promising unexplored resource for novel therapeutic tools in BC therapy. In this study, we analyzed the effectiveness of new 13-dichlorophenylalkyl berberine semisynthetic derivatives (NAX060, NAX103, NAX111, and NAX114) on the viability of BC cell lines. Our results demonstrated that the new compounds effectively inhibited the growth of a variety of human BC cell lines. In particular, the viability of HER-2 overexpressing SK-BR-3 cells was significantly reduced by the treatment with NAX060, the most active compound, in a dose and time-dependent manner. In the same tumor cell line, NAX060 induced a strong increase in sub-G1 population while G0/G1 and G2/M phase cells remarkably decreased. NAX060 withdrawal after 72 h of treatment resulted in an irreversible cell proliferation arrest and increasing cell death. Real-time PCR analyses showed that NAX060 induced the expression of some cell-cycle checkpoint molecules involved in cell senescence such as p21WAF1, p27, p16INK4a, and PAI-1. Furthermore, the HER-2 protein expression and phosphorylation, as well as the level of heparanase expression, were remarkably reduced on SK-BR-3 cells. NAX060 was effective also on HER-2 negative tumor cells, and, in particular, on human triple-negative MDA-MB-231 cells. These data suggest a potential therapeutic effect of NAX060 compound in the management of BC malignancies. Interestingly, NAX060 may represent a new useful tool also in triple-negative BC. © 2018 BioFactors, 44(5):443-452, 2018.

Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes.

The interaction between 13-phenylalkyl and 13-diphenylalkyl berberine derivatives (NAX) and human telomeric DNA G4 structures has been investigated by both spectroscopic and crystallographic methods. NAX042 and NAX053 are the best compounds improving the performance of the natural precursor berberine. This finding is in agreement with the X-ray diffraction result for the NAX053-Tel12 adduct, showing the ligand which interacts via π-stacking, sandwiched at the interface of two symmetry-related quadruplex units, with its benzhydryl group contributing to the overall stability of the adduct by means of additional π-stacking interactions with the DNA residues. The berberine derivatives were also investigated for their cytotoxic activity towards a panel of human cancer cell lines. Compounds NAX042 and NAX053 affect the viability of cancer cell lines in a dose-dependent manner.

Effect of new berberine derivatives on colon cancer cells.

The natural alkaloid berberine has been recently described as a promising anticancer drug. In order to improve its efficacy and bioavailability, several derivatives have been designed and synthesized and found to be even more potent than the lead compound. Among the series of berberine derivatives we have produced, five compounds were identified to be able to heavily affect the proliferation of human HCT116 and SW613-B3 colon carcinoma cell lines. Remarkably, these active compounds exhibit high fluorescence emission property and ability to induce autophagy.

Recognition of human telomeric G-quadruplex DNA by berberine analogs: effect of substitution at the 9 and 13 positions of the isoquinoline moiety.

G-quadruplex forming sequences are widely distributed in human genome and serve as novel targets for regulating gene expression and chromosomal maintenance. They offer unique targets for anticancer drug development. Here, the interaction of berberine (BC) and two of its analogs bearing substitution at 9 and 13-position with human telomeric G-quadruplex DNA sequence has been investigated by biophysical techniques. Both the analogs exhibited several-fold higher binding affinity than berberine. The Scatchard binding isotherms revealed non-cooperative binding. 9-ω-amino hexyl ether analog (BC1) showed highest affinity (1.8 × 10(6) M(-1)) while the affinity of the 13-phenylpropyl analog (BC2) was 1.09 × 10(6) M(-1). Comparative fluorescence quenching and polarization anisotropy of the emission spectra gave evidence for a stronger stacking interaction of the analogs compared to berberine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberine. However, the binding of the analogs did not induce any major structural perturbation in the G-quadruplex structure, but led to higher thermal stability. Energetics of the binding indicated that the association of the analogs was exothermic and predominantly entropy driven phenomenon. Increasing the temperature resulted in weaker binding; the enthalpic contribution increased and the entropic contribution decreased. A small negative heat capacity change with significant enthalpy-entropy compensation established the involvement of multiple weak noncovalent interactions in the binding process. The 9-ω-amino hexyl ether analog stabilized the G-quadruplex structure better than the 13-phenyl alkyl analog.

Role of 13-(di)phenylalkyl berberine derivatives in the modulation of the activity of human topoisomerase IB.

Topoisomerases IB are anticancer and antimicrobial targets whose inhibition by several natural and non-natural compounds has been documented. The inhibition effect by berberine and some 13-(di)phenylalkyl berberine derivatives has been tested towards human topoisomerase IB. Derivatives belonging to the 13-diphenylalkyl series display an efficient inhibition of the DNA relaxation and cleavage step, that increases upon pre-incubation with the enzyme. The religation step of the enzyme catalytic cycle is not affected by compounds and only slightly upon pre-incubation. The binding of the protein to the DNA substrate occurs also in the presence of the compounds, as monitored by a DNA shift assay, indicating that the compounds are not able to inhibit the formation of the enzyme-DNA complex but that they act as catalytic inhibitors.

Spectroscopic studies on the binding interaction of novel 13-phenylalkyl analogs of the natural alkaloid berberine to nucleic acid triplexes.

In this study we have characterized the capability of six 13-phenylalkyl analogs of berberine to stabilize nucleic acid triplex structures, poly(rA)⋅2poly(rU) and poly(dA)⋅2poly(dT). Berberine analogs bind to the RNA and DNA triplexes non-cooperatively. As the chain length of the substitution increased beyond CH2, the affinity enhanced up to critical length of (CH2)4, there after which the binding affinity decreased for both the triplexes. A remarkably stronger intercalative binding of the analogs compared to berberine to the triplexes was confirmed from ferrocyanide fluorescence quenching, fluorescence polarization and viscosity results. Circular dichroism results had indicated strong conformational changes in the triplexes on binding of the analogs. The analogs enhanced the stability of the Hoogsteen base paired third strand of both the triplexes while no significant change in the high-temperature duplex-to-single strand transitions was observed. Energetics of the interaction revealed that as the alkyl chain length increased, the binding was more entropy driven. This study demonstrates that phenylalkyl substitution at the 13-position of berberine increased the triplex binding affinity of berberine but a threshold length of the side chain is critical for the strong intercalative binding to occur.

Gadolinium-binding cyclic hexapeptoids: synthesis and relaxometric properties.

Two new cyclic hexapeptoids incorporating N-carboxyethylglycine and N-methoxyethylglycine residues are able to efficiently bind Gd(3+). Their thermodynamic stabilities and relaxivities have been assessed by (1)H-relaxometric investigations.