Conformational studies of glutenin polymers from different wheat cultivars by circular dichroism spectroscopy.

A strong correlation between baking quality and size distribution of wheat glutenin polymers exists, so we have utilized Circular Dichroism Spectroscopy in presence of some denaturant agents to study glutenin polymers. Spectra indicated that all the changes induced by urea and by sodium dodecyl sulphate followed a multi-step transition process.

Structural studies of wheat flour glutenin polymers by CD spectroscopy.

A dissolution procedure of unreduced glutenin polymers of three wheat flour varieties (WRU 6981, Alisei 1, and Alisei 2) by sonication in the presence of SDS (sodium dodecyl sulphate), after the elimination of albumins, globulins, and gliadins, was achieved, and the molecular weight distribution of glutenin polymers obtained by this method was measured by matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. A structural study by CD spectroscopy at different temperatures of WRU 6981 glutenin polymer and of 1Ax1 high-M(r) (relative molecular mass) glutenin subunit, which is the only high-M(r) subunit contained in WRU 6981 flour, was undertaken to understand if the information obtained from the single subunit were applicable to the total polymer. CD spectroscopy also has been employed to study the glutenin polymers obtained by Alisei 1 and Alisei 2 wheat flours; Alisei 1 biotype contained 1Bx7 and 1Dx2+1Dy12 high-M(r) subunits, whereas the Alisei 2 biotype contained only 1Bx7 and 1Dy12 subunits. A conformational study was undertaken by CD spectroscopy at different temperatures and in the presence of some chemical denaturant agents, such as urea and sodium dodecyl sulphate, in order to obtain information about their intrinsic stability and to verify if the 1Dx2 subunit presence determined a different structural behavior between Alisei 1 and Alisei 2 polymers. MALDI-TOF mass spectrometric experiments showed that the glutenin polymers molecular weights were in the mass range of 500000-5000000. CD spectra indicated that a single conformational state did not predominate in the temperature range studied but equilibrium between two distinct conformational states existed; moreover, all the changes induced by urea and by SDS followed a multistep transition process.

Conformational studies of wheat flour high relative molecular mass glutenin subunits by circular dichroism spectroscopy.

Conformational studies of 1Dx2, 1Bx7, and 1Dy12 high relative molecular mass glutenin subunits, extracted from Alisei 1 flour, are reported. Circular dichroism (CD) spectroscopy is employed to study their conformational polymorphism induced by urea and by urea in the presence of 1% sodium dodecyl sulfate (SDS). The CD spectra indicate that SDS promotes ordered structures. The addition of urea to the SDS-acetate solution of 1Dx2, 1Bx7, and 1Dy12 subunits eliminates the effect of SDS. Its addition to the acetate solution of proteins induces conformational transitions to form a poly-L-proline II-like structure. All the changes induced by urea follow a multistep transition process that is typical of proteins consisting of different domains.

Proteomics of gluten: mapping of subunit 1 Ax2* in Cheyenne cultivar by matrix-assisted laser desorption/ionization.

This paper reports results on the verification of the 1Ax2* high molecular weight glutenin subunit sequence in Cheyenne cultivar. The gene sequence of the protein is known but recently some text changes have been made, and furthermore until now no characterization of post-translational modifications has been reported. The two published sequences, named I and II, differ in four residues at positions 23, 208, 475, and 611. The first sequence contains 20 Arg and 6 Lys residues, producing 26 tryptic fragments, since the Arg(109)-Pro(110) bond is generally not cleaved by trypsin. The second sequence contains 19 Arg and 6 Lys residues, producing 25 tryptic peptides, again because of the Arg(109)-Pro(110) bond. Both sequences generate two cyanogen bromide fragments. Matrix-assisted laser desorption/ionization analysis of the tryptic digest of the high-MW glutenin subunit 1Ax2* resulted in the identification of 24 out of the 26 expected peptides for sequence I, a sequence coverage of 99.5%. These results were sufficient to rule out sequence II and any protein glycosylation and any other post-translational modifications to within the detection limits of the method. It was found that the choice of matrix considerably influenced the sequence coverage in peptide mapping.

Matrix-assisted laser desorption/ionization mass spectrometric peptide mapping of high molecular weight glutenin subunits 1Bx7 and 1Dy10 in Cheyenne cultivar.

This study describes the verification of the cDNA-deduced amino acid sequences of high molecular weight glutenin subunits 1Dy10 and 1Bx7 in Cheyenne cultivar by direct matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) analysis of their tryptic fragments omitting chromatographic pre-separation. These polypeptides have a conserved structure consisting of a long central repetitive domain that prevents the application of conventional sequencing procedures such as Edman degradation. The published sequence of subunit 1Dy10 contains 7 Lys and 13 Arg residues; thus the production of 21 tryptic peptides is expected. The cDNA-deduced sequence for 1Bx7 subunit includes 5 Lys and 15 Arg residues, but the presence of three Arg-Pro bonds, which are normally not cleaved by trypsin, predicts only 19 tryptic peptides. Three different matrices (DHB, SA and HCCA) in combination with the most compatible sample preparation procedures were used in order to obtain the maximum 1Dy10 and 1Bx7 sequence coverage. MALDI analysis of the 1Dy10 tryptic digest resulted in the identification of all 21 expected peptides. In the case of 1Bx7 MALDI analysis resulted in the identification of 17 of the 19 expected peptides, giving a sequence coverage of 99.3%. These results were sufficient to rule out glycosylation of the 1Dy10 and 1Bx7 proteins and to assess the absence of any other post-translational modification, to within the detection limits of the method.

Antimicrobial prophylaxis with ceftriaxone for prevention of early postoperative infections after 49 liver transplantations.

Infection remains a major problem for individuals who undergo solid organ transplantation and liver transplant recipients are particularly susceptible to infectious complications with a high morbidity and mortality rate. The risk of these infections is determined by previous or future environmental exposures as well as the patient's immune status. We report here the results of an open prospective study involving 49 consecutive liver transplantations, undertaken to evaluate the efficacy of ceftriaxone in the prevention of early postoperative infectious complications. Antimicrobial prophylaxis was done using a single dose of ceftriaxone (2 g i.v.) given at the induction of anesthesia and then 2 further once-daily doses were administered 2 days postoperatively. Early postoperative bacterial infection rate was 43.5% (20/46); this result is comparable or even lower than those documented in other studies. This study, even though open and non-comparative, showed that a once-daily regimen containing ceftriaxone provides adequate antimicrobial prophylaxis and significant cost-savings in comparison with multiple-dose prophylactic regimens in patients undergoing liver transplantation.

Use of hydroxyacetophenones as matrices for the analysis of high molecular weight glutenin mixtures by matrix-assisted laser desorption/ionization mass spectrometry

A selection of hydroxyacetophenones has been investigated as matrices for the analysis, by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS), of high molecular weight (HMW) glutenin mixtures from three wheat varieties. Mass spectra were obtained directly from the HMW glutenin extracts without any preliminary purification and separation steps. According to the quality of the mass spectra, obtained using different hydroxyacetophenones, it has been possible to classify the matrices on the basis of their suitability for the analyte properties. Only two of the matrices considered showed to be compatible with the HMW glutenin mixtures analysis, although a large amount of other highly complex protein mixtures are present. This study indicates that MALDI-MS, as a stand-alone technique, is particularly useful for the direct determination of the complete HMW subunits profile and their molecular weights. Copyright 1999 John Wiley & Sons, Ltd.

Separation of G structures formed by a 27-mer guanosine-rich oligodeoxyribonucleotide by dye-ligand affinity chromatography.

G-DNA structures, formed by a 27-mer guanosine-rich oligodeoxyribonucleotide, AACCCGGCGTTCGGGGGGTACCGGGTT, were isolated and studied by dye-ligand affinity chromatography, using a Reactive Green 19-agarose resin (RG19-aga) and gel electrophoresis. The experiments were performed in the presence of Li+, Na+ and K+, which are able to stabilise the G structures to different extents. Desalting procedures followed by affinity chromatography, performed in the presence of Li+, gave us information on the relationships among the species isolated and their stability. The results show that the more stable species were those obtained in the presence of K+, while in the presence of Li+, the formation of G structures was negligible and the oligonucleotide was almost exclusively present as a stem-loop structure recognised by the RG19-aga affinity resin. Electrophoretic and denaturation and renaturation experiments supported the affinity chromatography results.

Isolation by gel-permeation chromatography of a non-covalent complex of Cibacron Blue F3G-A with human serum albumin.

The isolation by gel-permeation chromatography on Sephadex G-100 of a non-covalent complex of Cibacron Blue F3G-A (CB) with human serum albumin (HSA) is described. The complex presents a molar ratio of 3:1 CB-HSA and can be re-chromatographed under the same conditions without modification of its composition. However, complete dissociation occurs when the complex is chromatographed in the presence of denaturing agents. The effect of pH on the molar composition of the complex was also investigated by gel-permeation chromatography. Analogous complexes between CB and A and C cyanogen bromide fragments of unreduced HSA were also isolated by gel-permeation chromatography on Sephadex G-50. They present a molar ratio of 0.8:1 and 1.3:1 CB-protein for fragments A and C, respectively. These results suggest that two of the three molecules of CB bound to HSA may be located in the hydrophobic pocket corresponding to subdomain IIA, with the other molecule in the hydrophobic site corresponding to subdomain IIIA. The UV-Vis and dichroic circular spectra of the isolated complexes are reported.

Tryptic peptide mapping of sequence 299-585 of human serum albumin by high-performance liquid chromatography and fast atom bombardment mass spectrometry.

The determination of the tryptic peptide mapping of sequence 299-585 (cyanogen bromide fragment A) of human serum albumin (HSA) by chemical and enzymatic cleavages and combined use of HPLC and FAB-MS is described. Reduction and carboxymethylation of A gave four subfragments which were separated by HPLC and digested with trypsin. Tryptic fragments were separated by HPLC and identified by FAB-MS. A total coverage of about 95% of the entire sequence was obtained. Tryptic fragments not identified include mostly single amino acids and very hydrophilic peptides which were absent in the chromatograms. The high reproducibility of the experiments and the satisfactory yield of the tryptic fragments identified demonstrate the great potential of the combined use of HPLC separation and FAB-MS analysis for the structural investigation of HSA.

Structural characterization of synthetic model peptides of the DNA-binding cI434 repressor by electrospray ionization and fast atom bombardment mass spectrometry.

The structural characterization of two synthetic model peptides of the cI434 repressor is described. Unequivocal determination of the structure was achieved by means of electrospray ionization mass spectrometry of the intact peptides and by fast atom bombardment mass spectrometric identification of complementary peptide fragments obtained by tryptic and chymotrypic digestion and partial separation by reversed-phase high-performance liquid chromatography. The results show the potential of this approach for characterizing synthetic peptides of relatively high molecular weight.

Tryptic peptide mapping of sequence 1-298 of human serum albumin by high-performance liquid chromatography and fast-atom bombardment mass spectrometry.

The determination of the tryptic peptide mapping of sequence 1-298 of human serum albumin (HSA) by chemical and enzymatic cleavage and combined use of high-performance liquid chromatography (HPLC) and fast-atom bombardment mass spectrometry (FAB-MS) is described. A total coverage of about 75% of the entire sequence was obtained. Unidentified fragments included some peptides which were not present in the chromatograms because of their extreme hydrophobic or hydrophilic character, as indicated by the calculated retention times. Due to the high reproducibility of the experiments and to the satisfactory yield of the tryptic fragments identified, the combined use of HPLC and FAB-MS appears to possess great potential for structural investigation of HSA.