First Report of Olpidium bornovanus and O. virulentus on Melon in Italy.

A survey for the presence of Olpidium spp. on melon (Cucumis melo L.) was conducted during the beginning of 2013 in central Italy in an unheated greenhouse, located in the melon-producing coastal area of north Latium (central Italy, Viterbo Province) (42°23'09.31″N, 11°30'46.10″E) with a history of monosporascus root rot and vine decline (MRRVD). For this aim, 10 soil samples were collected adjacent to the roots of plants symptomatic of MRRVD, represented by root lesions and rots and loss of smaller feeder roots. Olpidium was baited from collected infested soil by growing melon (cv. Dinero) plants for 45 days. Bait plants grown in sterilized soil were used as negative controls. All the baited melon roots were analyzed by morphological and molecular methods. For the morphological analysis, feeder roots were clarified in a 1.5% KOH solution for 24 h (2) and observed under a light microscope to record the presence or absence of sporangia and resting spores of Olpidium spp., which were observed in baited melon plants grown in infested soil and not in control roots. In particular, stellate resting spores were referred to as O. virulentus because this species cannot be distinguished from O. brassicae, which does not colonize melon. O. bornovanus had smooth-walled resting spores with a honeycomb-like pattern (2). For molecular analysis, DNA was extracted from 21 melon roots and tested by multiplex PCR to confirm Olpidium spp. identification (2). Based on molecular identification, O. virulentus was identified in 40% of samples, and O. bornovanus was identified in 10%. There were no mixed infections in the same sample. Two amplified PCR products, corresponding to O. bornovanus and O. virulentus expected fragment sizes of 977 and 579 bp respectively, were sequenced (GenBank Accession Nos. KF661295 and KF661296). BLAST analysis of the sequences showed 99% nucleotide identity with O. bornovanus isolate CH from Japan collected in melon roots (AB205215) and O. virulentus isolate HY-1 from Japan collected in lettuce roots as reported by Sasaya and Koganezawa (3) (AB205204, formerly O. brassicae). At the end of the experiment, the root systems of all inoculated plants appeared brown, whereas neither symptoms nor sporangia and resting spores were observed in roots of control plants. Olpidium spp. are root-infecting plant pathogens of melon (4), acting as vectors of Melon necrotic spot virus (MNSV) and other destructive plant viruses (1). Moreover, they are directly involved in the induction of germination of ascospores of Monosporascus cannonballus, the causal agent of MRRVD of cucurbits (4). To our knowledge, this is the first report of O. virulentus and O. bornovanus on melon in Italy. References: (1) A. Alfaro-Fernández et al. J. Phytopathol. 91:1250, 2009. (2) J. A. Herrera-Vásquez et al. Mycol. Res. 113:602, 2009. (3) T. Sasaya and H. Koganezawa. J. Gen. Plant Pathol. 72:20, 2006. (4) M. E. Stanghellini and I. J. Misaghi. Phytopathology 101:794, 2011.

First Report of Pepper vein yellows virus Infecting Sweet Pepper in Spain.

In November 2012, unusual symptoms were observed in plants of sweet pepper (Capsicum annuum L.) grown in commercial greenhouses of Almería Province, southeastern Spain. Symptoms included interveinal yellowing, upward leaf curling, and internode shortening, and were more evident in the upper part of the plant. Abnormal ripening of fruits was observed in symptomatic plants, with fruits remaining orange in the red varieties and yellow in the orange varieties, thus reducing their marketability. During December 2012 and January 2013, severe outbreaks of this disease syndrome occurred, with many greenhouses exhibiting almost 100% incidence. The symptoms observed were similar to those reported for isolates of Pepper vein yellows virus (PeVYV, genus Polerovirus, family Luteoviridae) (previously also named Pepper yellow leaf curl virus [PYLCV] and Pepper yellows virus [PYV]) (2,4). Twenty five symptomatic leaf and/or fruit samples (some of them supplied by Zeraim Ibérica, S.A.), each from a different greenhouse, were analyzed and all reacted positively in double-antibody sandwich-ELISA with an antiserum against the polerovirus Cucurbit aphid-borne yellows virus (CABYV) (Sediag, Longvic, France), known to cross-react with PeVYV (2). Total RNA was extracted by TRIsure reagent (Bioline, London, United Kingdom) from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with primers Pol-G-F (5'-GAYTGCTCYGGYTTYGACTGGAG-3') and Pol-G-R (5'-GATYTTATAYTCATGGTAGGCCTTGAG-3') designed for universal detection of poleroviruses by amplifying the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) partial genes (3). DNA fragments of the expected size (1.1 kbp) were amplified supporting a polerovirus infection in all the analyzed samples. The PCR product obtained from one sample (Almería-1) was extracted from agarose gel with a QIAquick gel extraction kit (Qiagen, Hilden, Germany), cloned in pGEM-T Easy vector (Promega, Madison, WI), and one clone was sequenced (Macrogen Inc., Seoul, South Korea). The PCR products amplified from three other samples (2-13, 7-13, and 8-13) were directly sequenced. The nucleotide identity between the amplified fragments (GenBank Accession Nos. KC769487, KC839992 to 94), calculated after alignment with ClustalW, was 99.7 to 100%. The highest nucleotide identity of the Spanish sequences was with a PeVYV isolate from Turkey (FN600344, named as PYV) (98.5 to 98.7%). The spread of PeVYV in Spain is additional evidence of the emergence of this virus as a global threat for pepper crops after its first detection in Japan in 1995 and recent reports from the Mediterranean Basin (1,2). References: (1) N. Buzkan et al. Arch. Virol. 158:881, 2013. (2) A. Dombrovsky et al. Phytoparasitica 38:477, 2010. (3) D. Knierim et al. Plant Pathol. 59:991, 2010. (4) R. Murakami et al. Arch. Virol. 156:921, 2011.

'Candidatus Liberibacter solanacearum' Associated with Bactericera trigonica-Affected Carrots in the Canary Islands.

In 2009 and 2010, commercial carrot (Daucus carota L.) fields located in Tenerife (Canary Islands, Spain) showed symptoms of curling, yellow, bronze, and purple discoloration of leaves, stunting of shoots and tap roots, and proliferation of secondary roots. A large population of the psyllid Bactericera trigonica was noted in those fields. Similar symptoms were reported previously in carrot-production areas of the Canary Islands and mainland Spain that were associated with stolbur and aster yellows (1997 and 1998) (2) and Spiroplasma citri and phytoplasmas (2009 and 2010) (1). These symptoms were also reported in southern Finland in 2008 and associated with 'Candidatus Liberibacter solanacerum' (4). Studies were conducted to investigate whether these pathogens and the psyllid B. trigonica were associated with the observed symptoms in carrot in Tenerife. A total of 18 petiole samples of symptomatic carrots were collected (13 samples in 2009 and 5 samples 2010). Five asymptomatic plants were also sampled. Three samples of psyllids (five individuals grouped) collected from one affected field in 2010 were also included in the assay. Total DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA), and analyzed by nested-PCR assays using primer pairs P1/P7 and R16F2n/R16R2n for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 for S. citri detection as described previously (3). PCR was performed using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, for 'Ca. L. solanacearum' (4). S. citri and phytoplasmas were not detected in any of the studied samples. However, a 1,168-bp 16S rDNA fragment and a 669-bp rplJ/rplL fragment were amplified from DNA from 16 symptomatic carrot samples and three psyllid grouped samples using specific primers for 'Ca. L. solanacearum'. No DNA was amplified from the asymptomatic samples. These results indicate the presence of 'Ca. L. solanacearum' in the affected carrot and psyllid samples collected in Tenerife (Canary Islands). Four and one PCR products obtained from DNA of carrot and psyllid samples, respectively, with both primer pairs were sequenced. BLAST analysis of the 16S rDNA sequences obtained from infected carrots (GenBank Accession Nos. HQ454312, HQ454313, HQ454314, and HQ454315) and psyllids (HQ454316) showed 99% identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049) and B. cockerelli (EU812557). The rplJ/rplL nucleotide sequences obtained from infected carrots (Accession Nos. HQ454317, HQ454318, HQ454319, and HQ454320) and psyllid (HQ454321) were 98% identical to the analogous rplJ/rplL 'Ca.L. solanacearum' ribosomal protein gene from carrot (GU373051) in Finland and tomato (EU834131) from New Zealand. To our knowledge, this is the first report of 'Ca. L. solanacearum' associated with psyllid-affected carrots in the Canary Islands (Tenerife, Spain) and also the first report of this plant pathogen associated with B. trigonica. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:405, 1999. (3) I.-M. Lee et al. Plant Dis. 90:989, 2006. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

First Report of 'Candidatus Liberibacter solanacearum' in Carrot in Mainland Spain.

In the summer of 2008, symptoms of leaf curling with yellow, bronze, and purple discoloration, twisting of petioles, stunting of shoots and tap roots, and proliferation of secondary roots were observed in 18 commercial carrot (Daucus carota L.) fields (~62 ha) severely infested with psyllids (mainly Bactericera sp.) from 52 fields (297 ha) located in Alicante and Albacete provinces of Spain. Incidence of symptomatic plants was variable among fields. Similar symptoms were observed in 2009, 2010, and 2011. Symptoms resembled those associated with phytoplasma, spiroplasma, or the bacterium 'Candidatus Liberibacter solanacearum' infections in carrot (1-4). Aster yellows and stolbur phytoplasmas and Spiroplasma citri have previously been reported from carrot in mainland Spain but liberibacter infection has not been documented in this region (1). Studies were conducted to determine if 'Ca. L. solanacearum' was associated with the symptoms. Petiole samples of symptomatic carrot plants were collected in 2009 (25 from 9 fields in Alicante and Albacete provinces) and early 2010 (21 from 8 fields in Alicante, Albacete, and Valencia provinces) from symptomatic fields where incidence ranged from 50 to 90%. In addition, one sample collected in 2008 in Alicante was included in the assay. Also, samples were collected from five asymptomatic carrot plants. Total DNA was extracted from 0.5 g of petiole tissue of each sample with the CTAB extraction buffer method (3,4). DNA extractions were analyzed by PCR assay using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, of 'Ca. L. solanacearum' (3,4). DNA samples were also tested for phytoplasmas and S. citri by nested-PCR assays using primer pairs P1/P7 followed by R16F2n/R16R2n and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2, respectively (2). A 1,168-bp fragment of 16S rDNA was detected in DNA extracted from 1, 12, and 12 symptomatic samples collected in 2008, 2009, and 2010, respectively, suggesting the presence of 'Ca. L. solanacearum' in the carrot samples. A 669-bp rplJ/rplL fragment also was amplified from DNA of the same samples. Liberibacter was not detected in asymptomatic plants. Eight and two samples were infected with S. citri and aster yellows phytoplasmas, respectively. Three samples were infected with S. citri and 'Ca. L. solanacearum' and one sample was infected with all three pathogens. Three amplicons obtained from the PCR assays with both primer pairs from carrot samples collected in 2009 and 2010 were sequenced directly. BLAST analysis of the 16S rDNA sequences (GenBank Nos. HQ454302, HQ454303, and HQ454304) showed 99% nucleotide identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049). The rplJ/rplL nucleotide sequences (HQ454305, HQ454306, and HQ454307) were 97% identical to sequences of the analogous rplJ/rplL 'Ca. L. solanacearum' ribosomal protein gene from carrot in Finland (GU373051). To our knowledge, this is the first report of 'Ca. L. solanacearum' in carrot in mainland Spain and also the first evidence of mixed infections of S. citri, 'Ca. L. solanacearum', and phytoplasmas in carrot. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) I.-M. Lee et al. Plant Dis. 90:989, 2006. (3) J. E. Munyaneza et al. J. Econ. Entomol. 103:1060, 2010. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

First Report of Spiroplasma citri in Carrot in Europe.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as 'carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

First Report of Pea enation mosaic virus Infecting Pea and Broad Bean in Spain.

During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were "bushy" and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5'-TGACCATGAGTCCACTGAGG-3'), PEMV-R (5'-AGTATCTTCCAACAACCACAT-3'). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.

First Report of Tobacco as a Natural Host of Tomato yellow leaf curl virus in Spain.

Two begomovirus species, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), have been identified as causal agents of tomato yellow leaf curl disease (TYLCD) in Spain. TYLCSV was reported in Spain in 1992 and TYLCV in 1997 on tomato crops (3). TYLCV was also reported in common bean (Phaseolus vulgaris L.) and pepper (Capsicum annuum L.) crops in southern Spain in 1997 and 1999, respectively. During the summer of 2004, symptoms of yellowing, crumpling, and necrosis of new leaves were observed sporadically in young, field-grown tobacco (Nicotiana tabacum L.) plants in the Badajoz Province. These tobacco plants were next to tomato crops where TYLCV was detected for the first time in Badajoz in 2003. In September 2004, four symptomatic tobacco plants were selected for double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) and polymerase chain reaction (PCR) identification analyses. Serological analyses were carried out in two repetitions and with the following polyclonal antisera: Potato virus Y (PVY) (Loewe Biochemica, Sauerlach, Germany); Tobacco mild green mosaic virus (produced in our laboratory); Tobacco mosaic virus (BIO-RAD, Marnes-La-Coquette, France); and Tomato spotted wilt virus (Loewe Biochemica). A simplified method of duplex PCR was used for a rapid, sensitive, and simultaneous detection of TYLCSV and TYLCV (2). Mixed infections of PVY and TYLCV were detected in all four tobacco samples tested. TYLCV infection was confirmed using the primer pair TY-1/TY-2 specific for the coat protein (CP) gene of begomoviruses (1). The CP fragment was digested with the restriction enzyme AvaII, and the pattern obtained corresponded to that obtained from TYLCV-infected tomato that served as a positive control. Two PCR products from different tobacco samples were sequenced and both showed 100% identity with the corresponding region (Almería) of TYLCV (GenBank Accession No. AJ489258) and 99% with TYLCV-Mild (Spain) (GenBank Accession No. AJ519441), confirming the diagnosis. The symptoms observed in the tobacco plants can not be attributed solely to TYLCV since the virus was present in a mixed infection with PVY. However, tobacco infected with TYLCV may serve as an important alternate host for TYLCV in the tomato cropping system. To our knowledge, this is the first report of N. tabacum as a natural host of TYLCV in Spain. References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) P. Martínez-Culebras et al. Ann. Appl. Biol. 139:251, 2001. (3) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997.

Viral Etiology of Diseases Detected in Melon in Guatemala.

At the beginning of 1999, 30 melon (Cucumis melo L.) plots on several farms (1,500 ha) in the Zacapa Valley of Guatemala were visited, and melon plants with two different symptomologies were observed. One group of plants exhibited stem necrosis at the crown level, and less frequently, small necrotic spots on leaves. Some plants exhibited necrosis of veins and yellow areas that evolved into interveinal necrosis and often expanded into large necrotic interveinal lesions. Roots were poor and lacked secondary rootlets. In some cases, wilt and plant death were detected. Affected plants appeared as localized patches in various areas of the plots on farms that were visited. Double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) serological analyses were carried out with 34 symptomatic plants. In these plants, a mixture of the crown and root were analyzed with two repetitions and two lots of different Melon necrotic spot virus (MNSV) polyclonal antisera (Loewe No. 07097 and Sanofi No. 70217). All 34 plants were positive for this virus. These results were confirmed using reverse transcription-polymerase chain reaction (RT-PCR) with specific MNSV primers (1). Spores of Olpidium bornovanus, the vector of MNSV, were seen on all ELISA-positive plants after staining rootlets with potassium hydroxide and neutralization with hydrochloric acid. In the same fields, another group of melon plants showed yellowing, curling, and mottling of leaves. Leaves collected from five symptomatic plants gave positive results in triple-antibody sandwich-ELISA using a Tomato yellow leaf curl begomovirus antiserum (DSMZ AS-0421 and DSMZ AS-0546/2). In 2001, these results were confirmed using PCR with degenerate primers that amplify the core region of most begomovirus coat protein genes (P. Martínez-Culebras, M. I. Font, and C. Jordá, unpublished). A 560-bp DNA fragment was amplified in these symptomatic melon samples. Three of the PCR products were sequenced and each showed 99% identity with the Melon chlorotic leaf curl virus isolate from Guatemala (GenBank Accession No. AF325497). Only one mixed infection of MNSV and MCLCV was found. During the four years subsequent to 1999, the number of melon plants showing both types of symptoms has increased. This study provides information on the current status of virus diseases in melon crops in Guatemala, and to our knowledge, this is the first report of MNSV in Guatemala. Reference: (1) B. Gosalvez et al. J. Virol. Methods 113:87.

Current Status and Newly Discovered Natural Hosts of Tomato infectious chlorosis virus and Tomato chlorosis virus in Spain.

Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) are emergent whitefly-transmitted criniviruses. ToCV and TICV were detected in Spain in 2000 (2) and 2001 (1), respectively. Both viruses infect tomato (Lycopersicon esculentum Mill) crops and cause symptoms of foliar chlorosis. ToCV is prevalent along the southern and eastern regions of Spain (provinces of Sevilla, Málaga, Almería, Murcia, Alicante, and Castellón), Balearic (Mallorca), and the Canary Islands (Tenerife and Gran Canaria). However, TICV only has been detected in the provinces of Murcia, Alicante, and Castellón in Spain. During the summer and autumn of 2002, abnormal interveinal reddening, yellowing symptoms, or both, were observed in plants of Chenopodium album L., C. murale L., and Solanum nigrum L. growing in or around tomato fields in Murcia and Almería provinces. To study the alternative hosts that may serve as virus reservoirs in areas where these viruses are prevalent, 62 samples of 42 common weed species were analyzed by reverse transcription-polymerase chain reaction using specific primers for ToCV and TICV (1). The 439-bp ToCV-specific DNA fragment was amplified in two S. nigrum samples from Alicante and Murcia provinces, and the 501-bp TICV-specific DNA fragment was amplified in one C. murale sample from Murcia, as well as in three C. album samples from Murcia and Alicante provinces. The DNA fragment amplified from the ToCV isolate was sequenced and showed 99 to 98% identity with the ToCV isolates (GenBank Accession Nos. AY048854 and AF234029) from Italy and Portugal, respectively. The DNA fragment amplified from TICV isolates were sequenced and showed 98% identity with the TICV isolate from Spain (GenBank Accession No. AF479662), confirming the diagnosis. Although the number of samples is not sufficient to conclude that we know, in a precise way, the role of weed reservoirs in TICV and ToCV epidemics in Spain, this study might contribute to a better understanding of the epidemiology of these viruses. To our knowledge this is the first report of these weeds as natural hosts of ToCV and TICV in Spain. References: (1) M. I. Font et al. Plant Dis. 86:696, 2002. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000.

First Report of Tomato infectious chlorosis virus in Spain.

During the summer and autumn of 2001, symptoms of interveinal yellowing, bronzing, brittleness, and rolling of lower leaves were observed in greenhouse- and field-grown tomato (Lycopersicon esculentum) plants in Castellon Province in eastern Spain. Symptoms resembled those caused by the whitefly-transmitted criniviruses (1,2). Total RNA was extracted from 28 samples of symptomatic leaves collected in three greenhouses and one field and analyzed by reverse transcription-polymerase chain reaction using primers specific for Tomato chlorosis virus (ToCV) (1) and Tomato infectious chlorosis virus (TICV) (2). The 501-bp TICV-specific DNA fragment was amplified in four samples collected during the summer in three greenhouses and one field, and the 439-bp ToCV-specific DNA fragment was amplified in 15 samples collected during the autumn in the same three greenhouses; no mixed infections were found. The DNA fragments amplified from TICV were sequenced and showed 99 to 100% identity with the TICV isolates (GenBank Accession Nos. U67449 and AY048855) from the United States and Italy, respectively, confirming the diagnosis. One sequence was deposited as GenBank Accession No. AF479662. To our knowledge, this is the first report of TICV in Spain and the second in Europe. References: (1) D. Louro et al. Eur. J. Plant Pathol. 106:539, 2000. (2) A. M. Vaira et al. Phytoparasitica. In Press.

The petrosal ganglion of the adult cat: neuronal count, sectional area, and their respective distributions.

The petrosal ganglion contains most of the perikarya of sensory neurons of the glossopharyngeal nerve. We studied the number and size of neuronal somata in 4 petrosal ganglia from adult cats. Ganglia were serially sectioned in length at 8 microns, sections drawn through a projection microscope, and those neuronal profiles presenting nuclei and nucleoli on each section were counted and their areas measured. The number of neurons ranged from 2311 to 3429 (2908 +/- 271; mean +/- SEM). Neurons were symmetrically distributed around the longitudinal axes of most ganglia, with a skewed distribution in only one ganglion. The sectional area of most neurons (> 98%) ranged between 250 and 1725 microns 2, with median values of 667-963 microns 2. Area distributions were significantly different, but differences never exceeded 8.2% in related area bins. The ganglion presenting a skewed count distribution and the highest median area departed from the rest, with differences surpassing 25%. We conclude that the neuronal population of the petrosal ganglion of the cat is regular both with respect to the number and the size of its constituents, with departures from this pattern probably reflecting individual variations.

The petrosal ganglion of the adult cat: neuronal count, sectional area, and their respective distributions

The petrosal ganglion contains most of the perikarya of sensory neurons of the glossopharyngeal nerve. We studied the number and size of neuronal somata in 4 petrosal ganglia from adult cats. Ganglia were serially sectioned in length at 8 microns, sections drawn through a projection microscope, and those neuronal profiles presenting nuclei and nucleoli on each section were counted and their areas measured. The number of neurons ranged from 2311 to 3429 (2908 +/- 271; mean +/- SEM). Neurons were symmetrically distributed around the longitudinal axes of most ganglia, with a skewed distribution in only one ganglion. The sectional area of most neurons (> 98 percent) ranged between 250 and 1725 microns 2, with median values of 667-963 microns 2. Area distributions were significantly different, but differences never exceeded 8.2 percent in related area bins. The ganglion presenting a skewed count distribution and the highest median area departed from the rest, with differences surpassing 25 percent. We conclude that the neuronal population of the petrosal ganglion of the cat is regular both with respect to the number and the size of its constituents, with departures from this pattern probably reflecting individual variations