Headache as the most prevalent post-vaccination adverse event after Covid-19 vaccination / Dor de cabeça como evento adverso pós-vacinação mais prevalente após a vacinação contra Covid-19

BACKGROUND: In 2020, the first vaccines were approved, according to the WHO. However, speculations arose regarding their efficacy and post-vaccination adverse events (AEFV). OBJECTIVE: To evaluate the prevalence of headache as AEFI from the SARSCoV-2 vaccine in Piauí, Brazil. METHODS: This is a quantitative, observational, cross-sectional, and prevalence study. Data were provided by the Post-Vaccination Adverse Event Information System (SI-AEFV), from reported cases from January to September 2021. Data were analyzed, and the research was approved by the UFPI Research Ethics Committee. RESULTS: A total of 2,008 cases were analyzed. Headache was reported in 752 cases (27.99%) as an AEFV after vaccination against SARS-CoV-2. In most cases, patients were from Teresina (67.62%), of brown race/ethnicity (52.67%), female (79.00%), and the majority were not healthcare professionals (54.27%). The most common age of patients, with the original data, was 33 years. After data correction, the most common age was 28 years. The majority of these cases were not severe (96.44%), and the majority of cases were associated with the first dose of the Covid-19-Covishield-Oxford/AstraZeneca vaccine (43.18%).CONCLUSION: Thus, it is concluded from the partial analysis of the results that headache is the most common adverse event after vaccination against SARS-CoV-2. The profile of patients with the most notifications was brown women aged 30 to 40 years who received the first dose of the Covid-19-Covishield-Oxford/AstraZeneca vaccine. Regarding the severity of events, the vast majority were considered non-severe, and no deaths were mentioned, demonstrating the safety of immunobiologicals.

FUNDAMENTO: Em 2020, foram aprovadas as primeiras vacinas, segundo a OMS. No entanto, surgiram especulações quanto à sua eficácia e eventos adversos pós-vacinais (EAPV). OBJETIVO: Avaliar a prevalência de cefaleia como EAPV da vacina SARSCoV-2 no Piauí, Brasil. MÉTODOS: Trata-se de um estudo quantitativo, observacional, transversal e de prevalência. Os dados foram fornecidos pelo Sistema de Informação de Eventos Adversos Pós-Vacinação (SI-AEFV), dos casos notificados no período de janeiro a setembro de 2021. Os dados foram analisados ​​e a pesquisa foi aprovada pelo Comitê de Ética em Pesquisa da UFPI. RESULTADOS: Foram analisados ​​2.008 casos. Cefaleia foi relatada em 752 casos (27,99%) como EAPV após vacinação contra SARS-CoV-2. Na maioria dos casos, os pacientes eram procedentes de Teresina (67,62%), de raça/etnia parda (52,67%), do sexo feminino (79,00%) e a maioria não era profissional de saúde (54,27%). A idade mais comum dos pacientes, com os dados originais, era de 33 anos. Após correção dos dados, a idade mais comum foi 28 anos. A maioria desses casos não foi grave (96,44%), e a maioria dos casos esteve associada à primeira dose da vacina Covid-19-Covishield-Oxford/AstraZeneca (43,18%).CONCLUSÃO: Assim, conclui-se a partir da análise parcial dos resultados de que cefaleia é o evento adverso mais comum após vacinação contra SARS-CoV-2. O perfil dos pacientes com mais notificações foi de mulheres pardas com idade entre 30 e 40 anos que receberam a primeira dose da vacina Covid-19-Covishield-Oxford/AstraZeneca. Quanto à gravidade dos eventos, a grande maioria foi considerada não grave e não foram mencionados óbitos, demonstrando a segurança dos imunobiológicos.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

Modeling risks in marine protected areas: Mapping of habitats, biodiversity, and cultural ecosystem services in the southernmost atlantic coral reef.

Marine Protected Area (MPA) is a fundamental strategy for the maintenance of ocean ecological processes worldwide and, consequently, their associated ecosystem services. Nevertheless, the quality of the services provided by MPAs, including cultural services such as recreational activities, depends on the effective management of marine habitats and biodiversity. Here, we performed an ecosystemic assessment in reef environments within a subtropical MPA, modeling the potential risks for their habitats and their recreational activities. The Queimada Grande Island (QGI), southeastern Brazil, was used as the model area since this island encompasses a unique and irreplaceable marine habitat, the Southernmost Atlantic coral reef. We firstly assessed and mapped the habitats, the biodiversity, and the recreational activities associated with QGI reefs. Next, we considered different scenarios of management for the modeling risks across the study area. We found that the coral reef and its adjacent habitats, such as the rhodolith bed, make the sheltered face of the island an important area for the provision of the cultural ecosystem services and overlapping uses such as onboard recreational fishing, spearfishing, and recreational diving. This area was also evaluated as the one under the highest risk of impact, considering the current scenario of management. The most successful scenario modeling to reduce these risks was the hypothetical implementation of a 66% reduction of all activities over all QGI habitats. Despite that, the scenario simulating the application of the regulations present in the MPA management plan was enough to reduce almost half the maximum risk value. Therefore, we concluded that to provide a balance among conservation, uses, and the local economy, the application of these regulations is the better management scenario modeled for the study area. Such results provided useful information and tools for local management and decision-making in this singular marine environment, also being an example for mapping ecosystem services and modeling risks in MPAs worldwide.

Assessing Paracetamol Overdose in Children: Acceptability and Potential Market for a Non-Invasive Testing Device.

Background: Assessment of paracetamol overdose in children and teenagers in the emergency department (ED) requires blood, taken 4 hours post ingestion. A commercial partner developed transdermal paracetamol measuring technology. This work aims to understand the acceptability of such a device, and potential market size. Methods: A questionnaire study was undertaken with children and parents attending Alder Hey Children's Hospital, and healthcare professionals (HCP) involved in their care. A retrospective audit of paracetamol ingestion presenting to a paediatric ED was undertaken. Results: One hundred forty-three questionnaires were distributed, and 139 returned (response rate 97.2%), comprising 55 children, 52 parents and 32 HCP (recruited between August-October 2019). Overall device acceptability, assessed by favourability of appearance and willingness to wear was high, at 60.0% and 81.5% respectively. Concerns raised included bulky size and weight, and concern regarding the duration younger children would tolerate wearing the device. All groups, including children, ranked accuracy of results as the most important device feature and device comfort the least important. Parents prioritised avoidance of blood tests more than children. One hundred twenty-seven children presented to ED with paracetamol ingestion (September 2017-August 2018), with 57 (44.9%) categorised as accidental overdose. Overall, 106 (83.4%) required paracetamol concentration measuring, and 25 (19.7%) of these required treatment with N-acetylcysteine. Extrapolating nationally, over 7000 children will present with accidental overdose per annum in the UK. Conclusion: Acceptability of a non-invasive paracetamol sensor was high in all groups, provided accuracy could be assured.

Feeding behaviour, locomotion rhythms and blood biochemistry of the neotropical red-tail catfish (Phractocephalus hemioliopterus).

The study evaluated the feeding behaviour of Phractocephalus hemioliopterus through the animals' ability to adapt to the self-feeding system, their preferred feeding times and locomotor activity, as well as the blood biochemistry of juveniles fed in a light/dark cycle. The study was carried out through two experiments, the first of which contained two phases. In experiment 1 - phase I, 24 juveniles (35.28 ± 0.62 g) were distributed in eight 48 l tanks. The tanks were equipped with a self-feeding system and the experiment consisted of evaluating whether the animals were able to adapt to the self-feeding system, as well as evaluating the preferred feeding times and locomotor activity of these animals. A feeding challenge to the animals was introduced in phase II, based on the results of phase I. The results of the first phase evidenced a nocturnal feeding preference. Thus, the feeding challenge consisted of measuring whether the animal would feed during the day and how long it would take to adapt. When the animals consumed 100% of the amount of feed provided daily, phase II was ended. In experiment 2, 24 juveniles of P. hemioliopterus (182.00 ± 14.03 g) were distributed in eight 96 l tanks. This experiment consisted of two treatments with four repetitions, one with exclusive feeding during the middle of the light cycle and another with exclusive feeding in the middle of the dark cycle. At the end, blood samples were collected from the animals for blood biochemistry evaluations. In experiment 1 - phase I, the results showed that the fish adapted very well to the self-feeding system and had a strictly nocturnal feeding behaviour and locomotor rhythm. When they were submitted to the feeding challenge in phase II, the feed intake was stabilized from the 17th day onwards, proportionally to the nocturnal consumption observed in the first phase, thus demonstrating feeding plasticity. In experiment 2, the feeding times influenced the animals' biochemical parameters. Animals fed during the night had higher values of cholesterol and triglycerides than animals fed during the day. It is concluded that P. hemioliopterus has fast adaptability to a self-feeding system, with strictly nocturnal feeding and locomotor behaviours. However, it has feeding plasticity, adapting its behaviour according to food availability. Blood biochemical parameters are influenced by the light/dark feeding cycle.

Audiovisual and printed technology to prevent childhood diarrhea: A clinical trial.

OBJECTIVE: To compare the effect of using an educational booklet and a video alone or together in promoting maternal self-efficacy to prevent childhood diarrhea. DESIGN AND SAMPLE: Randomized multicenter clinical trial with 522 mothers of children under 5 years of age from northeastern Brazil. They were allocated into eight groups, according to the city: metropolis - video alone (N = 61), booklet alone (N = 60), booklet and video along (N = 60), without intervention (N = 60); countryside - booklet alone (N = 70), video alone (N = 70), booklet and video along (N = 71), without intervention (N = 70). MEASUREMENTS: A sociodemographic form and the Maternal Self-Efficacy Scale for preventing early childhood diarrhea. RESULTS: Increases in self-efficacy scores were observed in all experimental groups after the educational intervention. Urban mothers living had greater self-efficacy than rural mothers. This result was verified in the video alone group (p = .036) and without intervention group (p = .003). Mothers in all intervention groups, regardless of the educational intervention used, had higher self-efficacy scores than the comparison group mothers (p < .05). CONCLUSION: The tested educational technologies promoted maternal self-efficacy to prevent childhood diarrhea, regardless of whether they are applied alone or in combination.

O "novo normal" na atividade física e saúde: pandemias e uberização? / The 'new normal' in physical activity and health: pandemics and uberization? / La 'nueva normalidad' en la actividad física y la salud: ¿pandemias y uberización?

Resumo A atividade física tem relevante lugar na agenda da Saúde Pública e foi muito acionada durante a pandemia da Covid-19. Com o objetivo de discutir o "novo normal" na atividade física e saúde, por meio de texto em caráter ensaístico, são abordadas a existência de duas pandemias - a de inatividade física e a de Covid-19 - e a perspectiva de ocorrer o processo de uberização. Ampliar a prática de atividade física é necessário, mas com cautela sobre o discurso da vida ativa, acima e apesar de tudo. Já a uberização, se confirmada, possivelmente terá repercussões negativas para o trabalhador, profissional/professor de Educação Física, e não garantirá a ampliação referida. Por fim, o "novo normal", localizado temporalmente com elementos analíticos até junho de 2020, reforça a necessidade de redução de iniquidades com o objetivo de ampliar possibilidades de construção de modos de vida saudável nos quais a atividade física estará incluída.

Abstract Physical activity plays a relevant role in the Public Health agenda and was often resorted to during the Covid-19 pandemic. This essay discusses the 'new normal' in physical activity and health, the existence of two pandemics - physical inactivity and Covid-19 - and the perspective of the uberization process. The practice of physical activities must be expanded but with caution about the discourse on having an active life above and despite everything. On the other hand, uberization, if confirmed, will probably cause negative impacts on workers and Physical Education professionals/teachers without guaranteeing that expansion. Finally, the 'new normal,' analytically situated until June 2020, reinforces the need to reduce health inequalities in order to expand possibilities for building healthy lifestyles in which physical activity will be included.

Resumen La actividad física ocupa un lugar relevante en la agenda de la Salud Pública y ha sido muy mencionada durante la pandemia de Covid-19. Con el objetivo de discutir la 'nueva normalidad' en la actividad física y la salud, este ensayo aborda la existencia de dos pandemias, la de inactividad física y la de Covid-19, y la posibilidad de que ocurra un proceso de uberización. Es necesario expandir la práctica de actividad física, pero con cautela en lo que se refiere al discurso de la vida activa por encima y a pesar de todo. En cuanto a la uberización, si se confirma, posiblemente tendrá repercusiones negativas para el trabajador, profesional/profesor de Educación Física, y no garantizará la expansión mencionada. Finalmente, la 'nueva normalidad', ubicada temporalmente con elementos analíticos hasta junio de 2020, refuerza la necesidad de reducir las inequidades para poder ampliar las posibilidades de construir estilos de vida saludables en los que la actividad física esté incluida.

Discursos de instituições de saúde brasileiras sobre atividade física no início da pandemia de COVID-19 / Discourses of Brazilian health institutions on physical activity at the beginning of the COVID-19 pandemic

Este estudo objetiva analisar os discursos produzidos por instituições de saúde sobre atividade física no início da pandemia de COVID-19 (março e começo de abril) no Brasil. Foi realizado um estudo documental a partir de sites de instituições de saúde, com o aporte teórico-metodológico inspirado nos estudos foucaultianos a partir do entrelaçamento da noção de discurso e seu impacto no governo das condutas. Foram compiladas 17 comunicações, sendo três de instituições governamentais, nove de sociedades médicas e cinco da educação física. Os primeiros comunicados abordaram a higiene pessoal e de equipamentos, referentes a locais fechados e em seguida a restrição de atividade física em tais espaços, indicando o domicílio para a realização das práticas. Assim, houve predomínio da atividade física em sua vertente biológica especialmente na estimativa de afetar a função imunológica. Problematizamos os discursos a partir da noção do governo das condutas, onde indivíduos e famílias foram acionados a praticar atividade física em casa, sem garantia de instrumentalização e acesso ao conhecimento e profissionais desta área

The aim of this article is to analyze discourses produced by health institutions regarding physical activity in the beginning of the COVID-19 pandemic (March and early April) in Brazil. A documentary study was carried out using websites of health institutions. The process were theoretical-methodological support inspired in Foucault's studies based on the intertwining notion of discourse and its impact on the conduct of the government. A total of 17 documents were compiled, three from government institutions, nine from medical societies and five from physical education institutions. The first documents addressed the personal and equipment hygiene concerning closed places, the following communications were about restricting physical activities in these places, finally recommending the performance of these activities at home. Therefore, physical activity predominated in its biological perspective, especially affecting immune function. The problematization of the discourses was carried out based on the governmentality notion in which individuals and families were triggered to practice physical activities at home without instrumentalization, access to knowledge and to physical education professionals

Cucurbit aphid-borne yellows virus from melon plants in Brazil is an interspecific recombinant.

Melon plants with severe yellowing symptoms from in Brazil were analyzed by high-throughput sequencing. Sequences homologous to the genome of the polerovirus cucurbit aphid-borne yellows virus (CABYV) were frequently retrieved. Two draft CABYV genomes were assembled from two pooled melon samples that contained an identical putative recombinant fragment in the 3' region with an unknown polerovirus. The complete genomes of these isolates revealed by Sanger sequencing share 96.8% nucleotide identity, while both sequences share 73.7% nucleotide identity with a CABYV-N isolate from France. A molecular-clock analysis suggested that CABYV was introduced into Brazil ~ 68 years ago.

A inclusão, a escola e a subjetivação docente: analisando o contexto do município do rio grande 1 / Inclusion, school and teaching subjectivity: analyzing the context of rio grande city

RESUMO: Há uma proliferação discursiva da inclusão como algo ético e benevolente, especialmente, nos discursos educacionais. Fundamentadas no pós-estruturalismo, notamos como os jogos de saber-poder-verdade instituem regimes discursivos que constrangem os indivíduos a agirem de determinados modos, constituindo subjetividades. Objetivamos analisar os discursos acerca da inclusão escolar e perceber como eles vêm produzindo formas de ser professor. A partir da aplicação de questionários a formandos de cursos de licenciatura e professores da Educação Básica, foi possível perceber que: a) o papel atribuído à escola, muitas vezes, se resume aos processos de socialização e à adequação física e material do espaço e; b) o papel do professor é descrito a partir do que denominamos subjetividades docentes contemporâneas, traduzidas em um sujeito docente, moral, mediador e responsável pelo sucesso/fracasso da inclusão. Assim, percebemos que esses discursos constituem subjetividades docentes contemporâneas que se curvam ao pressuposto da inclusão como um imperativo de Estado.

ABSTRACT: There is a discursive proliferation of school inclusion as something ethical and benevolent, especially in educational speeches. Based on post-structuralism, we note how the relation between knowledge-power-truth establishing discursive regimes that constrain individuals to act in certain subjective ways. Thus, we aimed to analyze the discourses about school inclusion and to understand how they have produced ways of being a teacher. The work uses the application of the questionnaires to graduates from degree courses and teachers of Basic Education. The results have revealed that: a) the role assigned to school often comes down to the socialization processes and physical and material appropriateness of space and; b) the teacher's role is described from what we call contemporary teaching subjectivity, translated into a moral teacher, mediator and responsible for the success/failure of school inclusion. Therefore, we realize that these speeches are contemporary teaching subjectivity who bow to the inclusion assumption as a State imperative.

Inclusão e educação física no município de Rio Grande: reflexões sobre as percepções dos educandos com deficiência / Inclusion and physical education in Rio Grande city: reflections about perceptions of students with disabilities / Inclusión y educación física en la ciudad de Rio grande: Reflexiones sobre las percepciones de los estudiantes con Discapacidad

Resumo: Este artigo tem por objetivo identificar e refletir sobre as percepções dos educandos com deficiência a respeito do seu processo de inclusão nas aulas de Educação Física na rede municipal da cidade do Rio Grande/RS. Participaram do estudo três alunos dos anos finais, que têm o acompanhamento de um monitor. Realizamos três observações, registradas em diário de campo e uma entrevista semiestruturada para cada um dos entrevistados. Para análise de dados foram criadas três categorias: mecanismos de in/exclusão, processos de vigilância e a normalização do anormal. Como ferramentas teórico-metodológicas utilizamos os Estudos Foucaultianos, principalmente os conceitos que versam sobre norma, normação e normalização. Como apontamentos desta pesquisa podemos refletir sobre o modo como os processos de inclusão se instalam como um imperativo, provocando professores e monitores a trabalharem como normatizadores e normalizadores de alunos com deficiência, os quais percebem o processo como positivo. (AU)

Abstract: This article aims to identify perceptions of students with disabilities about their process of inclusion in Physical Education classes in public schools of the city of Rio Grande. Participants included three students from the final years, who were followed by monitors. Three observations recorded in a field diary and a semi-structured interview were performed for each of the respondents. Three categories were created: inclusion/ exclusion mechanisms; monitoring procedures; and normalization of the abnormal, which were analyzed based on Foucault's studies, specially concepts of norm, normation and normalization. This research looks into how inclusion processes are established as imperatives and lead teachers to work as normatizers and normalizers of students with disabilities, who perceive the process as positive. (AU)

Resumen: Ese artículo tiene por objetivo identificar y reflexionar sobre las percepciones de los educandos con deficiencia en lo que se refiere a su proceso de inclusión en las clases de Educación Física en la red pública de la ciudad de Rio Grande. Participaron del estudio tres alumnos, de los años finales, que son acompañados por un monitor. Realizamos tres observaciones, registradas en un diario de campo y una entrevista semiestructurada para cada uno de los entrevistados. Para el análisis de los datos fueron creadas tres categorías: mecanismos de in/exclusión, procesos de vigilancia y la normalización de lo anormal. Como herramientas teórico-metodológicas utilizamos los Estudios Foucaultianos, principalmente los conceptos que versan sobre norma, normatización y normalización. En esta investigación, podemos reflexionar sobre el modo en que se instalan los procesos de inclusión, como un imperativo, obligando a que profesores y monitores trabajen como normatizadores y normalizadores de estudiantes con discapacidad, que perciben el proceso como positivo. (AU)

PEGylation: a successful approach to improve the biopharmaceutical potential of snake venom thrombin-like serine protease.

PEGylation is considered a successful technique to enhance the therapeutic and biotechnological potentials of peptides, proteins, toxins and drugs. The conjugation of polyethylene glycol (PEG) increases the size and molecular weight of conjugated molecule and improves its pharmacokinetics and pharmacodinamics by increasing water solubility, protecting from enzymatic degradation, reducing renal clearance and limiting immunogenic and antigenic reactions. These features are very useful for therapeutic proteins, since PEGylated proteins exhibit high stability and very low immunogenicity, ensuring a sustained clinical response with minimal dose and less frequent administration. The modification of snake venom toxins by PEGylation is a promising strategy to increase the use of these biomolecules in clinical practice, which has been limited by side effects of immune reactions in patients. Thrombin-like serine protease from Crotalus durissus collilineatus (SPCdc) is able to convert fibrinogen into fibrin and presents potential therapeutic application in cases of myocardial infarction, ischemic stroke and other thrombotic and vascular disorders. In this study we modified the SPCdc by site-specific PEGylation, producing the unique conjugate of molecular mass around 35 kDa, named SPCdc-PEG. Unexpectedly, the Km of the PEGylated enzyme (Km = 0.447 mM ± 0.025) was smaller than that of the native enzyme (Km = 0.770 mM ± 0.020), indicating that PEG-SPCdc has a higher affinity for the substrate TAME than SPCdc. Additionally, the values of Kcat/Km (1163 mM.min-1, for SPCdc-PEG and 350 mM.min-1, for SPCdc) showed that PEGylated enzyme has higher catalytic efficiency than the native form. These results demonstrated the relevant biopharmaceutical potential of SPCdc-PEG.

O cuidado das amas-de-leite e o protagonismo do negro na história da enfermagem: uma luta por equidade / The care of wet-nurses and the role of blacks in the history of nursing: a fight for fairness

Objetiva-se com esse estudo sistematizar referências relacionadas ao cuidado das amas-de-leite,ao racismo e ao legado deixado por grandes ícones negros da Enfermagem. Estudo descritivo com abordagem qualitativa, realizado a partir de uma pesquisa integrativa. A coleta de dados ocorreu nos meses de agosto e setembro de 2014. A técnica utilizada na pesquisa para obtenção dos dados foi por meio de um levantamento bibliográfico junto às bases de dados SciELO, Google Acadêmicoe EBSCO-HOST, que proporcionaram acesso aos periódicos e artigos científicos, a partir dos descritores: “aleitamento materno”, “cuidado da criança”, “história da enfermagem”. “racismo”,publicados em português, com recorte atemporal. Deve-se valorizar os diversos atores sociais que foram e constituem o conhecimento sobre o cuidado de Enfermagem, visando à emancipação do pensamento como forma de questionar o mundo, lutar contra preconceitos, iniquidades e injustiças.

Sense of place as a determinant of people's attitudes towards the environment: implications for natural resources management and planning in the Great Barrier Reef, Australia.

Integrating people's values and perceptions into planning is essential for the successful management of natural resources. However, successful implementation of natural resources management decisions on the ground is a complex task, which requires a comprehensive understanding of a system's social and ecological linkages. This paper investigates the relationship between sense of place and people's attitudes towards their natural environment. Sense of place contributes towards shaping peoples' beliefs, values and commitments. Here, we set out to explore how these theoretical contributions can be operationalized for natural resources management planning in the Great Barrier Reef region of Australia. We hypothesise that the region's diverse range of natural resources, conservation values and management pressures might be reflected in people's attachment to place. To tests this proposition, variables capturing socio-demographics, personal wellbeing and a potential for sense of place were collected via mail-out survey of 372 residents of the region, and tested for relationships using multivariate regression and redundancy orientation analyses. Results indicate that place of residence within the region, involvement in community activities, country of birth and the length of time respondents lived in the region are important determinants of the values assigned to factors related to the natural environment. This type of information is readily available from National Census and thus could be incorporated into the planning of community engagement strategies early in the natural resources management planning process. A better understanding of the characteristics that allow sense of place meanings to develop can facilitate a better understanding of people's perceptions towards environmental and biodiversity issues. We suggest that the insights gained from this study can benefit environmental decision making and planning in the Great Barrier Reef region; and that sense of place is a concept worthy of further investigation elsewhere.

Chemical and enzymatic site specific PEGylation of hGH.

Several strategies for site-specific PEGylation have been successfully exploited to conjugate poly(ethylene glycol) (PEG) to pharmaceutical proteins. The advantages sought are those of improving efficacy and increasing the half-life of conjugated proteins while achieving a higher degree of homogeneity. Recombinant human growth hormone (hGH) was thus PEGylated exploiting two site-specific strategies: N-terminal PEGylation using the PEG20 kDa-aldehyde polymer and microbial transglutaminase (mTGase) mediated enzymatic PEGylation using PEG20 kDa-NH2. N-Terminal PEGylation of hGH was carried out by covalent attachment of PEG to the α-amine residue of Phe1 that yielded the monoconjugate PEG-Nter-hGH with a mass of 44152.2 Da, as measured by MALDI-TOF mass spectrometry. The mTGase mediated PEGylation, performed in a water/ethanol solution mixture, allowed a PEG coupling reaction only at the level of hGH Gln141, yielding the single monoconjugate PEG-Gln141-hGH with a mass of 44064.9 Da. Circular dichroism studies showed that both conjugation strategies preserved the native-like secondary structures of hGH. It is vital to maintain the structural integrity of hGH if PEGylated hGH is to be used in therapeutic applications. As expected, the pharmacokinetic profile in rats of PEG-Nter-hGH and PEG-Gln141-hGH revealed a significant increase in systemic exposure with respect to unmodified hGH. The conjugates showed a half-life increase of 4.5-fold with respect to hGH. These results demonstrate that both chemical and enzymatic site-selective PEGylation of hGH generates conjugates with a prolonged half-life.

Uma proposta de psicoterapia breve para paciente com escoriação psicogênica / A proposal to brief psychotherapy for patients with psychogenic excoriation / Una propuesta de psicoterapia breve para pacientes con excoriación psicogénica

Escoriação psicogênica é uma psicodermatose caracterizada poralteração cutânea com estreita ligação com processos mentais, mais comunsem mulheres. Gera considerável desconforto físico e psicossocial ao pacientepelas lesões formadas na pele. Os pacientes assumem lesionar a própria pele,o que diferencia este diagnóstico da dermatite factícia. Esse reconhecimentofavorece a inserção desses pacientes em processos psicoterápicos, incluindoas psicoterapias breves, que podem beneficiá-los, especialmente em contextohospitalar, como ambulatórios de hospitais especializados em dermatologia.Descreve-se, analisa-se e propõe-se psicoterapia dinâmica breve para umapaciente com escoriação psicogênica, apresentando-se o planejamento doprocesso terapêutico indicado para ela. Trata-se de estudo clinico de caso cominformes de prontuário medico, de entrevista psicológica e de resultados do IFP(Inventário Fatorial de Personalidade). Com base nesses dados propõe-sepsicoterapia breve, com foco, objetivos e tempo definidos, estabelecendo-seum planejamento terapêutico, de acordo com o recomendado nesse tipo detratamento. A principal meta é o alivio dos sintomas ao lado da promoção deautoconhecimento e insights, clarificando os mais importantes conflitospsicodinâmicos identificados. Sugere-se que o processo psicoterápico breveproposto poderá resultar em ganhos terapêuticos importantes para a pacienteanalisada(AU)

Psychogenic Excoriation is a psychodermatosis characterized by skinalterations connected to mental processes, which are more common in women.It generates a considerable physical and psychosocial discomfort to the patient,because of the skin lesions. These patients assume to injure their own skin, andit differentiates this diagnosis from the factual dermatitis. This acknowledgementfacilitates the insertion of these patients in psychotherapeutic processes, includingfast psychotherapy, which can benefit them, especially in hospital contexts suchas hospital ambulatories specialized in dermatology. Fast dynamicpsychotherapies are described, analyzed and recommended to a psychogenicexcoriation patient while introducing the process plan indicated to her. It relates tothe clinical study of cases with medical records, psycho interviews and results ofthe FPI (Factor Personality Inventory). Based on these data, a fast psychotherapyis suggested with defined focus, aim and time, with a therapeutic plan accordingto what’s recommended in this type of treatment. The main objective is thesymptom alleviation besides self-knowledge and insights, clarifying the mostimportant identified psychodynamic conflicts. It’s also suggested that thesuggested fast psychotherapy process could well result in important therapeuticgains to the analyzed patient(AU)

La excoriación psicogénica es una psicodermatosis caracterizadapor alteraciones cutáneas estrechamente vinculada a procesos mentales; seencuentra con más frecuencia en mujeres. Esta enfermedad, genera en elpaciente niveles considerables de malestar físico y psicosocial, por las lesionesformadas en la piel. La diferencia de este diagnóstico con el de dermatitis ficticia,es que en la excoriación psicogénica los pacientes se asumen responsables delas lesiones ocasionadas en la piel. Ese reconocimiento, favorece la inclusiónde estos pacientes en procesos psicoterapéuticos, lo que incluye la psicoterapiabreve, que puede ser beneficioso para ellos, especialmente en los contextoshospitalares de enfermidad de la piel, tales como sus ambulatorios. En estapropuesta, se describe, se analiza y se propone la psicoterapia dinámica brevepara una paciente con excoriación psicogénica, presentándose la planificacióndel proceso indicado para ella. Se trata de un estudio de caso clínico conformadopor informes médicos, entrevista psicológica y de los resultados del IFP(Inventario Factorial de la Personalidad). Con base a esas informaciones seproponen, objetivos y tiempo de tratamiento, estableciéndose el plan detratamiento terapéutico, según las recomendaciones para este tipo de caso. Laprincipal meta es el alivio de los síntomas en conjunto con la promoción delautoconocimiento y de insights, clarificando los conflictos psicodinámicos másimportantes identificados. Se sugiere que el proceso de psicoterapia brevepropuesto podrá tener resultados terapéuticos significativamente positivos parala paciente analizada(AU)

Características clínicas e sociodemográficas dos pacientes acometidos por insuficiência cardíaca / Clinical characteristics and sociodemográficas of patients acometidos for cardiac insufficience

Objetivo: levantar as características sociodemográficas dos pacientes portadores de insuficiência cardíaca (IC) eidentificar os fatores de risco modificáveis nos pacientes portadores de IC. Método: estudo descritivo, quantitativo,desenvolvido em hospital terciário de Fortaleza-CE. A população foi constituída por pacientes com IC hospitalizados, comamostra de 100 pacientes. Os dados foram coletados nos prontuários e em entrevista. Aprovado pelo comitê de ética sobparecer n.º 514/2008. Resultados: predominaram como características sociodemográficas: sexo masculino (63%); idade >60 anos (43%); presença de fatores hereditários (48%); casados (67%); aposentados (42%) e com renda familiar < 1 saláriomínimo (70%). Fatores de risco modificáveis detectados: hipertensão (61%); diabetes (22%); sobrepeso (40%); dislipidemia(18%); sedentários (82%); tabagistas (11%) e etilista (15%). Conclusão: conclui-se que conhecer o perfil da populaçãoportadora de IC é favorável para desenvolver estratégias de educação em saúde a fim de prevenir complicaçõescardiovasculares nas populações com fatores de risco.

Batch purification of high-purity lysozyme from egg white and characterization of the enzyme modified by PEGylation.

PEGylation is one of the most promising and extensively studied strategies for improving the pharmacological properties of proteins as well as their physical and thermal stability. Purified lysozyme obtained from hen egg white by batch mode was modified by PEGylation with methoxypolyethyleneglycol succinimidyl succinato (mPEG-SS, MW 5000). The conjugates produced retained full enzyme activity with the substrate glycol chitosan, independent of degree of enzyme modification, although lysozyme activity with the substrate Micrococcus lysodeikticus was altered according to the degree of modification. The conjugate with a low degree of modification by mPEG-SS retained 67% of its enzyme activity with the M. lysodeikticus substrate. The mPEG-SS was also shown to be a highly reactive polymer. The effects of pH and temperature on PEGylated lysozymes indicated that the conjugate was active over a wide pH range and was stable up to 50 degrees C. This conjugate also showed resistance to proteolytic degradation, remained stable in human serum, and displayed greater antimicrobial activity than native lysozyme against Gram-negative bacteria.

Biochemical and biophysical characterization of lysozyme modified by PEGylation.

PEGylation is a strategy that has been used to improve the biochemical properties of proteins and their physical and thermal stabilities. In this study, hen egg-white lysozyme (EC 3.2.1.17; LZ) was modified with methoxypolyethylene glycol-p-nitrophenyl carbonate (mPEG-pNP, MW 5000). This PEGylation of LZ produced conjugates that retained full enzyme activity with glycol chitosan, independent of degree of enzyme modification; its biological activity with the substrate Micrococcus lysodeikticus was altered according to its degree of modification. The conjugate obtained with a low degree of mPEG-pNP/NH(2) modification was studied by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF), demonstrating a spectral peak at m/z 19,988 Da with 77% of its original enzymatic activity. Spectroscopic studies of Fourier transform infrared (FTIR) and circular dichroism (CD) did not show any relevant differences in protein structure between the native and conjugate LZ. Studies of the effects of pH and temperature on PEGylated LZ indicated that the conjugate was active over a broad pH range, stable at 50 degrees C, and demonstrated resistance to proteolytic degradation.