The C-terminus of the P22 tailspike protein acts as an independent oligomerization domain for monomeric proteins.

TSP (P22 tailspike protein) is a well-established model system for studying the folding and assembly of oligomeric proteins, and previous studies have documented both in vivo and in vitro folding intermediates using this protein. Especially important is the C-terminus of TSP, which plays a critical role in the assembly and maturation of the protrimer intermediate to its final trimeric form. In the present study, we show that by grafting the C-terminus of TSP on to the monomeric MBP (maltose-binding protein), the resulting chimaera (MBP-537) is a trimeric protein. Moreover, Western blot studies (using an anti-TSP antibody) indicate that the TSP C-terminus in the MBP-537 chimaera has the same conformation as the native TSP. The oligomerization of the MBP-537 chimaera appears to involve hydrophobic interactions and a refolding sequence, both of which are analogous to the native TSP. These results underscore the importance of the TSP C-terminus in the assembly of the mature trimer and demonstrate its potential utility as a model to study the folding and assembly of the TSP C-terminus in isolation.

Coupling reactions of bromoalkynes with imidazoles mediated by copper salts: synthesis of novel N-alkynylimidazoles.

A cross-coupling reaction of imidazoles with bromoalkynes in the presence of a catalytic amount of CuI is reported. This protocol allows an access to novel N-(1-alkynyl)imidazoles in moderate to good yields.

Molecular modeling and biophysical analysis of the c-MYC NHE-III1 silencer element.

G-Quadruplex and i-Motif-forming sequences in the promoter regions of several oncogenes show promise as targets for the regulation of oncogenes. In this study, molecular models were created for the c-MYC NHE-III(1) (nuclease hypersensitivity element III(1)) from two 39-base complementary sequences. The NHE modeled here consists of single folded conformers of the polypurine intramolecular G-Quadruplex and the polypyrimidine intramolecular i-Motif structures, flanked by short duplex DNA sequences. The G-Quadruplex was based on published NMR structural data for the c-MYC 1:2:1 loop isomer. The i-Motif structure is theoretical (with five cytosine-cytosine pairs), where the central intercalated cytosine core interactions are based on NMR structural data obtained for a tetramolecular [d(A(2)C(4))(4)] model i-Motif. The loop structures are in silico predictions of the c-MYC i-motif loops. The porphyrin meso-tetra(N-methyl-4-pyridyl)porphine (TMPyP4), as well as the ortho and meta analogs TMPyP2 and TMPyP3, were docked to six different locations in the complete c-MYC NHE. Comparisons are made for drug binding to the NHE and the isolated G-Quadruplex and i-Motif structures. NHE models both with and without bound cationic porphyrin were simulated for 100 ps using molecular dynamics techniques, and the non-bonded interaction energies between the DNA and porphyrins calculated for all of the docking interactions.

Isothermal titration calorimetry: experimental design, data analysis, and probing macromolecule/ligand binding and kinetic interactions.

Isothermal titration calorimetry (ITC) is now routinely used to directly characterize the thermodynamics of biopolymer binding interactions and the kinetics of enzyme-catalyzed reactions. This is the result of improvements in ITC instrumentation and data analysis software. Modern ITC instruments make it possible to measure heat effects as small as 0.1 microcal (0.4 microJ), allowing the determination of binding constants, K's, as large as 10(8) - 10(9)M(-1). Modern ITC instruments make it possible to measure heat rates as small as 0.1 microcal/sec, allowing for the precise determination of reaction rates in the range of 10(-12) mol/sec. Values for K(m) and k(cat), in the ranges of 10(-2) - 10(3) microM and 0.05 - 500 sec(-1), respectively, can be determined by ITC. This chapter reviews the planning of an optimal ITC experiment for either a binding or kinetic study, guides the reader through simulated sample experiments, and reviews analysis of the data and the interpretation of the results.

Biophysical characterization of vaccinia virus thymidine kinase substrate utilization.

To provide information for the development of new antiviral compounds that inhibit orthopoxviruses, further characterization of the kinetics and thermodynamics that underlie substrate utilization reactions of vaccinia virus thymidine kinase (VVTK) has been undertaken. The kinetics of 2'deoxythymidine phosphorylation by VVTK and the thermodynamics of complex formation between VVTK and the substrate 2' deoxythymidine were determined using spectroscopic and calorimetric techniques. These studies demonstrated that kinetic parameters for 2' deoxythymidine phosphorylation by VVTK were 25 microM and 0.2s(-1) for K(m) and k(cat), respectively. The enthalpy change, Delta H, for the enzyme catalyzed reaction is -18.1 kcal/mol. Thermodynamic studies for the formation of the enzyme substrate complex demonstrated a binding affinity (K(a)) of 4 x 10(4)M(-1), an enthalpy change for binding (Delta H) of -17.4 kcal/mol, and a reaction stoichiometry of two molecules of substrate binding to each enzyme tetramer. Kinetic and thermodynamic data were in agreement (K(a) approximately 1/K(m)) and showed similarities to literature values reported for herpes simplex virus thymidine kinase (HSV-TK) and human thymidine kinase 1 (hTK1) with respect to k(cat) but not with respect to K(m). The K(m) value found for VVTK in this study is nearly two orders of magnitude larger than the values reported for the hTK1 and the HSV TK enzymes.

Break in the heat capacity change at 303 K for complex binding of netropsin to AATT containing hairpin DNA constructs.

Studies performed in our laboratory demonstrated the formation of two thermodynamically distinct complexes on binding of netropsin to a number of hairpin-forming DNA sequences containing AATT-binding regions. These two complexes were proposed to differ only by a bridging water molecule between the drug and the DNA in the lower affinity complex. A temperature-dependent isothermal titration calorimetry (ITC)-binding study was performed using one of these constructs (a 20-mer hairpin of sequence 5'-CGAATTCGTCTCCGAATTCG) and netropsin. This study demonstrated a break in the heat capacity change for the formation of the complex containing the bridging water molecule at approximately 303 K. In the plot of the binding enthalpy change versus temperature, the slope (DeltaCp) was -0.67 kcal mol-1 K-1 steeper after the break at 303 K. Because of the relatively low melting temperature of the 20-mer hairpin (341 K (68 degrees C)), the enthalpy change for complex formation might have included some energy of refolding of the partially denatured hairpin, giving the suggestion of a larger DeltaCp. Studies done on the binding of netropsin to similar constructs, a 24-mer and a 28-mer, with added GC basepairs in the hairpin stem to increase thermal stability, exhibit the same nonlinearity in DeltaCp over the temperature range of from 275 to 333 K. The slopes (DeltaCp) were -0.69 and -0.64 kcal mol-1 K-1 steeper after 303 K for the 24-mer and 28-mer, respectively. This observation strengthens the argument regarding the presence of a bridging water molecule in the lower affinity netropsin/DNA complex. The DeltaCp data seem to infer that because the break in the heat capacity change function for the lower affinity binding occurs at the isoequilibrium temperature for water, water may be included or trapped in the complex. The fact that this break does not occur in the heat capacity change function for formation of the higher affinity complex can similarly be taken as evidence that water is not included in the higher affinity complex.

Biophysical studies of the c-MYC NHE III1 promoter: model quadruplex interactions with a cationic porphyrin.

Regulation of the structural equilibrium of G-quadruplex-forming sequences located in the promoter regions of oncogenes by the binding of small molecules has shown potential as a new avenue for cancer chemotherapy. In this study, microcalorimetry (isothermal titration calorimetry and differential scanning calorimetry), electronic spectroscopy (ultraviolet-visible and circular dichroism), and molecular modeling were used to probe the complex interactions between a cationic porphryin mesotetra (N-methyl-4-pyridyl) porphine (TMPyP4) and the c-MYC PU 27-mer quadruplex. The stoichiometry at saturation is 4:1 mol of TMPyP4/c-MYC PU 27-mer G-quadruplex as determined by isothermal titration calorimetry, circular dichroism, and ultraviolet-visible spectroscopy. The four independent TMPyP4 binding sites fall into one of two modes. The two binding modes are different with respect to affinity, enthalpy change, and entropy change for formation of the 1:1 and 2:1, or 3:1 and 4:1 complexes. Binding of TMPyP4, at or near physiologic ionic strength ([K(+)] = 0.13 M), is described by a "two-independent-sites model." The two highest-affinity sites exhibit a K(1) of 1.6 x 10(7) M(-1) and the two lowest-affinity sites exhibit a K(2) of 4.2 x 10(5) M(-1). Dissection of the free-energy change into the enthalpy- and entropy-change contributions for the two modes is consistent with both "intercalative" and "exterior" binding mechanisms. An additional complexity is that there may be as many as six possible conformational quadruplex isomers based on the sequence. Differential scanning calorimetry experiments demonstrated two distinct melting events (T(m)1 = 74.7 degrees C and T(m)2 = 91.2 degrees C) resulting from a mixture of at least two conformers for the c-MYC PU 27-mer in solution.

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques.

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.