Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 16 de 16
Filter
1.
Clin Genet ; 87(5): 461-6, 2015 May.
Article in English | MEDLINE | ID: mdl-24805811

ABSTRACT

Alpha-thalassemia intellectual disability, one of the recognizable X-linked disability syndromes, is characterized by short stature, microcephaly, distinctive facies, hypotonic appearance, cardiac and genital anomalies, and marked skewing of X-inactivation in female carriers. With the advent of next generation sequencing, mutations have been identified that result in less severe phenotypes lacking one or more of these phenotypic manifestations. Here we report five unrelated kindreds in which a c.109C>T (p.R37X) mutation segregates with a variable but overall milder phenotype. The distinctive facial appearance of alpha-thalassemia intellectual disability was present in only one of the 18 affected males evaluated beyond the age of puberty, although suggestive facial appearance was present in several during infancy or early childhood. Although the responsible genetic alteration is a nonsense mutation in exon 2 of ATRX, the phenotype appears to be partially rescued by the production of alternative transcripts and/or other molecular mechanisms.


Subject(s)
Alleles , Codon, Nonsense , DNA Helicases/genetics , Mental Retardation, X-Linked/diagnosis , Mental Retardation, X-Linked/genetics , Nuclear Proteins/genetics , Phenotype , alpha-Thalassemia/diagnosis , alpha-Thalassemia/genetics , Adolescent , Child , Child, Preschool , Facies , Female , Genes, X-Linked , Heterozygote , Humans , Infant , Male , Pedigree , X-linked Nuclear Protein , Young Adult
2.
Transl Psychiatry ; 3: e316, 2013 Oct 22.
Article in English | MEDLINE | ID: mdl-24150225

ABSTRACT

Single nucleotide variants (SNV) in the gene encoding the MET receptor tyrosine kinase have been associated with an increased risk for autism spectrum disorders (ASD). The MET promoter SNV rs1858830 C 'low activity' allele is enriched in ASD, associated with reduced protein expression, and impacts functional and structural circuit connectivity in humans. To gain insight into the transcriptional regulation of MET on ASD-risk etiology, we examined an interaction between the methyl CpG-binding protein 2 (MeCP2) and the MET 5' promoter region. Mutations in MeCP2 cause Rett syndrome (RTT), a predominantly female neurodevelopmental disorder sharing some ASD clinical symptoms. MeCP2 binds to a region of the MET promoter containing the ASD-risk SNV, and displays rs1858830 genotype-specific binding in human neural progenitor cells derived from the olfactory neuroepithelium. MeCP2 binding enhances MET expression in the presence of the rs1858830 C allele, but MET transcription is attenuated by RTT-specific mutations in MeCP2. In the postmortem temporal cortex, a region normally enriched in MET, gene expression is reduced dramatically in females with RTT, although not due to enrichment of the rs1858830 C 'low activity' allele. We newly identified a sex-based reduction in MET expression, with male ASD cases, but not female ASD cases compared with sex-matched controls. The experimental data reveal a prominent allele-specific regulation of MET transcription by MeCP2. The mechanisms underlying the pronounced reduction of MET in ASD and RTT temporal cortex are distinct and likely related to factors unique to each disorder, including a noted sex bias.


Subject(s)
Autistic Disorder/genetics , Gene Expression Regulation/genetics , Methyl-CpG-Binding Protein 2/genetics , Proto-Oncogene Proteins c-met/genetics , Rett Syndrome/genetics , Temporal Lobe/metabolism , Autistic Disorder/metabolism , Female , Genotype , Humans , Male , Methyl-CpG-Binding Protein 2/metabolism , Mutation , Neuroepithelial Cells/metabolism , Phenotype , Polymorphism, Single Nucleotide , Promoter Regions, Genetic , Real-Time Polymerase Chain Reaction , Rett Syndrome/metabolism , Sex Factors
3.
J Med Genet ; 47(1): 38-48, 2010 Jan.
Article in English | MEDLINE | ID: mdl-19617216

ABSTRACT

BACKGROUND: Mucolipidoses II and III alpha/beta (ML II and ML III) are lysosomal disorders in which the essential mannose 6-phosphate recognition marker is not synthesised on to lysosomal hydrolases and other glycoproteins. The disorders are caused by mutations in GNPTAB, which encodes two of three subunits of the heterohexameric enzyme, N-acetylglucosamine-1-phosphotransferase. OBJECTIVES: Clinical, biochemical and molecular findings in 61 probands (63 patients) are presented to provide a broad perspective of these mucolipidoses. METHODS: GNPTAB was sequenced in all probands and/or parents. The activity of several lysosomal enzymes was measured in plasma, and GlcNAc-1-phosphotransferase was assayed in leucocytes. Thirty-six patients were studied in detail, allowing extensive clinical data to be abstracted. RESULTS: ML II correlates with near-total absence of phosphotransferase activity resulting from homozygosity or compound heterozygosity for frameshift or nonsense mutations. Craniofacial and orthopaedic manifestations are evident at birth, skeletal findings become more obvious within the first year, and growth is severely impaired. Speech, ambulation and cognitive function are impaired. ML III retains a low level of phosphotransferase activity because of at least one missense or splice site mutation. The phenotype is milder, with minimal delays in milestones, the appearance of facial coarsening by early school age, and slowing of growth after the age of 4 years. CONCLUSIONS: Fifty-one pathogenic changes in GNPTAB are presented, including 42 novel mutations. Ample clinical information improves criteria for delineation of ML II and ML III. Phenotype-genotype correlations suggested in more general terms in earlier reports on smaller groups of patients are specified and extended.


Subject(s)
Mucolipidoses/diagnosis , Mucolipidoses/genetics , Transferases (Other Substituted Phosphate Groups)/genetics , Child, Preschool , Female , Genotype , Humans , Infant , Male , Mutation , Phenotype
4.
J Med Genet ; 46(1): 9-13, 2009 Jan.
Article in English | MEDLINE | ID: mdl-18805826

ABSTRACT

BACKGROUND: FG syndrome (FGS) is an X-linked disorder characterised by mental retardation, hypotonia, particular dysmorphic facial features, broad thumbs and halluces, anal anomalies, constipation, and abnormalities of the corpus callosum. A behavioural phenotype of hyperactivity, affability, and excessive talkativeness is very frequent. The spectrum of clinical findings attributed to FGS has widened considerably since the initial description of the syndrome by Opitz and Kaveggia in 1974 and has resulted in clinical variability and genetic heterogeneity. In 2007, a recurrent R961W mutation in the MED12 gene at Xq13 was found to cause FGS in six families, including the original family described by Opitz and Kaveggia. The phenotype was highly consistent in all the R961W positive patients. METHODS: In order to determine the prevalence of MED12 mutations in patients clinically diagnosed with FGS and to clarify the phenotypic spectrum of FGS, 30 individuals diagnosed previously with FGS were evaluated clinically and by MED12 sequencing. RESULTS: The R961W mutation was identified in the only patient who had the typical phenotype previously associated with this mutation. The remaining 29 patients displayed a wide variety of features and were shown to be negative for mutations in the entire MED12 gene. A definite or possible alternative diagnosis was identified in 10 of these patients. CONCLUSION: This report illustrates the difficulty in making a clinical diagnosis of FGS given the broad spectrum of signs and symptoms that have been attributed to the syndrome. Individuals with a phenotype consistent with FGS require a thorough genetic evaluation including MED12 mutation analysis. Further genetic testing should be considered in those who test negative for a MED12 mutation to search for an alternative diagnosis.


Subject(s)
Abnormalities, Multiple/diagnosis , Abnormalities, Multiple/genetics , Mental Retardation, X-Linked/diagnosis , Mental Retardation, X-Linked/genetics , Abnormalities, Multiple/pathology , Adolescent , Amino Acid Substitution , Child , Child, Preschool , Female , Humans , Male , Mediator Complex , Mental Retardation, X-Linked/pathology , Muscle Hypotonia/diagnosis , Muscle Hypotonia/genetics , Muscle Hypotonia/pathology , Mutation , Phenotype , Receptors, Thyroid Hormone/genetics , Syndrome
5.
Neurology ; 67(1): 164-6, 2006 Jul 11.
Article in English | MEDLINE | ID: mdl-16832102

ABSTRACT

MECP2 mutations mainly occur in females with Rett syndrome. Mutations have been described in 11 boys with progressive encephalopathy: seven of nine with affected sisters and two de novo. The authors report four de novo occurrences: three pathogenic and one potentially pathogenic. Common features include failure to thrive, respiratory insufficiency, microcephaly, and abnormal motor control. MECP2 mutations should be assessed in boys with progressive encephalopathy and one or more of respiratory insufficiency, abnormal movements or tone, and intractable seizures.


Subject(s)
Methyl-CpG-Binding Protein 2/genetics , Mutation , Rett Syndrome/genetics , Cerebral Cortex/pathology , Child, Preschool , DNA Mutational Analysis , Humans , Infant , Magnetic Resonance Imaging/methods , Male , Rett Syndrome/pathology , Rett Syndrome/physiopathology
6.
Clin Genet ; 69(5): 414-9, 2006 May.
Article in English | MEDLINE | ID: mdl-16650080

ABSTRACT

Mutations in the L1CAM gene cause neurological abnormalities of variable severity, including congenital hydrocephalus, agenesis of the corpus callosum, spastic paraplegia, bilaterally adducted thumbs, aphasia, and mental retardation. Inter- and intrafamilial variability is a well-known feature of the L1CAM spectrum, and several patients have a combination of L1CAM mutations and Hirschsprung's disease (HSCR). We report on two siblings with a missense mutation in exon 7 (p.P240L) of the L1CAM gene. In one of the siblings, congenital dislocation of the radial heads and HSCR were present. Neither patient had hydrocephalus, adducted thumbs, or absent speech, but both had a hypoplastic corpus callosum. We suggest that L1CAM mutation testing should be considered in male patients with a positive family history compatible with X-linked inheritance and either the combination of agenesis of the CC and HSCR or the combination of agenesis of the CC and limb abnormalities, including abnormalities other than adducted thumbs.


Subject(s)
Agenesis of Corpus Callosum , Hirschsprung Disease/diagnosis , Neural Cell Adhesion Molecule L1/genetics , Radius/abnormalities , Adolescent , Child , Child, Preschool , DNA Mutational Analysis , Elbow Joint/abnormalities , Elbow Joint/diagnostic imaging , Hirschsprung Disease/genetics , Humans , Infant , Joint Dislocations/congenital , Joint Dislocations/diagnostic imaging , Male , Mutation, Missense , Pedigree , Phenotype , Radiography , Radius/diagnostic imaging
7.
Rev. méd. hondur ; 73(2): 77-82, abr.-jun. 2005. ilus
Article in Spanish | LILACS | ID: lil-444213

ABSTRACT

El síndrome de Rett es un trastorno del neurodesarrollo caracterizado por regresión en el desarrollo psicomotor con manifestaciones autísticas, desaceleración del crecimiento de la cabeza, convulsiones, pérdidas de las funciones propositivas manuales y movimientos repetitivos esteotipados de las manos. Ocurre predominantemente en mujeres, es causado por una mutación en el gen que codifica para la proteína ligadora de metil-CpG-2(MECP-2). Presentamos el caso de una niña de 9 años de edad que era normal hasta los 6 meses, fecha a partir de la cual inicia un cuadro emético crónico, seguido tiempo después con retraso psicomotor, pérdida de las habilidades adquiridas, además de movimientos estereotipados de las manos y crisis convulsiva. El estudio de ADN para la mutación del gen de MECP-2 confirmó el diagnóstico de síndrome de Rett. La presentación y el curso de nuestra paciente deben de alertarnos sobre la posibilidad de síndrome de Rett como diagnóstico diferencial en niños hondureños con enfermedad de neurodegenerativa en los primeros dos años de vida...


Subject(s)
Female , Mutation/genetics , Rett Syndrome/cerebrospinal fluid , Epilepsy/complications , Epilepsy/diagnosis , Autistic Disorder/diagnosis
8.
Rev. méd. hondur ; 73(2): 77-82, abr.-jun. 2005. ilus
Article in Spanish | BIMENA | ID: bim-4833

ABSTRACT

El síndrome de Rett es un trastorno del neurodesarrollo caracterizado por regresión en el desarrollo psicomotor con manifestaciones autísticas, desaceleración del crecimiento de la cabeza, convulsiones, pérdidas de las funciones propositivas manuales y movimientos repetitivos esteotipados de las manos. Ocurre predominantemente en mujeres, es causado por una mutación en el gen que codifica para la proteína ligadora de metil-CpG-2(MECP-2). Presentamos el caso de una niña de 9 años de edad que era normal hasta los 6 meses, fecha a partir de la cual inicia un cuadro emético crónico, seguido tiempo después con retraso psicomotor, pérdida de las habilidades adquiridas, además de movimientos estereotipados de las manos y crisis convulsiva. El estudio de ADN para la mutación del gen de MECP-2 confirmó el diagnóstico de síndrome de Rett. La presentación y el curso de nuestra paciente deben de alertarnos sobre la posibilidad de síndrome de Rett como diagnóstico diferencial en niños hondureños con enfermedad de neurodegenerativa en los primeros dos años de vida...(AU)


Subject(s)
Female , Rett Syndrome/cerebrospinal fluid , Mutation/genetics , Autistic Disorder/diagnosis , Epilepsy/complications , Epilepsy/diagnosis , Seizures/cerebrospinal fluid , Seizures/diagnosis
9.
Genet Med ; 6(5): 421-5, 2004.
Article in English | MEDLINE | ID: mdl-15371907

ABSTRACT

PURPOSE: We expect that the mutation panel currently recommended for preconception/prenatal CF carrier screening will be modified as new information is learned regarding the phenotype associated with specific mutations and allele frequencies in various populations. One such example is the I148T mutation, originally described as a severe CF mutation. After implementation of CF population-based carrier screening, we learned that I148T exists as a complex allele with 3199del6 in patients with clinical CF, whereas asymptomatic compound heterozygotes for I148T and a second severe CF mutation were negative for 3199del6. METHODS: We performed reflex testing for 3199del6 on 663 unrelated specimens, including I148T heterozygotes, compound heterozygotes, and a homozygous individual. RESULTS: Less than 1% of I148T carriers were also positive for 3199del6. Excluding subjects tested because of a suspected or known CF diagnosis or positive family history, 0.6% of I148T-positive individuals were also positive for 3199del6. We identified 1 I148T homozygote and 6 unrelated compound heterozygous individuals with I148T and a second CF variant (2 of whom also carried 3199del6). In addition, one fetus with echogenic bowel and one infertile male were heterozygous for I148T (3199del6 negative). CONCLUSIONS: Reflex testing for 3199del6 should be considered whenever I148T is identified. Reflex testing is of particular importance for any symptomatic patient or whenever one member of a couple carries a deleterious CF mutation and the other member is an I148T heterozygote. Further population data are required to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF or male infertility.


Subject(s)
Cystic Fibrosis/genetics , Mutation , Cystic Fibrosis Transmembrane Conductance Regulator/genetics , DNA Mutational Analysis , Female , Gene Frequency , Genotype , Heterozygote , Humans , Male , Phenotype
10.
Appl Environ Microbiol ; 69(1): 693-6, 2003 Jan.
Article in English | MEDLINE | ID: mdl-12514064

ABSTRACT

Sixty-two partial formyltetrahydrofolate synthetase (FTHFS) structural gene sequences were recovered from roots of salt marsh plants, including Spartina alterniflora, Salicornia virginica, and Juncus roemerianus. Only S. alterniflora roots yielded sequences grouping with FTHFS sequences from known acetogens. Most other FTHFS or FTHFS-like sequences grouped with those from sulfate-reducing bacteria. Several sequences that grouped with Sphingomonas paucimobilis ligH were also recovered.


Subject(s)
Acetates/metabolism , Bacteria, Anaerobic/enzymology , Chenopodiaceae/microbiology , Formate-Tetrahydrofolate Ligase/genetics , Plant Roots/microbiology , Poaceae/microbiology , Bacteria, Anaerobic/classification , Bacteria, Anaerobic/genetics , Ecosystem , Formate-Tetrahydrofolate Ligase/chemistry , Genes, Bacterial , Molecular Sequence Data , Phylogeny , Seawater , Sequence Analysis, DNA , Sulfur-Reducing Bacteria/enzymology , Sulfur-Reducing Bacteria/genetics
11.
Appl Environ Microbiol ; 67(11): 5308-14, 2001 Nov.
Article in English | MEDLINE | ID: mdl-11679360

ABSTRACT

DNA was extracted from dry standing dead Spartina alterniflora stalks as well as dry Spartina wrack from the North Inlet (South Carolina) and Sapelo Island (Georgia) salt marshes. Partial nifH sequences were PCR amplified, the products were separated by denaturing gradient gel electrophoresis (DGGE), and the prominent DGGE bands were sequenced. Most sequences (109 of 121) clustered with those from alpha-Proteobacteria, and 4 were very similar (>99%) to that of Azospirillum brasilense. Seven sequences clustered with those from known gamma-Proteobacteria and five with those from known anaerobic diazotrophs. The diazotroph assemblages associated with dead Spartina biomass in these two salt marshes were very similar, and relatively few major lineages were represented.


Subject(s)
Alphaproteobacteria/genetics , Gammaproteobacteria/genetics , Oxidoreductases/genetics , Phylogeny , Poaceae/microbiology , Sequence Analysis, DNA , Biomass , DNA, Bacterial/analysis , DNA, Bacterial/isolation & purification , Electrophoresis, Polyacrylamide Gel/methods , Molecular Sequence Data , Poaceae/physiology , Polymerase Chain Reaction/methods
12.
J Autism Dev Disord ; 30(4): 355-8, 2000 Aug.
Article in English | MEDLINE | ID: mdl-11039861

ABSTRACT

A recent study has suggested that a dodecamer duplication in the HOPA gene in Xq13 may occur in a significant portion of male patients with autism. We have determined the incidence of this duplication in 202 patients from the South Carolina Autism Study. The incidence of the duplication was not significantly different between patients and controls. Three of the female patients inherited the duplication from nonautistic fathers. In addition, there was no systematic skewing of X inactivation in the female patients with the duplication, or in nonautistic mothers and sisters with the duplication. These findings suggest that the dodecamer duplication in the HOPA gene does not play a significant role in the etiology of autism.


Subject(s)
Autistic Disorder/genetics , Gene Duplication , Gene Expression/genetics , Adult , Autistic Disorder/epidemiology , Female , Genetic Linkage , Humans , Incidence , Male , X Chromosome/genetics
13.
Hum Genet ; 106(1): 36-9, 2000 Jan.
Article in English | MEDLINE | ID: mdl-10982179

ABSTRACT

A recent study suggested that a dodecamer duplication in exon 42 of the HOPA gene in Xq13 may be a significant factor in the etiology of X-linked mental retardation. In an effort to investigate this possibility, we determined the incidence of the dodecamer duplication in cohorts of non-fragile X males with mental retardation from three countries, cohorts of fragile X males from two countries, 43 probands from families with X-linked mental retardation and control cohorts from three countries. The duplication was found in 3.6-4.0% of male patients from two non-fragile X groups (Italy and South Carolina), in 1.2% from another non-fragile X group (South Africa), but in no male patients from families with X-linked mental retardation (South Carolina). The dodecamer duplication was also found in several white males with fragile X syndrome from France (5%) and South Africa (22.2%). Additionally, the duplication was found in 1.5% of South Carolinian newborn males, 2.5% South Carolinian male college students, 5% Italian male controls and 4.5% of the white South African controls. None of the black South African non-fragile X individuals with mental retardation, the fragile X or the control samples tested carried the duplication, suggesting that the duplication is rare in the black South African population. The incidence of the duplication was not significantly different between any of the groups in the study. Therefore, results of our studies in four different populations do not corroborate the findings of the previous study, and indicate that the HOPA dodecamer duplication does not convey an increased susceptibility to mental retardation.


Subject(s)
Fragile X Syndrome/genetics , Gene Duplication , Intellectual Disability/genetics , X Chromosome , Adult , Case-Control Studies , Cohort Studies , DNA Mutational Analysis , Female , Genetic Linkage , Humans , Infant, Newborn , Linkage Disequilibrium , Male , Polymorphism, Genetic
14.
J Virol ; 73(3): 1990-7, 1999 Mar.
Article in English | MEDLINE | ID: mdl-9971779

ABSTRACT

The goal of this study was to determine the minimal sequence within the simian virus 40 (SV40) late promoter region, nucleotides (nt) 255 to 424, capable of phasing nucleosomes as measured by its ability to confer the greatest endonuclease sensitivity on adjacent DNA sequences. To identify the minimal sequence, a deletional analysis of the late region was performed by utilizing a SV40 recombinant reporter system. The reporter system consisted of a series of unique restriction sites introduced into SV40 at nt 2666. The unique restriction sites allowed the insertion of test sequences as well as measurement of conferred endonuclease sensitivity. The results of the deletional analysis demonstrated that constructs capable of conferring the greatest nuclease sensitivities consistently included nt 255 to 280. The activator protein 4 (AP-4) and GTIIC transcription factor binding sequences lie within this region and were analyzed individually. Their abilities to confer nuclease sensitivity upon the reporter nearly matched that of the entire late domain. These results suggest that transcription factors AP-4 and transcription-enhancing factor which binds the GTIIC sequence are able to confer significant levels of nuclease sensitivity and are likely involved in the formation of the SV40 nucleosome-free region.


Subject(s)
Chromatin/physiology , Promoter Regions, Genetic , Simian virus 40/genetics , DNA-Binding Proteins/physiology , Gene Deletion , Nucleosomes/physiology , Transcription Factor TFIID , Transcription Factors/physiology , Transcription Factors, TFII/physiology , Transcription, Genetic
15.
J Virol ; 70(6): 3416-22, 1996 Jun.
Article in English | MEDLINE | ID: mdl-8648673

ABSTRACT

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.


Subject(s)
DNA Restriction Enzymes/pharmacology , DNA, Viral/chemistry , Promoter Regions, Genetic , Simian virus 40/genetics , Base Sequence , Enhancer Elements, Genetic , Molecular Sequence Data
SELECTION OF CITATIONS
SEARCH DETAIL
...