Spontaneous reversal of the developmental aging of normal human cells following transcriptional reprogramming.

AIM: To determine whether transcriptional reprogramming is capable of reversing the developmental aging of normal human somatic cells to an embryonic state. MATERIALS & METHODS: An isogenic system was utilized to facilitate an accurate assessment of the reprogramming of telomere restriction fragment (TRF) length of aged differentiated cells to that of the human embryonic stem (hES) cell line from which they were originally derived. An hES-derived mortal clonal cell strain EN13 was reprogrammed by SOX2, OCT4 and KLF4. The six resulting induced pluripotent stem (iPS) cell lines were surveyed for telomere length, telomerase activity and telomere-related gene expression. In addition, we measured all these parameters in widely-used hES and iPS cell lines and compared the results to those obtained in the six new isogenic iPS cell lines. RESULTS: We observed variable but relatively long TRF lengths in three widely studied hES cell lines (16.09-21.1 kb) but markedly shorter TRF lengths (6.4-12.6 kb) in five similarly widely studied iPS cell lines. Transcriptome analysis comparing these hES and iPS cell lines showed modest variation in a small subset of genes implicated in telomere length regulation. However, iPS cell lines consistently showed reduced levels of telomerase activity compared with hES cell lines. In order to verify these results in an isogenic background, we generated six iPS cell clones from the hES-derived cell line EN13. These iPS cell clones showed initial telomere lengths comparable to the parental EN13 cells, had telomerase activity, expressed embryonic stem cell markers and had a telomere-related transcriptome similar to hES cells. Subsequent culture of five out of six lines generally showed telomere shortening to lengths similar to that observed in the widely distributed iPS lines. However, the clone EH3, with relatively high levels of telomerase activity, progressively increased TRF length over 60 days of serial culture back to that of the parental hES cell line. CONCLUSION: Prematurely aged (shortened) telomeres appears to be a common feature of iPS cells created by current pluripotency protocols. However, the spontaneous appearance of lines that express sufficient telomerase activity to extend telomere length may allow the reversal of developmental aging in human cells for use in regenerative medicine.

Identification of a novel insulin-like growth factor binding protein gene homologue with tumor suppressor like properties.

Here we report the identification of a new insulin-like growth factor binding protein homologue, provisionally designated insulin-like growth factor binding related protein-4 (IGFBP-rP4). IGFBP-rP4 was found to be most closely related to IGFBP-7 with 52% amino acid homology and 43% amino acid identity, and shares a similar domain structure. Semi-quantitative RT-PCR expression analysis demonstrated a pattern of downregulation of this gene in multiple tumor samples including lung and colon cancer, compared to matched adjacent normal tissue. Western blotting revealed a protein of approximately 38kDa expressed in both the cell pellet and secreted into the supernatant of transiently transfected Cos-7 cells. Cos-7 supernatants containing IGFBP-RP4 protein were observed to suppress the growth of HeLa cells in culture compared to vector controls. IGFBP-RP4 directly transiently transfected into HeLa cells also further confirmed the growth suppressive properties of this protein. Together these data suggest that IGFBP-RP4 may be a novel putative tumor suppressor protein.

TANK2, a new TRF1-associated poly(ADP-ribose) polymerase, causes rapid induction of cell death upon overexpression.

Tankyrase (TANK1) is a human telomere-associated poly(ADP-ribose) polymerase (PARP) that binds the telomere-binding protein TRF1 and increases telomere length when overexpressed. Here we report characterization of a second human tankyrase, tankyrase 2 (TANK2), which can also interact with TRF1 but has properties distinct from those of TANK1. TANK2 is encoded by a 66-kilobase pair gene (TNKS2) containing 28 exons, which express a 6.7-kilobase pair mRNA and a 1166-amino acid protein. The protein shares 85% amino acid identity with TANK1 in the ankyrin repeat, sterile alpha-motif, and PARP catalytic domains but has a unique N-terminal domain, which is conserved in the murine TNKS2 gene. TANK2 interacted with TRF1 in yeast and in vitro and localized predominantly to a perinuclear region, similar to the properties of TANK1. In contrast to TANK1, however, TANK2 caused rapid cell death when highly overexpressed. TANK2-induced death featured loss of mitochondrial membrane potential, but not PARP1 cleavage, suggesting that TANK2 kills cells by necrosis. The cell death was prevented by the PARP inhibitor 3-aminobenzamide. In vivo, TANK2 may differ from TANK1 in its intrinsic or regulated PARP activity or its substrate specificity.

Telomerase expression prevents replicative senescence but does not fully reset mRNA expression patterns in Werner syndrome cell strains.

Reduced replicative capacity is a consistent characteristic of cells derived from patients with Werner syndrome. This premature senescence is phenotypically similar to replicative senescence observed in normal cell strains and includes altered cell morphology and gene expression patterns. Telomeres shorten with in vitro passaging of both WRN and normal cell strains; however, the rate of shortening has been reported to be faster in WRN cell strains, and the length of telomeres in senescent WRN cells appears to be longer than that observed in normal strains, leading to the suggestion that senescence in WRN cell strains may not be exclusively associated with telomere effects. We report here that the telomere restriction fragment length in senescent WRN fibroblasts cultures is within the size range observed for normal fibroblasts strains and that the expression of a telomerase transgene in WRN cell strains results in lengthened telomeres and replicative immortalization, thus indicating that telomere effects are the predominant trigger of premature senescence in WRN cells. Microarray analyses showed that mRNA expression patterns induced in senescent WRN cells appeared similar to those in normal strains and that hTERT expression could prevent the induction of most of these genes. However, substantial differences in expression were seen in comparisons of early-passage and telomerase-immortalized derivative lines, indicating that telomerase expression does not prevent the phenotypic drift, or destabilized genotype, resulting from the WRN defect.

Telomerase expression restores dermal integrity to in vitro-aged fibroblasts in a reconstituted skin model.

The lifespan of human fibroblasts and other primary cell strains can be extended by expression of the telomerase catalytic subunit (hTERT). Since replicative senescence is accompanied by substantial alterations in gene expression, we evaluated characteristics of in vitro-aged dermal fibroblast populations before and after immortalization with telomerase. The biological behavior of these populations was assessed by incorporation into reconstituted human skin. Reminiscent of skin in the elderly, we observed increased fragility and subepidermal blistering with increased passage number of dermal fibroblasts, but the expression of telomerase in late passage populations restored the normal nonblistering phenotype. DNA microarray analysis showed that senescent fibroblasts express reduced levels of collagen I and III, as well as increased levels of a series of markers associated with the destruction of dermal matrix and inflammatory processes, and that the expression of telomerase results in mRNA expression patterns that are substantially similar to early passage cells. Thus, telomerase activity not only confers replicative immortality to skin fibroblasts, but can also prevent or reverse the loss of biological function seen in senescent cell populations.

Microarray analysis of replicative senescence.

BACKGROUND: Limited replicative capacity is a defining characteristic of most normal human cells and culminates in senescence, an arrested state in which cells remain viable but display an altered pattern of gene and protein expression. To survey widely the alterations in gene expression, we have developed a DNA microarray analysis system that contains genes previously reported to be involved in aging, as well as those involved in many of the major biochemical signaling pathways. RESULTS: Senescence-associated gene expression was assessed in three cell types: dermal fibroblasts, retinal pigment epithelial cells, and vascular endothelial cells. Fibroblasts demonstrated a strong inflammatory-type response, but shared limited overlap in senescent gene expression patterns with the other two cell types. The characteristics of the senescence response were highly cell-type specific. A comparison of early- and late-passage cells stimulated with serum showed specific deficits in the early and mid G1 response of senescent cells. Several genes that are constitutively overexpressed in senescent fibroblasts are regulated during the cell cycle in early-passage cells, suggesting that senescent cells are locked in an activated state that mimics the early remodeling phase of wound repair. CONCLUSIONS: Replicative senescence triggers mRNA expression patterns that vary widely and cell lineage strongly influences these patterns. In fibroblasts, the senescent state mimics inflammatory wound repair processes and, as such, senescent cells may contribute to chronic wound pathologies.

Identification and cloning of a sequence homologue of dopamine beta-hydroxylase.

We have identified and cloned a cDNA encoding a new member of the monooxygenase family of enzymes. This novel enzyme, which we call MOX (monooxygenase X; unknown substrate) is a clear sequence homologue of the enzyme dopamine beta-hydroxylase (DBH). MOX maintains many of the structural features of DBH, as evidenced by the retention of most of the disulfide linkages and all of the peptidyl ligands to the active site copper atoms. Unlike DBH, MOX lacks a signal peptide sequence and therefore is unlikely to be a secreted molecule. The steady-state mRNA levels of MOX are highest in the kidney, lung, and adrenal gland, indicating that the tissue distribution of MOX is broader than that of DBH. Antisera raised to a fusion protein of MOX identifies a single band of the expected mobility by Western blot analysis. MOX mRNA levels are elevated in some fibroblast cell strains at replicative senescence, through this regulation is not apparent in all primary cell strains. The gene for MOX resides on the q arm of chromosome 6 and the corresponding mouse homolog has been identified.

The mouse telomerase RNA 5"-end lies just upstream of the telomerase template sequence.

Telomerase is a ribonucleoprotein enzyme with an essential RNA component. Embedded within the telomerase RNA is a template sequence for telomere synthesis. We have characterized the structure of the 5' regions of the human and mouse telomerase-RNA genes, and have found a striking difference in the location of the template sequence: Whereas the 5'-end of the human telomerase RNA lies 45 nt from the telomerase-RNA template sequence, the 5'-end of the mouse telomerase RNA lies just 2 nt from the telomerase-RNA template sequence. Analysis of genomic sequences flanking the 5'-end of the human and mouse telomerase RNA-coding sequences reveals similar promoter-element arrangements typical of mRNA-type promoters: a TATA box-like element and an upstream region containing a consensus CCAAT box. This putative promoter structure contrasts with that of the ciliate telomerase-RNA genes whose structure resembles RNA polymerase III U6 small nuclear RNA (snRNA) promoters. These and other comparisons suggest that, during evolution, both the RNA-polymerase specificity of telomerase RNA-gene promoters and, more recently, the position of the template sequence in the telomerase RNA changed.

Reconstitution of human telomerase activity and identification of a minimal functional region of the human telomerase RNA.

Telomerase is a ribonucleoprotein that catalyzes telomere elongation through the addition of TTAGGG repeats in humans. Activation of telomerase is often associated with immortalization of human cells and cancer. To dissect the human telomerase enzyme mechanism, we developed a functional in vitro reconstitution assay. After removal of the essential 445 nucleotide human telomerase RNA (hTR) by micrococcal nuclease digestion of partially purified human telomerase, the addition of in vitro transcribed hTR reconstituted telomerase activity. The activity was dependent upon and specific to hTR. Using this assay, truncations at the 5' and 3' ends of hTR identified a functional region of hTR, similar in size to the full-length telomerase RNAs from ciliates. This region is located between positions 1-203. Furthermore, we found that residues 1-44, 5' to the template region (residues 46-56) are not essential for activity, indicating a minimal functional region is located between residues 44-203. Mutagenesis of full-length hTR between residues 170-179, 180-189 or 190-199 almost completely abolished the ability of the hTR to function in the reconstitution of telomerase activity, suggesting that sequences or structures within this 30 nucleotide region are required for activity, perhaps by binding telomerase protein components.

The RNA component of human telomerase.

Eukaryotic chromosomes are capped with repetitive telomere sequences that protect the ends from damage and rearrangements. Telomere repeats are synthesized by telomerase, a ribonucleic acid (RNA)-protein complex. Here, the cloning of the RNA component of human telomerase, termed hTR, is described. The template region of hTR encompasses 11 nucleotides (5'-CUAACCCUAAC) complementary to the human telomere sequence (TTAGGG)n. Germline tissues and tumor cell lines expressed more hTR than normal somatic cells and tissues, which have no detectable telomerase activity. Human cell lines that expressed hTR mutated in the template region generated the predicted mutant telomerase activity. HeLa cells transfected with an antisense hTR lost telomeric DNA and began to die after 23 to 26 doublings. Thus, human telomerase is a critical enzyme for the long-term proliferation of immortal tumor cells.

Cataloging altered gene expression in young and senescent cells using enhanced differential display.

Recently, a novel PCR-based technique, differential display (DD), has facilitated the study of differentially expressed genes at the mRNA level. We report here an improved version of DD, which we call Enhanced Differential Display (EDD). We have modified the technique to enhance reproducibility and to facilitate sequencing and cloning. Using EDD, we have generated and verified a catalog of genes that are differentially expressed between young and senescent human diploid fibroblasts (HDF). From 168 genetags that were identified initially, 84 could be sequenced directly from PCR amplified bands. These sequences represent 27 known genes and 37 novel genes. By Northern blot analysis we have confirmed the differential expression of a total of 23 genes (12 known, 11 novel), while 19 (seven known, 12 novel) did not show differential expression. Several of the known genes were previously observed by others to be differentially expressed between young and senescent fibroblasts, thereby validating the technique.

Recombinant human erythrocyte cytochrome b5.

The gene encoding the human erythrocyte form of cytochrome b5 (97 residues in length) has been prepared by mutagenesis of an expression vector encoding lipase-solubilized bovine liver microsomal cytochrome b5 (93 residues in length) (Funk et al., 1990). Efficient expression of this gene in Escherichia coli has provided the first opportunity to obtain this protein in quantities sufficient for physical and functional characterization. Comparison of the erythrocytic cytochrome with the trypsin-solubilized bovine liver cytochrome b5 by potentiometric titration indicates that the principal electrostatic difference between the two proteins results from two additional His residues present in the human erythrocytic protein. The midpoint reduction potential of this protein determined by direct electrochemistry is -9 +/- 2 mV vs SHE at pH 7.0 (mu = 0.10 M, 25.0 degrees C), and this value varies with pH in a fashion that is consistent with the presence of a single ionizable group that changes pKa from 6.0 +/- 0.1 in the ferricytochrome to 6.3 +/- 0.1 in the ferrocytochrome with delta H degrees = -3.2 +/- 0.1 kcal/mol and delta S degrees = -11.5 +/- 0.3 eu (pH 7.0, mu = 0.10). The 1D 1H NMR spectrum of the erythrocytic ferricytochrome indicates that 90% of the protein binds heme in the "major" orientation and 10% of the protein binds heme in the "minor" orientation (pH 7.0, 25 degrees C) with delta H degrees = -2.9 +/- 0.3 kcal/mol and delta S degrees = -5.4 +/- 0.9 eu for this equilibrium.

Characterization of wild-type and an active-site mutant in Escherichia coli of short-chain acyl-CoA dehydrogenase from Megasphaera elsdenii.

The objective of this work is to determine the molecular mechanism and regulation of short-chain acyl-CoA dehydrogenase (SCAD) from Megasphaera elsdenii. To achieve this, the gene coding for SCAD from M. elsdenii was cloned and sequenced. Site-directed mutagenesis was then used to identify an amino acid residue that is required for the proposed mechanism. To clone the gene, the amino acid sequence of the 50 N-terminal residues of SCAD from M. elsdenii was determined. This sequence information was utilized to synthesize two sets of mixed oligonucleotide primers which were then used to generate a 120-bp specific probe from M. elsdenii DNA by the polymerase chain reaction (PCR) method. The 120-bp probe was used to screen a M. elsdenii genomic DNA library cloned into Escherichia coli. The gene encoding M. elsdenii SCAD was identified from this library, sequenced, and expressed. The cloned SCAD gene contained an open reading frame which revealed a high degree of sequence identity with an open reading frame protein sequence of the human SCAD and the rat medium-chain acyl-CoA dehydrogenase (MCAD) (44% and 36% identical residues in paired comparisons for human SCAD and rat MCAD, respectively). Recombinant SCAD expressed from a pUC119 vector accounted for 35% of the cytosolic protein in the Escherichia coli crude extract. The expressed protein had similar activity, redox potential properties, and nearly identical amino acid composition to native M. elsdenii SCAD. In addition, a site-directed Glu367 Gln mutant of SCAD expressed from a pUC119 vector was shown to have minimal reductive and oxidative pathway activity with butyryl-CoA and crotonyl-CoA, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

Novel DNA binding of p53 mutants and their role in transcriptional activation.

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

Transmutation of a heme protein.

Residue Asn57 of bovine liver cytochrome b5 has been replaced with a cysteine residue, and the resulting variant has been isolated from recombinant Escherichia coli as a mixture of four major species: A, BI, BII, and C. A combination of electronic spectroscopy, 1H NMR spectroscopy, resonance Raman spectroscopy, electrospray mass spectrometry, and direct electrochemistry has been used to characterize these four major cytochrome derivatives. The red form A (E(m) = -19 mV) is found to possess a heme group bound covalently through a thioether linkage involving Cys57 and the alpha carbon of the heme 4-vinyl group. Form BI has a covalently bound heme group coupled through a thioether linkage involving the beta carbon of the heme 4-vinyl group. Form BII is similar to BI except that the sulfur involved in the thioether linkage is oxidized to a sulfoxide. The green form C (E(m) = 175 mV) possesses a noncovalently bound prosthetic group with spectroscopic properties characteristic of a chlorin. A mechanism is proposed for the generation of these derivatives, and the implications of these observations for the biosynthesis of cytochrome c and naturally occurring chlorin prosthetic groups are discussed.

Expression of glycosylated and nonglycosylated human transferrin in mammalian cells. Characterization of the recombinant proteins with comparison to three commercially available transferrins.

The coding sequence for human serum transferrin was assembled from restriction fragments derived from a full-length cDNA clone isolated from a human liver cDNA library. The assembled clone was inserted into the expression vector pNUT and stably transfected into transformed baby hamster kidney (BHK) cells, leading to secretion of up to 125 mg/L recombinant protein into the tissue culture medium. As judged by mobility on NaDodSO4-PAGE, immunoreactivity, spectral properties (indicative of correct folding and iron binding), and the ability to bind to receptors on a human cell line, initial studies showed that the recombinant transferrin, is identical to three commercial human serum transferrin samples. Electrospray mass spectrometry (ESMS), anion-exchange chromatography, and urea gel analysis showed that the recombinant protein has an extremely complex carbohydrate pattern with 16 separate masses ranging from 78,833 to 80,802 daltons. Mutation of the two asparagine carbohydrate linkage sites to aspartic acid residues led to the expression and secretion of up to 25 mg/L nonglycosylated transferrin. ESMS, anion-exchange chromatography, and urea gel analysis showed a single molecular species that was consistent with the expected theoretical mass of 75,143 daltons. In equilibrium binding experiments, the nonglycosylated mutant bound to HeLa S3 cells with the same avidity and to the same extent as the glycosylated protein and the three commercial samples. These studies demonstrate conclusively that carbohydrate has no role in this function.

CASTing for multicomponent DNA-binding complexes.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Cyclic amplification and selection of targets for multicomponent complexes: myogenin interacts with factors recognizing binding sites for basic helix-loop-helix, nuclear factor 1, myocyte-specific enhancer-binding factor 2, and COMP1 factor.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

Preliminary crystallographic analyses of the N-terminal lobe of recombinant human serum transferrin.

The N-terminal lobe of recombinant human serum transferrin (residues 1 to 337) has been crystallized in a form suitable for high-resolution three-dimensional X-ray crystallographic analyses. Crystals are of the orthorhombic space group P2(1)2(1)2(1), with unit cell dimensions of a = 44.9 A, b = 57.0 A and c = 135.9 A, and diffract to beyond 2 A resolution. Further studies show that isomorphous crystals of specifically designed mutants of this protein can also be grown. Structural studies of both recombinant and mutant protein forms will provide a basis for understanding the mechanism by which human serum transferrin functions.