The role of hyperbaric oxygen in osteoradionecrosis-a prophylactic insight.

BACKGROUND: Osteoradionecrosis (ORN) is an uncommon and debilitating consequence of head and neck radiotherapy and hyperbaric oxygen therapy (HBOT) has been advocated for prophylaxis prior to performing dentoalveolar procedures. The aim of this study was to evaluate a prophylactic HBOT protocol and describe the outcomes of susceptible individuals. METHODS: A retrospective audit of adults who attended the Oral and Maxillofacial Surgery department at the Royal Adelaide Hospital (South Australia) who received dental extractions with a history of radiotherapy to the jaws from 2008 to 2020. Data including demographic information and outcomes of osteoradionecrosis and delayed healing was recorded. RESULTS: A total of 121 individuals were eligible for case note review; 68.6% of individuals were male and 55.4% were aged over 67 years. Osteoradionecrosis occurred in 9.1% of individuals and delayed healing for 3.3%; fifteen individuals (12.4%) were unable to complete the HBOT protocol. The individuals who were diagnosed with ORN had a significant association with age (P = 0.006) and binary analysis showed alcohol consumption to be a significant predictor. CONCLUSIONS: Prophylactic HBOT protocol had a lower proportion of individuals diagnosed with ORN and those who were diagnosed were more likely to be younger males and have current alcohol consumption.

Genetic association between antipsychotic induced weight gain and FTO gene in a Sri Lankan population

Background: About 30% of patients treated with second generation antipsychotics (SGA) experience weight gain. Although there is evidence that the FTO gene is associated with obesity its role in antipsychotic induced weight gain is not so clear. Methods: A genetic association study was carried out to identify the association between FTO rs9939609 and antipsychotic induced weight gain. Sample consisted of 180 cases and 120 controls. Cases were patients diagnosed with schizophrenia or schizoaffective disorder, treated with second-generation antipsychotics for a minimum of 3 months, and had gained at least 10% of body weight. Controls were patients with schizophrenia treated with second-generation antipsychotics for a minimum of 3 months but had not gained ≥10% of body weight. Genomic DNA was extracted from whole blood. Polymerase chain reaction of the samples was done. Real-time quantitative PCR (qPCR) was carried out using BIO-RAD CFX96 Touch TM PCR detection system. Results: Females were significantly more among cases (58.3%) than controls (35%). Cases (52.4%) were significantly more likely to be overweight or obese than controls (13.8%). Genotype distribution was in Hardy-Weinberg equilibrium (p=0.43). Cochran-Armitage trend test was not significant. Risk of antipsychotic induced weight gain in the AA genotype [OR 1.69 (95% CI 0.74-3.86)] and AT genotype [OR 1.1 (95% CI 0.67-1.79)] were not significantly higher than the TT genotype. Recessive model showed that AA/AT genotypes were at significantly higher risk of being obese/overweight [OR 1.84 (95% CI 1.05-3.2)]. Conclusions: There was no significant association between FTO rs9939609 and antipsychotic induced weight gain. AA/AT genotypes had significantly higher risk of overweight/obesity.

The role of heme iron molecules derived from red and processed meat in the pathogenesis of colorectal carcinoma.

Emerging evidence that heme iron in red meat is a risk factor for colorectal carcinogenesis is a topic that has received recent scrutiny. This review aims to summarise the mechanism of colorectal carcinogenesis by heme contained in red and processed meat. Heme iron can induce cytotoxicity by 'cytotoxic heme factor' and promote surface epithelial cell apoptosis and compensatory epithelial hyperplasia. Heme, induces peroxidation of lipids, leading to free radical formation and generation of DNA adducts in colorectal epithelial cells. In addition, heme catalyses the formation of N-nitroso-compounds, which in turn results in the initiation of colorectal carcinogenesis. Emerging data suggest that intestinal dysbiosis can promote carcinogenic properties of heme. Heme induces multiple genetic alterations by regulating WNT signalling pathway and causing mutations in major colon cancer genes such as APC, TP53 and KRAS. However, a balanced diet containing green vegetables, olive oil and calcium may reduce the carcinogenic effects of heme.

Multiple Sclerosis Patients with Markedly Low Intrathecal Antibody Response in Sri Lanka.

Multiple sclerosis (MS) is a heterogeneous disease which is poorly studied in Asia, where the disease is known to be rare with significant differences in clinical and radiological presentations and intrathecal antibody response. Therefore the objective of this study was to determine clinical presentation, radiological and neurophysiological characteristics, and oligoclonal band status in Sri Lankan MS patients, following careful exclusion of patients with neuromyelitis optica spectrum disorders and other conditions mimicking multiple sclerosis. Sixty-nine MS patients were recruited to the study adhering to McDonald 2010 criteria. Their clinical presentation, characteristics of central nervous system lesions in magnetic resonance imaging, visual evoked potential (VEP) results, oligoclonal bands (OCB), and AQP4 antibody status were studied. Of 69 MS patients, 54%, 6%, and 1% were relapsing remitting, secondary progressive, and primary progressive, respectively, and 39% were patients with clinically isolated syndrome. The commonest clinical presentations were cerebral motor followed by cerebral sensory and optic neuritis. Majority had typical periventricular and infratentorial lesions in MRI. Though not clinically apparent, bilateral delay of P100 wave latency was present in 52%. OCB positivity was 42% and AQP4 antibody was positive in only one patient. In conclusion, this group of Sri Lankan MS patients shares most of the clinical and radiological features of Caucasian MS patients. However, the OCB positivity is lower in this group, when compared to the Caucasian MS populations.

Relationship between the tensile strengths and diameters of human umbilical cords.

Mothers of alleged infanticides might claim that umbilical cord broke during precipitate delivery causing injuries detected on baby at autopsy. There is paucity of evidence regarding this possibility. The objective of the study was to determine relationship between tensile strength and diameter or weight per unit length of cord. Diameters and weights per unit length of fresh umbilical cords were determined. Tensile strengths were measured by Hounsfield Testing Machine. Relationship between tensile strength versus cord diameter and weight per unit length were analyzed. Of 122 cords, average tensile strength, diameter and weight per centimeter were 50.4 N, 7.73 mm and 6.87 g respectively. The tensile strengths were directly proportional to diameter. There was no association between tensile strength and weight per centimeter. Measurement of the diameter of cord is important during autopsy to predict tensile strength and thereby to presume whether cord could have broken by the weight of the baby.

Near-field edge fringes at sharp material boundaries.

We have studied the formation of near-field fringes when sharp edges of materials are imaged using scattering-type scanning near-field optical microscope (s-SNOM). The materials we have investigated include dielectrics, metals, a near-perfect conductor, and those that possess anisotropic permittivity and hyperbolic dispersion. For our theoretical analysis, we use a technique that combines full-wave numerical simulations of tip-sample near-field interaction and signal demodulation at higher orders akin to what is done in typical s-SNOM experiments. Unlike previous tip-sample interaction near-field models, our advanced technique allows simulation of the realistic tip and sample structure. Our analysis clarifies edge imaging of recently emerged layered materials such as hexagonal boron nitride and transition metal dichalcogenides (in particular, molybdenum disulfide), as well as traditional plasmonic materials such as gold. Hexagonal boron nitride is studied at several wavelengths, including the wavelength where it possesses excitation of phonon-polaritons and hyperbolic dispersion. Based on our results of s-SNOM imaging in different demodulation orders, we specify resonant and non-resonant types of edges and describe the edge fringes for each case. We clarify near-field edge-fringe formation at material sharp boundaries, both outside bright fringes and the low-contrast region at the edge, and elaborate on the necessity of separating them from propagating waves on the surface of polaritonic materials.

Reliable passivation of black phosphorus by thin hybrid coating.

Black phosphorus (BP) possesses several extraordinary physical properties, which include in-plane anisotropy, thickness dependent direct bandgap and high carrier mobility. These physical properties make BP highly desirable from the point of view of fundamental science and modern optoelectronics applications. The excitement about this material has always been accompanied by unreserved skepticism due to its extraordinary degradation under ambient conditions. Here we show ambient degradation of exfoliated BP can be effectively suppressed using thin layer of hybrid metal organic chemical vapor deposition coating of boron nitride (BN) followed by atomic layer deposition coating of Al2O3. We have extensively studied the time dependent surface, optical and electrical properties of BP encapsulated by BN and/or Al2O3 using nanoscale infrared imaging and I-V characterizations. Our results show hybrid thin layer (∼5 nm) BN/Al2O3 coated BP exfoliated on SiO2 substrate is protected from degradation in ambient for over 6 months, much longer than those coated only by BN or Al2O3 layers. Our theoretical modeling of the experimental degradation growth pattern shows that the influence of neighboring elements on the degradation of a given element is minimal for BP flakes with hybrid coating. Electrical characterization further confirms the effectiveness of BN/Al2O3 as encapsulation layer and gate dielectrics with minor changes after several weeks.

The influence of gold(i) on the mechanism of thiolate, disulfide exchange.

The mechanism of gold(i)-thiolate, disulfide exchange was investigated by using initial-rate kinetic studies, 2D ((1)H-(1)H) ROESY NMR spectroscopy, and electrochemical/chemical techniques. The rate law for exchange is overall second order, first order in gold(i)-thiolate and disulfide. 2D NMR experiments show evidence of association between gold(i)-thiolate and disulfide. Electrochemical/chemical investigations do not show evidence of free thiolate and are consistent with a mechanism involving formation of a [Au-S, S-S], four-centered metallacycle intermediate during gold(i)-thiolate, disulfide exchange.

Terminal ilial intussusception in an adult due to endometriosis.

BACKGROUND: Intussusception is invagination of a proximal segment of bowel into the distal segment in telescopic manner. Although intussusception is common among children, intussusception secondary to terminal ileal endometriosis in an adult is a very rare encounter. We present such a case of intussusception in a Sri Lankan female. CASE PRESENTATION: A 43 year old Sri Lankan female presented to the surgical casualty unit with features of a subacute intestinal obstruction. Her past surgical and medical histories were unremarkable. On examination she was haemodynamically stable with distended abdomen and there was generalized tenderness. There was no guarding or rigidity. No masses were palpable. Bowel sounds were increased. Her urine was negative for Human Chorionic Gonadotrophin hormone. Full blood count revealed an increased white blood cell count with predominant number of neutrophils. Plain abdominal X-ray film showed dilated small bowel loops with empty rectum and distal colon. Patient underwent emergency exploratory laparotomy. An annular growth at terminal ileum was noted. Proximal bowel loops were distended. There was no free fluid in the abdomen. Ileo caecal tuberculosis was suspected and right hemicolectomy was performed. Uterus and bilateral ovaries appeared normal. Post surgical recovery was uneventful. The pathologist has noted endometriosis of terminal ileum contributing to the stricture formation and intussusception at the site. Following recovery patient was referred to a Gynaecologist for management of endometriosis. CONCLUSION: Though terminal ileal endometriosis is a very rare cause of intussusception it is important to consider the possibility of it, especially when a female patient of reproductive age presents with symptoms and signs of intestinal obstruction.

Translational research for Diabetes Self-Management in Sri Lanka: A randomized controlled trial.

AIMS: The study tested the hypothesis that a theory driven Diabetes Self-Management (DSM) intervention delivered by trained nurses would result in a clinically significant improvement in glycaemic control. METHODS: Patients with an HbA1c >7.5% (58mmol/mol) and free of diabetes complications were enrolled into a randomized controlled trial (n=85). Intervention consisted of four sessions and monthly follow up for 6 months. Biochemical tests, and diet and physical activity assessments were done in both groups. Analysis of covariance was used to test the effectiveness of the intervention. RESULTS: At 6 months, there was a significant difference (P=0.001) in HbA1c between the groups controlling for baseline values and other variables. Based on the primary outcome, 28% in the intervention group achieved the target value of 6.5% HbA1c, compared to 8% in the "usual care" group (P<0.001; η(2)=0.65). The reduction in total energy intake and increase in physical activity was significant in the intervention group between baseline and follow up. CONCLUSIONS: The DSM intervention has resulted in a clinically significant impact on glycaemia, change in diet and physical activity, and has demonstrated the feasibility of using it within existing care arrangements in a developing country setting.

Identification of Iris yellow spot virus on Leek (Allium porrum) in Sri Lanka.

Leek (Allium porrum) has become one of the major leafy vegetable export crops in Sri Lanka during last few years. This year-round crop is cultivated in open fields at elevations between 1,000 and 2,000 m on approximately 1,600 ha with a production of 27,000 t per year (2). In August 2009, straw-colored spots (2 to 3 mm in diameter), surrounded by a greenish halo and a necrotic area, resembling symptoms to those caused by Iris yellow spot virus (IYSV) were observed on leek in Kandapola in the Nuwara Eliya District. Additional thrips damage consisting of silver-colored spots was observed on all plants. IYSV (family Bunyaviridae, genus Tospovirus) was first described and characterized in the Netherlands in 1998 (1). During the last few years, this virus was reported from Australia, Brazil, Chile, France, Germany, Guatemala, India, Israel, New Zealand, Peru, Reunion Island, Serbia, South Africa, Spain, the United States (4), and Japan. Collected samples were initially analyzed for IYSV infections using antisera raised against nucleocapsid (N) protein in a double-antibody sandwich (DAS)-ELISA. The presence of IYSV was confirmed by a reverse transcription (RT)-PCR using IYSV-F-373 (5'CTGCGGGCTTCTCTGG3') and IYSV-R-779 (5'GACTCACCAATGTCTTCAAC3') primers that amplify a 400-bp fragment of the N gene. The entire N gene was not obtained when specific primers were used to retrieve the complete N gene. Four nucleotides of the reverse primer GAAAGATAGATATAATTAA (indicated in bold) did not match with sequence at the 3'end of the N gene. Hence, to obtain the remaining parts of the N gene, the primers UHP (5'CACTGGATCCTTTTGTTTTTGTTTTTTG3') and Asian Termini (5'CCCGGATCCAGAGCAATCGAGGY3') (3) were combined with IYSV-F and IYSV-R. The obtained amplicons were cloned into pGEM-T easy vector and sequenced. The N gene sequence has been deposited at the NCBI/GenBank (Accession No. GU901211). The deduced N protein sequence(s) were compared with other IYSV N protein sequences available in the GenBank and showed a 92% protein identity with the Brazilian strain (IYSV-BR) and 97% with the Dutch strain (IYSV-NL) with Accession Nos. AAF04199 and AAB61923, respectively. No data on the thrips vector species or on the disease incidence have been collected. The presence of IYSV in Sri Lanka can potentially be considered as a threat for the export of leek. To our knowledge, this is the first report that IYSV occurs in Sri Lanka. References: (1) I. Cortêz et al. Phytopathology 88:1276, 1998. (2) Department of Census and Statistics Sri Lanka. Retrieved from http://www.statistics.gov.lk , 2009. (3) A. Hassani-Mehraban et al. Phytopathology 95:852, 2005. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

Low cost in-house PCR for the routine diagnosis of extra-pulmonary tuberculosis.

SETTING: Conventional methods for the identification of mycobacteria are slow and labour intensive. DNA amplification methods offer rapid sensitive and specific diagnosis. OBJECTIVE: To determine the feasibility of an in-house polymerase chain reaction (PCR) method to detect Mycobacterium tuberculosis in clinical samples. DESIGN: The present study focused mainly on diagnosing extra-pulmonary tuberculosis (EPTB) using an in-house PCR method in 465 clinical samples. This study also compared the efficacy of a standard phenol-chloroform (PC) extraction procedure and the guanidine thiocyanate with diatomaceous silica (GTCS) method of DNA extraction and purification. A subsample of patients was used for the validation of results based on the final diagnosis. RESULTS: Among 373 patients with suspected EPTB, 75 specimens were positive by PCR, four by microscopy and six by culture. Of the 25 PCR-positive patients, 95% had a final diagnosis of TB. Globally, the GTCS method was found to be superior to the PC method for DNA extraction and removal of inhibitors from clinical specimens. CONCLUSION: The DNA amplification method was found to be significantly more sensitive and rapid compared to culture and microscopy for a reliable final diagnosis of EPTB.

First successful in vitro culture of autochthonous Leishmania sp. in Sri Lanka.

Since the first autochthonous case of cutaneous leishmaniasis in Sri Lanka was reported in 1992 (1) attempts to culture the causative organisms have been unsuccessful. We report the first successful isolation of the local Leishmania sp. by in vitro culture, which would pave the way for species and strain indentification.

Dicationic bis(9-methylphenazine-1-carboxamides): relationships between biological activity and linker chain structure for a series of potent topoisomerase targeted anticancer drugs.

Bis(9-methylphenazine-1-carboxamides) joined by a variety of dicationic (CH(2))(n)()NR(CH(2))(m)NR(CH(2))(n) linkers of varying length (carboxamide N-N distances from 11.0 to 18.4 A) and rigidity were prepared by reaction of 9-methylphenazine-1-carboxylic acid imidazolide with the appropriate polyamines. The compounds were evaluated for growth inhibitory properties in P388 leukemia, Lewis lung carcinoma, and wild-type (JL(C)) and mutant (JL(A) and JL(D)) forms of human Jurkat leukemia with low levels of topoisomerase II (topo II). The compounds all had IC(50) ratios of <1 in the resistant Jurkat lines, consistent with topo II inhibition not being the primary mechanism of action. Analogues joined by an (CH(2))(2)NR(CH(2))(2)NR(CH(2))(2) linker were extremely potent cytotoxins, with selectivity toward the human cell lines, but absolute potencies declined sharply from R = H through R = Me to R = Pr and Bu. In contrast, (CH(2))(2)NR(CH(2))(3)NR(CH(2))(2) compounds showed reverse effects, with the R = Me analogue being more potent than the R = H one as well as being the most potent in the series [IC(50) in JL(C) cells 0.08 nM; superior to that for the clinical bis(naphthalimide) LU 79553]. Overall, the IC(50)s of analogues with linker chains (CH(2))(n)NH(CH(2))(m)NH(CH(2))(n) were inversely proportional to linker length. Constraining the rigidity of the linker chain by incorporating a piperazine ring did not decrease potency significantly. A representative compound bound tightly to DNA with high selectivity for GC sites, compatible with recent work suggesting that compounds of this type place their side chains in the major groove, making specific contacts with guanine bases. Representative compounds were susceptible to transport mediated resistance, being much less effective in cells that overexpressed P-glycoprotein. Overall the results suggest these compounds have a similar mode of action, mediated primarily by poisoning of topo I (possibly with some involvement of topo II). The bis(9-methylphenazine-1-carboxamides) show very high in vitro growth inhibitory potencies compared to their monomeric analogues. Two compounds showed in vivo activity in murine colon 38 syngeneic and HT29 human colon tumor xenograft models using intraperitoneal dosing.

Comparative biodistribution and metabolism of carbon-11-labeled N-[2-(dimethylamino)ethyl]acridine-4-carboxamide and DNA-intercalating analogues.

The tricyclic carboxamide N-[2-(dimethylamino)ethyl]acridine-4-carboxamide (DACA) is a DNA-intercalating agent capable of inhibiting both topoisomerases I and II and is currently in Phase II clinical trial. Many related analogues have been developed, but despite their potent in vitro cytotoxicities, they exhibit poor extravascular distribution. As part of an ongoing drug development program to obtain related "minimal intercalators" with lower DNA association constants, we have compared the biodistribution and metabolite profiles of the prototype compound, DACA, with three analogues to aid rational drug selection. All of these compounds share a common structural feature, N-dimethyl side chain, which was radiolabeled with the positron-emitting radioisotope, carbon-11. This strategy was selected because it allows promising candidates emerging from preclinical studies in animals to be evaluated rapidly in humans using positron emission tomography (PET). The acridine DACA, the phenazine SN 23490, the pyridoquinoline SN 23719, and the dibenzodioxin SN 23935 were found to be cytotoxic in in vitro assays with an IC50 of 1.4-1.8 microM, 0.4-0.6 microM, 1.3-1.6 microM, and 24-36 microM, respectively, in HT29, U87MG, and A375M cell lines. Ex vivo biodistribution studies with carbon-11 radiolabeled compounds in mice bearing human tumor xenografts showed rapid clearance of 11C-radioactivity (parent drug and metabolites) from blood and the major organs. Rapid hepatobiliary clearance and renal excretion were also observed. There was low [<5% of injected dose/gram (%ID/g)] and variable uptake of 11C-radioactivity in three tumor types for all of the compounds. Tumor (U87MG) to blood 11C-radioactivity for [11C]DACA, [11C](9-methoxyphenazine-1-carboxamide (SN 23490), [11C]2-(4-pyridyl)quinoline-8-carboxamide (SN 23719), and [11C]dibenzo[1,4]dioxin-1-carboxamide (SN 23935) at 30 min were 2.9 +/- 1.1, 2.3 +/- 0.6, 2.6 +/- 0.6, and 0.7 +/- 0.2, respectively. For SN 23719, the distribution of 11C-radioactivity in normal tissues and tumors determined ex vivo was in broad agreement with that determined in vivo by whole body PET scanning. [11C]DACA was rapidly and extensively metabolized to several plasma metabolites and a major tumor metabolite. In contrast, [11C]SN 23935, [11C]SN 23490, and [11C]SN 23719 showed less extensive metabolism. In the tumor samples, the parent [11C]DACA and [11C]SN 23935 represented between 0.3 and 1.5%ID/g, whereas [11C]SN 23490 and [11C]SN 23719 represented between 1.5 and 2.8%ID/g. In conclusion, by using a strategy with 11C-labeling, we have determined the tissue distribution and metabolic stability of novel tricyclic carboxamides with the view of selecting analogues with potentially better in vivo activity against solid tumors. SN 23490 and SN 23719 had more favorable distribution and metabolic stability compared with DACA and SN 23935 and may warrant further development. The radiolabeling strategy used allows ex vivo and in vivo evaluation of promising anticancer agents in animals and offers the potential of rapid translation to studies in humans using PET.

Efficacy of LGD1069 (Targretin), a retinoid X receptor-selective ligand, for treatment of uterine leiomyoma.

The conventional treatment of uterine leiomyomas, or fibroids, with gonadotropin-releasing hormone (GnRH) agonists is often associated with serious side effects, necessitating short-term, palliative use of this therapy. Therefore, we examined a retinoid X receptor (RXR)-selective ligand, LGD1069, as a possible treatment for leiomyoma. LGD1069 has demonstrated efficacy as a chemopreventive agent in the N-nitroso-N-methylurea (NMU)-induced rat mammary carcinoma model and is a therapeutic agent in several epithelial tumor models. Previous studies have shown that it has both antitumor effects and antiestrogenic activity in the rat uterus, suggesting the potential utility of this agent for treatment of hormonally dependent uterine fibroids. The expression of retinoid receptors in tumors and cell lines derived from leiomyomas arising in the Eker rat was confirmed by Northern analysis. After treatment for 4 months with LGD1069, the number of grossly observable tumors was substantially reduced although the total incidence of tumors, including microscopic lesions, remained unaffected, suggesting an effect of the compound on tumor growth kinetics rather than on tumor initiation. Analysis of terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining and determination of 5-bromo-2-deoxyuridine (BrdU) incorporation indicated that the reduction in grossly observable tumors that occurred in treated animals was mediated by a significant increase in the level of apoptosis rather than a decrease in cell proliferation. These results suggest that LGD1069 may be an effective therapeutic agent for uterine leiomyoma that may inhibit tumor growth and, consequently, alleviate the symptoms associated with this disease.

Bis(phenazine-1-carboxamides): structure-activity relationships for a new class of dual topoisomerase I/II-directed anticancer drugs.

Ring-substituted bis(phenazine-1-carboxamides), linked by a -(CH(2))(3)NMe(CH(2))(3)- chain, were prepared from the corresponding substituted phenazine-1-carboxylic acids by reaction of the intermediate imidazolides with bis(3-aminopropyl)methylamine. The compounds were evaluated for growth inhibitory activity in a panel of tumor cell lines, including P388 leukemia, Lewis lung carcinoma, and wild-type (JL(C)) and mutant (JL(A) and JL(D)) forms of human Jurkat leukemia. The latter mutant lines are resistant to topoisomerase (topo) II targeted agents because of lower levels of the enzyme. Analogues with small, lipophilic substituents (e.g., Me, Cl) at the 9-position were the most potent inhibitors, superior to the corresponding dimeric bis(acridine-4-carboxamides) (bis-DACA analogues). Several of the compounds were preferentially (up to 2-fold) more cytotoxic toward the mutant Jurkat lines than the wild-type. To test whether this selectivity was related to topoisomerase action, the most potent of the compounds (9-methyl) was evaluated in a cell-free system. It poisoned topo I at drug concentrations of 0.25 and 0.5 microM and inhibited the catalytic activity of both topo I and topo II at concentrations of 1 and 5 microM, respectively. Results from the NCI human tumor cell line panel showed the compounds had preferential activity toward colon tumor lines (on average 9.5-fold more active in the HT29 line than in the cell line panel as a whole). Several analogues produced significant growth delays in the relatively refractory subcutaneous colon 38 tumor model in vivo. In particular, the 9-methyl compound was substantially more potent in this tumor model than the clinical dual topo I/II poison DACA (total dose 90 versus 400 mg/kg) with comparable activity. The bis(phenazine-1-carboxamides) are a new and interesting class of dual topo I/II-directed anticancer drugs.

Dimeric analogues of non-cationic tricyclic aromatic carboxamides are a new class of cytotoxic agents.

A series of tricyclic aromatic carboxamides, and their corresponding dimeric analogues, were prepared and their growth-inhibitory properties were evaluated in a series of cell lines. The dimeric compounds were prepared by reaction of the appropriate acids with carbonyl-1,1'-diimidazole, isolating the resulting imidazolides, and reacting these with a stoichiometric amount of the diamine. The monomeric carboxamides containing a (CH2)2NMe2 side chain had widely differing inhibitory potencies, with the known nitronaphthalimide (mitonafide) and acridine-4-carboxamide (DACA) being the most potent. The corresponding bis analogues, linked by a (CH2)3NMe(CH2)3 chain, were generally more potent, with the largest increases (dimer/monomer ratio 20- to 30-fold) seen for the nitronaphthalimides and the phenazines. Based on the intrinsic cytotoxicity of the monomers and the highest degree of increase in cytotoxicity on dimerization, the most interesting chromophores appear to be the acridine-4-carboxamide and phenazine-1-carboxamide. Both of these compounds showed significant growth delays (approximately 6 days) in an in vivo colon 38 tumour model in mice.

Structure-activity relationships for substituted bis(acridine-4-carboxamides): a new class of anticancer agents.

A series of acridine-substituted bis(acridine-4-carboxamides) linked by a (CH2)3N(Me)(CH2)3 chain have been prepared by reaction of the isolated imidazolides of the substituted acridine-4-carboxylic acids with N,N-bis(3-aminopropyl)methylamine. These dimeric analogues of the mixed topoisomerase I/II inhibitor N-[2-(dimethylamino)ethyl]acridine-4-carboxamide (DACA), currently in clinical trial, show superior potencies to the corresponding monomeric DACA analogues in a panel of cell lines, including wild-type (JLC) and mutant (JLA and JLD) forms of human Jurkat leukemia. The latter mutant lines are resistant to topoisomerase II targeted agents because of lower levels of the enzyme. Analogues with small substituents (e.g., Me, Cl) at the acridine 5-position were clearly superior, with IC50's as low as 2 nM against the Lewis lung carcinoma and 11 nM against JLC. Larger substituents at any position caused a steady decrease in potency, likely due to lowering of DNA binding affinity. A small series of analogues of the most potent bis(5-methylDACA) compound, with second substituents (Me and Cl) in the 1- or 8- position had broadly similar potencies to the 5-Me compound, indicating that, while the 1- and 8-substituents are acceptable, they add little to the enhancing effect of the 5-methyl group. All of the compounds were at least equitoxic (some up to 4-fold more cytotoxic) against the mutant Jurkat lines than in the wild-type, consistent with a relatively greater effect on topoisomerase I compared with topoisomerase II. The bis(5-methylDACA) compound was found to inhibit the action of purified topoisomerase I in a cell-free assay. Compounds were on average 10-fold less cytotoxic in an MCF7 breast cancer line overexpressing P-glycoprotein than in the wild-type line and showed some selectivity for colon tumor lines in the NCI human tumor cell line panel. Several analogues produced significant growth delays in the relatively refractory subcutaneous colon 38 tumor model in vivo at substantially lower doses than DACA. The bis(acridine-4-carboxamides) represent a new and interesting class of potent topoisomerase inhibitors.

Pulsed-field gel electrophoresis typing of Hafnia alvei isolated from chub-packed and retail ground beef.

Thirty-eight isolates of Hafnia alvei were characterized by biochemical profiles, ribotyping and pulsed-field gel electrophoresis (PFGE) patterns. The isolates were recovered from chub-packed (19 isolates) or retail (nine isolates) ground beef, or were obtained from culture repositories (10 isolates). Biochemical profiling differentiated the 38 isolates into five groups and a commercial ribotyping method recognized 11 groups, whereas PFGE differentiated the same 38 isolates into 19 groups. These data substantiate that PFGE is a highly discriminatory tool for establishing the relatedness among Hafnia alvei strains.