Synthesis of Bodipy-Tagged Galactoconjugates and Evaluation of Their Antibacterial Properties.

As a development of our research on biocompatible glycoconjugate probes and specifically multi-chromophoric systems, herein, we report the synthesis and early bactericidal tests of two luminescent glycoconjugates whose basic structure is characterized by two boron dipyrromethene difluoride (BODIPY) moieties and three galactoside rings mounted on an oligophenylene ethynylene (OPE) skeleton. BODIPY fluorophores have found widespread application in many branches of biology in the last few decades. In particular, molecular platforms showing two different BODIPY groups have unique photophysical behavior useful in fluorescence imaging. Construction of the complex architecture of the new probes is accomplished through a convergent route that exploits a series of copper-free Heck-Cassar-Sonogashira cross-couplings. The great emergency due to the proliferation of bacterial infections, in conjunction with growing antibiotic resistance, requires the production of new multifunctional drugs and efficient methods for their targeted delivery to control bacteria-associated diseases. Preliminary studies of the glycoconjugate properties as antibacterial agents against representatives of Gram-negative (P. aeruginosa) and Gram-positive (S. aureus) pathogens, which are associated with chronic infections, indicated significant bactericidal activity ascribable to their structural features.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Rod-like nanostructures through amphiphilic OPE-porphyrin self-organization.

A new amphiphilic monosubstituted porphyrin functionalized by a ß-D-glucoside terminated oligophenylenethylene (OPE) able to self-arrange into nano-aggregates in polar solvents has been synthesized and fully characterized in its monomeric and aggregated forms.

Amino-OPE glycosides and blue light: a powerful synergy in photodynamic therapy.

Herein we report the synthesis and biological properties of sugar-conjugated oligophenylene ethynylene (OPE) dyes, used as novel photosensitizers (PSs) for photodynamic treatment (PDT) under blue light. The OPE-bearing glycosides at both ends are successfully prepared by a Pd-catalyzed Sonogashira cross-coupling reaction. The live-cell imaging studies have shown that these OPE glycosides (including glucose, mannose and maltose derivatives) efficiently penetrate the cytoplasm of cultured HeLa cancer cells. No dark toxicity was observed, but upon irradiating the cells under blue light an extraordinary photodynamic effect was observed at low concentrations (10-6-10-8 M). The localization studies indicate that OPE-glucose 1 and OPE-mannose 2 have Golgi patterns, whereas OPE-maltose 3 could be in lysosomes. The PDT and morphological studies in HeLa cells treated with sublethal doses of PS 1-3 revealed that cell death occurs by necrosis.

A Curcumin-BODIPY Dyad and Its Silica Hybrid as NIR Bioimaging Probes.

In this paper we describe the synthesis of a novel bichromophoric system in which an efficient photoinduced intercomponent energy transfer process is active. The dyad consists of one subunit of curcumin and one of BODIPY and is able to emit in the far-red region, offering a large Stokes shift, capable of limiting light scattering processes for applications in microscopy. The system has been encapsulated in MCM-41 nanoparticles with dimensions between 50 and 80 nm. Both the molecular dyad and individual subunits were tested with different cell lines to study their effective applicability in bioimaging. MCM-41 nanoparticles showed no reduction in cell viability, indicating their biocompatibility and bio-inertness and making them capable of delivering organic molecules even in aqueous-based formulations, avoiding the toxicity of organic solvents. Encapsulation in the porous silica structure directed the location of the bichromophoric system within cytoplasm, while the dyad alone stains the nucleus of the hFOB cell line.

A two-site reactive platform in the synthesis of amino-functionalized amphiphilic molecules via sulfenic acids.

The synthesis of some bolaamphiphiles is described. It is a convergent approach that allows the linkage of a glucosyl derivative to a bis-functionalized platform, via a copper-free Sonogashira cross-coupling. The central core was obtained from the reaction of a suitably substituted bis-sulfoxide with diethynyl benzenes. The intermediates of such reaction are sulfenyl functions that are easily added to one triple bond of the unsaturated molecules. The functionalization at the central core, through the nucleophilic addition of ammonia or piperidine onto the two vinyl sulfonyl groups already present in the backbones of the molecules, opened the way to the preparation of more complex derivatives. The observation of the formation of new stereogenic carbons with an unexpected significantly high diastereoselectivity was justified and supported by preliminary theoretical calculations. The two ending glucosyl moieties were favourably deprotected to afford the amino-functionalized bolaamphiphilic molecules.

Bodipy-carbohydrate systems: synthesis and bio-applications.

Luminescent BODIPY-sugar probes have stimulated the attention of researchers for the potential applications of such molecular systems in bio-imaging. The presence of carbohydrate units confers unique structural and biological features, beside enhancement of water solubility and polarity. On the other hand, BODIPY (BOronDiPYrromethene) derivatives represent eclectic and functional luminescent molecules because of their outstanding photophysical properties. This article provides a review on the synthesis and applications of BODIPY-linked glycosyl probes in which the labelling of complex carbohydrates with BODIPY allowed the disclosing of their in vivo behaviour or where the sugar constitutes a recognition element for specific targeting probes, or, finally, in which the stereochemical characteristics of the carbohydrate hydroxyl groups play as structural elements for assembling more than one photoactive subunit, resulting in functional supramolecular molecules with modulable properties. We describe the methods we have used to construct various multiBODIPY molecular systems capable of functioning as artificial antennas exhibiting extremely efficient and fast photo-induced energy transfer. Some of these systems have been designed to allow the modulation of energy transfer efficiency and emission color, and intensity dependent on their position within a biological matrix. Finally, future perspectives for such BODIPY-based functional supramolecular sugar systems are also highlighted.

A Portrait of the OPE as a Biological Agent.

Oligophenylene ethynylenes, known as OPEs, are a sequence of aromatic rings linked by triple bonds, the properties of which can be modulated by varying the length of the rigid main chain or/and the nature and position of the substituents on the aromatic units. They are luminescent molecules with high quantum yields and can be designed to enter a cell and act as antimicrobial and antiviral compounds, as biocompatible fluorescent probes directed towards target organelles in living cells, as labelling agents, as selective sensors for the detection of fibrillar and prefibrillar amyloid in the proteic field and in a fluorescence turn-on system for the detection of saccharides, as photosensitizers in photodynamic therapy (due to their capacity to highly induce toxicity after light activation), and as drug delivery systems. The antibacterial properties of OPEs have been the most studied against very popular and resistant pathogens, and in this paper the achievements of these studies are reviewed, together with almost all the other roles held by such oligomers. In the recent decade, their antifungal and antiviral effects have attracted the attention of researchers who believe OPEs to be possible biocides of the future. The review describes, for instance, the preliminary results obtained with OPEs against severe acute respiratory syndrome coronavirus 2, the virus responsible for the COVID-19 pandemic.

Light-up photoluminescence sensing of a nerve agent simulant by a bis-porphyrin-salen-UO2 complex.

A luminescent bis-porphyrin-salen-UO2 complex, showing a significant fluorescence light-up response upon reacting with DMMP (a simulant of nerve agents), is reported. The fluorescence change of this complex by excitation at 365 nm can be clearly observed with the naked eye, and this complex was successfully employed to construct a test paper to detect nerve agents.

Covalently Conjugated Gold-Porphyrin Nanostructures.

Gold nanoparticles show important electronic and optical properties, owing to their size, shape, and electronic structures. Indeed, gold nanoparticles containing no more than 30-40 atoms are only luminescent, while nanometer-sized gold nanoparticles only show surface plasmon resonance. Therefore, it appears that gold nanoparticles can alternatively be luminescent or plasmonic and this represents a severe restriction for their use as optical material. The aim of our study was the fabrication of nanoscale assembly of Au nanoparticles with bi-functional porphyrin molecules that work as bridges between different gold nanoparticles. This functional architecture not only exhibits a strong surface plasmon, due to the Au nanoparticles, but also a strong luminescence signal due to porphyrin molecules, thus, behaving as an artificial organized plasmonic and fluorescent network. Mutual Au nanoparticles-porphyrin interactions tune the Au network size whose dimension can easily be read out, being the position of the surface plasmon resonance strongly indicative of this size. The present system can be used for all the applications requiring plasmonic and luminescent emitters.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.

Enantiomeric Recognition of α-Aminoacids by a Uranyl Salen-Bis-Porphyrin Complex.

A novel uranyl salen-bis-porphyrin complex, in which two porphyrin subunits and salen moiety were directly linked, was synthesized for the recognition of tetrabutylammonium (TBA) amino acids. This uranyl salen complex, due to the presence of porphyrins with their fluorescence properties, represents the first example of a luminescence of uranyl salen complexes. UV/Vis measurements indicate the formation of 1:1 host-guest complexes, whereas UV-vis and fluorescence studies revealed that this complex acts as a receptor for the enantiomeric recognition of α-aminoacids derivatives, with high association constants and an excellent enantiomeric discrimination between the two enantiomers of phenylalanine-TBA.

Polyethersulfone Mats Functionalized with Porphyrin for Removal of Para-nitroaniline from Aqueous Solution.

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water. The functional mats in this study were obtained by two different approaches based on fiber impregnation or doping. In particular, meso-tetraphenyl porphyrin (H2TPP) or zinc(II) meso-tetraphenyl porphyrin (ZnTPP) were immobilized on the surface of PES fiber mats by dip-coating or added to the PES electrospun solution to obtain porphyrin-doped PES mats. The presence of porphyrins on the fiber surfaces was confirmed by UV-Vis spectroscopy, fluorescence measurements, and XPS analysis. p-NA removal from water solutions was spectrophotometrically detected and evaluated.

Covalently functionalized carbon nanoparticles with a chiral Mn-Salen: a new nanocatalyst for enantioselective epoxidation of alkenes.

A new protocol to obtain carbon nanoparticles (CNPs) covalently functionalized with a chiral Mn-Salen catalyst is described here. The new nanocatalyst (CNPs-Mn-Salen) was tested in the enantioselective epoxidation of some representative alkenes (CN-chromene, 1,2-dihydronaphthalene and cis-ß-ethyl styrene), obtaining better enantiomeric excess values than that of the catalyst single molecule, highlighting the role of the nanostructure in the enantioselectivity.

Chiral Recognition of L- and D- Amino Acid by Porphyrin Supramolecular Aggregates.

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H4TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control. Finally, the chiral porphyrin aggregates obtained exhibit strong chiral inertia.

Interactions Between Spermine-Derivatized Tentacle Porphyrins and The Human Telomeric DNA G-Quadruplex.

G-rich DNA sequences have the potential to fold into non-canonical G-Quadruplex (GQ) structures implicated in aging and human diseases, notably cancers. Because stabilization of GQs at telomeres and oncogene promoters may prevent cancer, there is an interest in developing small molecules that selectively target GQs. Herein, we investigate the interactions of meso-tetrakis-(4-carboxysperminephenyl)porphyrin (TCPPSpm4) and its Zn(II) derivative (ZnTCPPSpm4) with human telomeric DNA (Tel22) via UV-Vis, circular dichroism (CD), and fluorescence spectroscopies, resonance light scattering (RLS), and fluorescence resonance energy transfer (FRET) assays. UV-Vis titrations reveal binding constants of 4.7 × 106 and 1.4 × 107 M-1 and binding stoichiometry of 2⁻4:1 and 10⁻12:1 for TCPPSpm4 and ZnTCPPSpm4, respectively. High stoichiometry is supported by the Job plot data, CD titrations, and RLS data. FRET melting indicates that TCPPSpm4 stabilizes Tel22 by 36 ± 2 °C at 7.5 eq., and that ZnTCPPSpm4 stabilizes Tel22 by 33 ± 2 °C at ~20 eq.; at least 8 eq. of ZnTCPPSpm4 are required to achieve significant stabilization of Tel22, in agreement with its high binding stoichiometry. FRET competition studies show that both porphyrins are mildly selective for human telomeric GQ vs duplex DNA. Spectroscopic studies, combined, point to end-stacking and porphyrin self-association as major binding modes. This work advances our understanding of ligand interactions with GQ DNA.

Supramolecular complexes for nanomedicine.

Host-guest interactions studied in supramolecular chemistry have been inspired by interactions between enzymes and substrates. Furthermore, most of the interactions involved in the cells are based on non-covalent bonds between two or more molecules. The common aspects between supramolecular chemistry and medicine have led to the development of a "new" area called "supramolecular medicine", in which non-covalent interactions and self-assembly processes are applied within several medical fields. The object of this Digest is to offer an account of how some macrocyclic hosts (e.g. cucurbiturils, cyclodextrins, pillararenes and calixarenes) are employed in supramolecular medicine creating new supramolecular hydrogels used as biomaterials for human tissue in regenerative medicine, and a diagnostic instrument, in-vitro and in-vivo, for the detection of diseases, as well as for the investigation of cell morphology.

Driving Coordination Polymer Monolayer Formation by Competitive Reactions at the Air/Water Interface.

We have developed a novel approach enabling us to follow and facilitate the formation of two-dimensional coordination polymer monolayers directly at the air/water interface without the need of complex instrumentation. The method is based on the use of a surface active ligand that, when spread at the air/water interface, progressively undergoes hydrolysis with consequent gradual decrease in surface pressure. Notably, if the aqueous subphase contains metal ions capable of coordinating the ligand, coordination competes with hydrolysis, resulting in a lower surface pressure decrease. As a consequence, the formation of the coordination polymer monolayer can be verified simply by surface pressure measurements. Competition between hydrolysis and coordination was investigated as a function of the main experimental parameters affecting the two reactions, enabling the formation of stable coordination polymer monolayers with controlled density. Finally, the formation of continuous rigid 2D layers was confirmed by compression isotherms and ex situ morphological characterization. This work will simplify the verification of coordination polymer monolayer formation; thus, it will boost the synthesis of novel and innovative 2D materials.

Chirality Enhancement of Porphyrin Supramolecular Assembly Driven by a Template Preorganization Effect.

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.