Comparative application of microfluidic systems in circulating tumor cells and extracellular vesicles isolation; a review.

Cancer is a prevalent cause of mortality globally, where early diagnosis leads to a reduced death rate. Many researchers' common strategies are based on personalized diagnostic methods with rapid response and high accuracy. This technology was developed by applying liquid biopsy instead of tissue biopsies in the case of tumor cell analysis that facilitates point-of-care testing for cancer diagnosis and treatment. In recent years, significant progress in microfluidic technology led to the successful isolation, analysis, and monitoring of cancer biomarkers in body liquid biopsy with merits like high sensitivity and flexibility, low sample usage, cost effective, and the ability of automation. The most critical and informative markers in body liquid refer to circulating tumor cells (CTCs) and extracellular vesicles derived from tumors (EVs) that carry various biomarkers in their structure (DNAs, proteins, and RNAs) as compared to ctDNA. The released ctDNA has a low half-life and decreased sensitivity due to large amounts of nucleic acid in serum. This review intends to highlight different cancer screening tests with a particular focus on the details regarding the only FDA-approved and awaiting technologies for FDA clearance to isolate CTCs and EVs based on microfluidics systems.

Isolation and characterization of a novel GRP78-specific single-chain variable fragment (scFv) using ribosome display method.

Glucose-regulated protein 78 (GRP78) is a well-characterized endoplasmic reticulum (ER) chaperon frequently overexpressed at the surface of tumor cells and associated with tumor survival, metastasis, and chemoresistance. Hence, potential GRP78 binders emerge as promising candidates for cancer therapy and diagnosis. We applied ribosome display to isolate a single-chain variable domain (scFv) specific for the C-terminal domain of a recombinant human GRP78 (CGRP). Six female BALB/c mice were immunized and then splenocyte mRNA was extracted. An scFv-ribosome display library was established by joining the amplified VH/Vκ fragments through a 72-bp linker using overlap extension PCR. Then, selection was performed by applying two rounds of eukaryotic ribosome display panning with stepwise decreased amount of CGRP. Ultimately, the selected scFv was characterized using the indirect-ELISA assay, competitive-ELISA assay, Western blotting, Surface Plasmon Resonance (SPR), and in-silico analyses. The constructed library had a length of ~ 1100 bp and the high-affinity scFvs were isolated using the outputs of the final panning round. Among 60 positive clones, GSF3 was selected and its expression, purification, and binding capacity was confirmed by SDS-PAGE and Western blotting. GSF3 exhibited an affinity of 13 × 107 M-1 to CGRP as assessed by SPR. Moreover, the in-silico analyses indicated that GSF3 binds the C-terminal domain of GRP78 through key residues engaged in antibody-antigen interactions. We found that ribosome display is a swift and reliable technique for specific and high-affinity scFv isolation. Moreover, our results suggest that GSF3 might be applied as a potential cancer immunotherapeutic and diagnostic tool if this approach is carefully followed by successful preclinical and clinical evaluations to validate the findings for further confirmation.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Identification and evaluation of novel vaccine candidates against Shigella flexneri through reverse vaccinology approach.

Shigellosis is a significant type of diarrhea that causes 160,000 deaths annually in a global scale. The mortality occurs mainly in children less than 5 years of age. No licensed vaccine is available, and conventional efforts for developing an effective and safe vaccine against shigellosis have not been succeeded yet. The reverse vaccinology is a novel promising method that screens genome or proteome of an organism for finding new vaccine candidates. In this study, through reverse vaccinology approach, new vaccine candidates against Shigella flexneri were identified and experimentally evaluated. Proteomes of S. flexneri were obtained from UniProt, and then outer membrane and extracellular proteins were predicted and selected for the evaluation of transmembrane domains, protein conservation, host homology, antigenicity, and solubility. From 103 proteins, 7 high-scored proteins were introduced as novel vaccine candidates, and after B- and T-cell epitope prediction, the best protein was selected for experimental studies. Recombinant protein was expressed, purified, and injected to BALB/c mice. The adhesion inhibitory effect of sera was also studied. The immunized mice demonstrated full protection against the lethal dose challenge. The sera remarkably inhibited S. flexneri adhesion to Caco-2 epithelial cells. The results indicate that identified antigen can serve for vaccine development against shigellosis and support reverse vaccinology for discovering novel effective antigens. KEY POINTS: • Seven Shigella new antigens were identified by reverse vaccinology (RV) approach. • The best antigen experimented demonstrated full protection against lethal dose. • In vivo results verified RV analyses and suggest FimG as a new potent vaccine candidate.

Isolation and characterization of a novel nanobody for detection of GRP78 expressing cancer cells.

Glucose-regulated protein 78 (GRP78) is an endoplasmic reticulum (ER) chaperone that has been shown that is overexpressed in cancer cells. Overexpression of GRP78 on cancer cells makes this molecule a suitable candidate for cancer detection and targeted therapy. VHH is the binding fragment of camelid heavy-chain antibodies also known as "nanobody." The aim of this study is to isolate and produce a new recombinant nanobody using phage display technique to detect cancer cells. Using the c-terminal domain of GRP78 (CGRP) as an antigen, four rounds of biopanning were performed, and high-affinity binders were selected by ELISA. Their affinity and functionality were characterized by surface plasmon resonance (SPR) cell ELISA and immunocytochemistry. A unique nanobody named V80 was purified. ELISA and SPR showed that this antibody had high specificity and affinity to the GRP78. Immunofluorescence analysis showed that V80 could specifically bind to the HepG2 and A549 cancer cell lines. This novel recombinant nanobody could bind to the cell surface of different cancer cells. After further evaluation, this nanobody can be used as a new tool for cancer detection and tumor therapy.

Protective effects of egg yolk immunoglobulins (IgYs) developed against recombinant immunogens CtxB, OmpW and TcpA on infant mice infected with Vibrio cholerae.

Vibrio cholerae causes cholera and other infections, especially in children under five years of age. Cholera toxin (CT), toxin-coregulated pilus (TCP) and outer membrane protein W (OmpW) are three major virulence factors of this bacterium. The emergence of antimicrobial-resistant (AMR) strains and the absence of a comprehensive and flawless vaccine, has prompted other treatments. There are several advantages of egg yolk antibodies (IgY) over other immunotherapy agents, such as economic feasibility, high yield simple production, and better immune responsiveness to mammalian antigens due to phylogenetic distance. Accordingly, in the present study, IgYs against recombinant proteins CtxB (responsible for the CT binding to eukaryotic cells), TcpA (enhances bacterial attachment to enterocytes) and OmpW were produced, in single, coupled or combined forms, to evaluate and compare their protectivity potency. Immunoreactivity of IgYs were examined through protein and whole cell ELISA, their specificity was confirmed by western blotting, and their neutralizing effects on CT was evaluated in Y1 cell culture. Produced IgYs were gavage administered to different groups of infant mice infected with V. cholerae. The results indicated that IgYs produced against CtxB had the highest titers, and were able to neutralize cytotoxicity effects in Y1 cell culture, while the highest protection in the mice challenge was obtained by IgY-TcpA. No considerable increase was observed in immunoreactivity or protectivity of antibodies produced against combined antigens. The produced IgYs showed a good antigen-specificity and protectivity which can be used in passive immunotherapy against cholera.

Identification of novel vaccine candidate against Salmonella enterica serovar Typhi by reverse vaccinology method and evaluation of its immunization.

Salmonella enterica serovar Typhi (S. Typhi) is an essential enteric fever causing bacterium worldwide. Due to the emergence of multidrug-resistant strains, urgently attention is needed to prevent the global spread of them. Vaccination is an alternative approach to control these kinds of infections. Currently available commercial vaccines have significant limitations such as non-recommendation for children below six years of age and poor long-term efficacy. Thus, the development of a new vaccine overcoming these limitations is immediately required. Reverse Vaccinology (RV) is one of the most robust approaches for direct screening of genome sequence assemblies to identify new protein-based vaccines. The present study aimed to identify potential vaccine candidates against S. Typhi by using the RV approach. Immunogenicity of the best candidate against S. Typhi was further investigated. The proteome of S. Typhi strain Ty2 was analyzed to identify the most immunogenic, conserved, and protective surface proteins. Among the predicted vaccine candidates, steD (fimbrial subunit) was the best for qualifying all the applied criteria. The synthetic steD gene was expressed in E.coli, and the mice were immunized with purified recombinant steD protein and then challenged with a lethal dose of S. Typhi. Immunized animals generated high protein-specific antibody titers and demonstrated 70% survival following lethal dose challenge with S. Typhi. Pretreatment of the S. Typhi cells with immunized mice antisera significantly decreased their adhesion to Caco-2 cells. Altogether, steD as a protective antigen could induce a robust and long term and protective immunity in immunized mice against S. Typhi challenge.

Aptamer-Based Sandwich Assay for Measurement of Thymidine Kinase 1 in Serum of Cancerous Patients.

Thymidine kinase 1 (TK1) is traditionally a serum biomarker that is elevated in the early stages of malignancies. The diagnostic and prognostic role of TK1 for screening and monitoring human malignancies has recently been investigated. Anti-human TK1 aptamers were selected through 12 iterative rounds of systematic evolution of ligands by exponential enrichment from a DNA library. The aptamer pool of round 12 was amplified, and the polymerase chain reaction product was cloned on the TA vector. Of the 85 colonies obtained, 52 were identified as positive clones. These aptamers were screened for TK1 with surface plasmon resonance, where apta37 and apta69 showed the highest affinity for TK1. The TK1_apta37 and TK1_apta69 aptamers were used in a sandwich assay platform and successfully detected TK1 in the concentration range of 54-3500 pg mL-1. Clinical samples from 60 cancerous patients were also tested with this assay system and compared using the conventional antibody-based enzyme-linked immunosorbent assay kit. The aptamer sandwich assay demonstrated a dynamic range for TK1 at clinically relevant serum levels, covering subpicogram per milliliter concentrations. The new approach offers a simple and robust method for detecting serum biomarkers that have low and moderate abundance. The results of this study demonstrate the screening capability of the aptamer sandwich assay platform and its potential applicability to the point-of-care testing system.

A Comparison Between Cell, Protein and Peptide-Based Approaches for Selection of Nanobodies Against CD44 from a Synthetic Library.

BACKGROUND: The hyaluronic acid receptor CD44, is a cancer stem cell biomarker, playing important roles in cell adhesion, tumor progression and drug-resistance. Therefore, CD44 is a potential target for cancer treatment and its blockade could result in multi-factorial therapeutic effects. METHODS: Nanobodies against CD44 were isolated from a synthetic library with a diversity of 5×1011 CFU/ml using the phage display technique. Three approaches were used for isolation of nanobodies fragments including peptide-, protein- and cell-based panning. RESULTS: Nanobodies from cell-based panning displayed more specificity compared to protein or peptide-based panning. Our results show that cell-based panning is the most efficient method for isolation of a specific single domain antibody fragment to CD44 from a synthetic phage displayed library. CONCLUSION: The isolated nanobodies could successfully recognize and bind cells that express the CD44 surface antigen.

Immunogenicity of enterotoxigenic Escherichia coli outer membrane vesicles encapsulated in chitosan nanoparticles.

OBJECTIVES: Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrheal disease in humans, particularly in children under 5 years and travelers in developing countries.To our knowledge, no vaccine is licensed yet to protect against ETEC infection. Like many Gram-negative pathogens, ETEC can secrete outer membrane vesicles (OMVs). These structures contain various immunogenic virulence proteins such as LT and therefore can be used as vaccine candidates. In this study we attempted to isolate the OMVs of ETEC cultivated at different temperatures and evaluate their immunogenicity and protective efficacy in a murine model of infection. MATERIALS AND METHODS: OMVs was purified from bacterial supernatant by ultracentrifugation. OMVs were encapsulated in chitosan nanoparticles prepared by ionic gelation method within a layer of Eudragit L100 for oral delivery. Female BALB/c mice of 9 weeks' old were immunized by parenteral injection and oral administration with free and encapsulated OMVs obtained from bacteria cultivated at 37°C and 42°C. The serum samples were collected and the antibody titers were measured by an enzyme-linked immunosorbent assay (ELISA). RESULTS: The protein concentrations of OMVs were 3.47 mg/ml and 2.46 mg/ml for bacteria grown at 37°C and 42°C respectively. OMVs loaded into nanoparticles (NP-OMVs) were homogeneous and spherical in shape, with a size of 532 nm. The encapsulation efficiency of NP was 90%. Mice immunized with OMVs, inhibited the ETEC colonization in their small intestine and induced production of antibodies against LT toxin. CONCLUSION: The results obtained in this research place OMVs among promising candidates to be used for vaccination.

Synthetic peptides mimicking lipopolysaccharide as a potential vaccine candidates against Vibrio cholerae serogroup O1.

BACKGROUND AND OBJECTIVES: Cholera is a life-threatening diarrhea caused mainly by Gram-negative marine habitant Vibrio cholerae serogroup O1. Cholera vaccination is limited mainly to developed countries, due to the cumbersome and expensive task of vaccine production. In the present work, the aim was to study the immunogenicity of the synthetic mimotopes through two different routes of injection and oral administration. Lipopolysaccharide (LPS) is one of the immunogenic components in Gram-negative bacteria, which cannot be used as a vaccine candidate, due to its high toxic effect. MATERIALS AND METHODS: Three phage-displayed selected peptides, with high affinity to anti-LPS VHH tested in our previous study, were chemically synthesized and used as a potential vaccine candidate. In order to enhance the antigenic properties and safe delivery, these peptides were conjugated to BSA as a carrier and encapsulated with PLGA. Peptides were injected intra-peritoneally or administered orally, alone or in combined form. Mice sera and feces were collected for assessment of humoral and mucosal antibody titers, respectively. ELISA plates were coated with mimotope conjugates and V. cholerae, Shigella sonnei and ETEC were used as target antigens. Antibody titer was measured by adding IgG and IgA as primary antibodies. RESULTS: Mice receiving three selected synthetic peptide conjugates (individually or in combination) showed higher antibody titer compared to control groups. The mice immunized with synthetic peptides were protected against more than 15 LD50 of V. cholerae. CONCLUSION: These peptides are mimicking LPS and can potentially act as vaccine candidates against V. cholerae.

Identification and in vitro characterization of novel nanobodies against human granulocyte colony-stimulating factor receptor to provide inhibition of G-CSF function.

It has been shown that Granulocyte colony-stimulating factor (G-CSF) has a higher expression in malignant tumors, and anti-G-CSF therapy considerably decreases tumor growth, tumor vascularization and metastasis. Thus, blocking the signaling pathway of G-CSF could be beneficial in cancer therapy. This study is aimed at designing and producing a monoclonal nanobody that could act as an antagonist of G-CSF receptor. Nanobodies are the antigen binding fragments of camelid single-chain antibodies, also known as VHH. These fragments have exceptional properties which makes them ideal for tumor imaging and therapeutic applications. We have used our previously built nanobody phage libraries to isolate specific nanobodies to the G-CSF receptor. After a series of cross-reactivity and affinity experiments, two unique nanobodies were selected for functional analysis. Proliferation assay, real-time PCR and immunofluorescence assays were used to characterize these nanobodies. Finally, VHH26 nanobody that was able to specifically bind G-CSF receptor (G-CSF-R) on the surface of NFS60 cells and efficiently block G-CSF-R downstream signaling pathway in a dose-dependent manner was selected. This nanobody could be further developed into a valuable tool in tumor therapy and it forms a basis for additional studies in preclinical animal models.

Development of lipopolysaccharide-mimicking peptides and their immunoprotectivity against Vibrio cholerae serogroup O1.

Vibrio cholerae serogroup O1 is the main causative agent of cholera diseases defined by life threatening rice watery diarrhea. Cholera routine vaccination has failed in controlling epidemics in developing countries because of their hard and expensive production. In this study, our aim was to investigate phage displayed mimotopes that could mimic V. cholerae lipopolysaccharide (LPS). Although LPS of Vibrio, as an endotoxin, can stimulate the immune system, thereby making it a suitable candidate for cholera vaccine, its toxicity remains as a main problem. Phage particles displaying 12 amino acid peptides were selected from phage library mimicking the antigenic epitopes of LPS from vibrio. The screening was carried out using single-domain antibody fragment VHH against LPS as target through three rounds of selection. Three clones with highest affinity to VHH were selected. To find out a new and efficient vaccine against cholera, these three phage particles containing high-affinity peptides were administered to mice to investigate the active and passive immunity. Out of 20 particles, three showed the highest affinity toward VHH. ELISA was carried out with immunized mice sera using LPS and three selected phages particles individually. ETEC, Shigella sonnei, and clinical isolates were used as bacterial targets. These three selected phages (individually or in combination) could stimulate mice immune system producing active and passive immunity. The mice immunized with phage particles could protect about 14 LD50 of V. cholerae. In conclusion, these peptides are mimicking LPS and can potentially act as vaccine candidates against V. cholerae. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.

Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates.

Camelid-derived heavy-chain nanobody against Clostridium botulinum neurotoxin E in Pichia pastoris.

Botulinum neurotoxins (BoNTs) result in severe and often fatal disease, botulism. Common remedial measures such as equine antitoxin and human botulism immunoglobulin in turn are problematic and time-consuming. Therefore, diagnosis and therapy of BoNTs are vital. The variable domain of heavy-chain antibodies (VHH) has unique features, such as the ability to identify and bind specifically to target epitopes and ease of production in bacteria and yeast. The Pichia pastoris is suitable for expression of recombinant antibody fragments. Disulfide bond formation and correct folds of protein with a high yield are some of the advantages of this eukaryotic host. In this study, we have expressed and purified the camelid VHH against BoNT/E in P. pastoris. The final yield of P. pastoris-expressed antibody was estimated to be 16 mg/l, which is higher than that expressed by Escherichia coli. The nanobody expressed in P. pastoris neutralized 4LD50 of the BoNT/E upon i.p. injection in 25% of mice. The nanobody expressed in E. coli extended the mice's survival to 1.5-fold compared to the control. This experiment indicated that the quality of expressed protein in the yeast is superior to that of the bacterial expression. Favorable protein folding by P. pastoris seems to play a role in its better toxin-binding property.

Recombinant outer membrane protein F-B subunit of LT protein as a prophylactic measure against Pseudomonas aeruginosa burn infection in mice.

AIM: To study immunogenicity of outer membrane protein F (OprF) fused with B subunit of LT (LTB), against Pseudomonas aeruginosa (P. aeruginosa). METHODS: The OprF, a major surface exposed outer membrane protein that is antigenically conserved in various strains of P. aeruginosa, is a promising immunogen against P. aeruginosa. In the present study recombinant OprF and OprF-LTB fusion gene was cloned, expressed and purified. BALB/c mice and rabbits were immunized using recombinant OprF and OprF-LTB and challenged at the burn site with P. aeruginosa lethal dose of 10(4) CFU. The protective efficacy of rabbit anti OprF IgG against P. aeruginosa burn infection was investigated by passive immunization. RESULTS: It has been well established that the LTB is a powerful immunomodulator with strong adjuvant activity. LTB as a bacterial adjuvant enhanced immunogenicity of OprF and anti OprF IgG titer in serum was increased. Experimental findings showed significantly higher average survival rate in burned mice immunized with OprF-LTB than immunized with OprF or the control group. Rabbits anti OprF IgG brought about 75% survival of mice following challenge with P. aeruginosa. Post challenge hepatic and splenic tissues of mice group immunized with OprF-LTB had significantly lower bacterial load than those immunized with OprF or the control groups. CONCLUSION: These results demonstrate that LTB-fused OprF might be a potential candidate protein for a prophylactic measure against P. aeruginosa in burn infection.

Production of Novel VHH Nanobody Inhibiting Angiogenesis by Targeting Binding Site of VEGF.

Vascular endothelial growth factor (VEGF) is one of the key players in angiogenesis and is considered as one of the major targets in cancer therapy. VEGF is secreted by the cancerous cells to form new vessels that carry oxygen and nutrients to the tumor, allowing it to grow beyond 1-2 mm. Cancerous cells spread using these veins and cause malignancy. Therefore, neutralization of VEGF could prevent tumor growth and malignancy, and nowadays, antibodies are widely used for such purpose. Among antibody fragments, nanobodies possess unique characteristics which make them appropriate tools for cancer therapy. In this study, the receptor-binding region of VEGF was used to produce a nanobody using phage display technology. A camel was immunized with the recombinant VEGF, and VHH fragments were amplified using nested PCR on lymphocyte complementary DNA (cDNA). The highest binding affinity was achieved after three rounds of panning. Twenty-four clones were tested by monoclonal phage ELISA, and the clone with the highest affinity (VA12) was selected for soluble expression of nanobody. VA12 was tested under various physicochemical conditions and showed considerable stability in extreme temperatures, pH, and various urea concentrations. Stability of VA12 under such conditions is considered as an advantage over the prevailing antibodies.

In silico analysis of Acinetobacter baumannii phospholipase D as a subunit vaccine candidate.

The rate of human health care-associated infections caused by Acinetobacter baumannii has increased significantly in recent years for its remarkable resistance to desiccation and most antibiotics. Phospholipases, capable of destroying a phospholipid substrate, are heterologous group of enzymes which are believed to be the bacterial virulence determinants. There is a need for in silico studies to identify potential vaccine candidates. A. baumannii phospholipase D (PLD) role has been proved in increasing organism's resistance to human serum, destruction of host epithelial cell and pathogenesis in murine model. In this in silico study high potentials of A. baumannii PLD in elicitation of humoral and cellular immunities were elucidated. Thermal stability, long half-life, non-similarity to human and gut flora proteome and non-allergenicity were in a list of A. baumannii PLD positive properties. Potential epitopic sequences were also identified that could be used as peptide vaccines against A. baumannii and various other human bacterial pathogens.

A CssA, CssB and LTB chimeric protein induces protection against Enterotoxigenic Escherichia coli

OBJECTIVES: Enterotoxigenic Escherichia coli (ETEC), a major cause of diarrhea in children under 5, is an important agent for traveler's diarrhea. Heat-labile enterotoxin (LT) and colonization factors (CFs) are two main virulence mechanisms in ETEC. CS6 is one of the most prevalent CFs consisting of two structural subunits viz., CssA, CssB, necessary for attachment to the intestinal cells. METHODS: In the present research, a chimeric trivalent protein composed of CssB, CssA and LTB was constructed. The chimeric gene was synthesized with codon bias of E. coli for enhanced expression of the protein. Recombinant proteins were expressed and purified. Mice were immunized with the recombinant protein. The antibody titer and specificity of the immune sera were analyzed by ELISA and Western blotting. Efficiency of the immune sera against ETEC was evaluated. RESULTS: Antibody induction was followed by immunization of mice with the chimeric protein. Pretreatment of the ETEC cells with immunized animal antisera remarkably decreased their adhesion to Caco-2 cells. DISCUSSION: The results indicate efficacy of the recombinant chimeric protein as an effective immunogen, which induces strong humoral response as well as protection against ETEC adherence and toxicity. .

Prevalent phenotypic and genotypic profile of enterotoxigenic Escherichia coli among Iranian children.

Enterotoxigenic Escherichia coli (ETEC) is the most common cause of diarrhea among children. ETEC strains express colonization factors (CFs), which mediate adherence to the small intestinal epithelium and produce entrotoxins that induce diarrhea. Here, we characterized the phenotypes and genotypes of ETEC strains from 261 diarrheal stool samples from Iranian children. The prevalence of ETEC was 8.04%. Most of the isolates were positive for heat-labile and heat-stable toxins. CFA/I, CS3, CS2, and CS5 were detected from some of the clinical isolates. 33.3% of the isolates did not express CFs. The majority of ETEC isolates were identified as O127 and O128 serotypes, and 57% of the strains were resistant to more than 1 antimicrobial agent. Heat-labile enterotoxin activity was confirmed using the Y1 adrenal cell assay, rabbit ileal loop and adenylate cyclase activation tests. Regional phenotypic and genotypic characterization could help to elucidate the ecology and pathogenicity of ETEC to efficiently reduce the burden of illness brought about by ETEC. This study may lead to development of effective prophylactic measures.