Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil.

In Brazil, non-cultivated plants, especially weeds, are infected with a diversity of begomoviruses and often show striking golden mosaic symptoms. In the present study, leaves showing these symptoms were collected from Sida sp. plants in Guadalupe, Piaui State, Northeastern Brazil, in 2015 and 2016. PCR tests with degenerate primers revealed the presence of begomovirus DNA-A and DNA-B components. Restriction enzyme digestion of rolling circle-amplified DNA revealed fragments totaling ~5.2 kb, indicating infection by a bipartite begomovirus. The DNA-A and DNA-B components have a genome organization typical of New World (NW) bipartite begomoviruses and a common region of 220 nucleotides (nt) with 96% identity, indicating these are cognate components. Comparisons performed with the DNA-A sequence revealed the highest nt sequence identity (84%) with that of sida angular mosaic virus (SiAMV), whereas those performed with the DNA-B sequence revealed highest identity (77%) with that of sida chlorotic vein virus (SiCVV). In phylogenetic analyses, the DNA-A sequence was placed in a strongly supported clade with SiAMV and SiCVV from Piaui, whereas the DNA-B sequence was placed in a clade with SiCVV and corchorus mottle virus. Based on the current ICTV criteria for the demarcation of begomovirus species (<91% nt sequence identity for the DNA-A component), this is a member of a new species for which the name "Sida yellow golden mosaic virus" is proposed.

Characterization of tomato leaf curl purple vein virus, a new monopartite New World begomovirus infecting tomato in Northeast Brazil.

A new begomovirus species was identified from tomato plants with upward leaf curling and purple vein symptoms, which was first identified in the Piaui state of Northeast (NE) Brazil in 2014. Tomato leaf samples were collected in 2014 and 2016, and PCR with degenerate primers revealed begomovirus infection. Rolling circle amplification and restriction enzyme digestion indicated a single genomic DNA of ~ 2.6 kb. Cloning and sequencing revealed a genome organization similar to DNA-A components of New World (NW) bipartite begomoviruses, with no DNA-B. The complete nucleotide sequence had the highest identity (80%) with the DNA-A of Macroptilium yellow spot virus (MacYSV), and phylogenetic analyses showed it is a NW begomovirus that clusters with MacYSV and Blainvillea yellow spot virus, also from NE Brazil. Tomato plants agroinoculated with a dimeric clone of this genomic DNA developed upward leaf curling and purple vein symptoms, indistinguishable from those observed in the field. Based on agroinoculation, this virus has a narrow host range, mainly within the family Solanaceae. Co-inoculation experiments with tomato severe rugose virus and tomato mottle leaf curl virus, the two predominant begomoviruses infecting tomato in Brazil, revealed a synergistic interaction among these begomoviruses. The name Tomato leaf curl purple vein virus (ToLCPVV) is proposed for this new begomovirus.

Recent Emergence of the Mild Strain of Tomato yellow leaf curl virus as a Cause of Tomato Yellow Leaf Curl Disease of Processing Tomatoes (Solanum lycopersicon) in the Dominican Republic.

In the early 1990s, the monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) was introduced into the Dominican Republic (DO), and molecular characterization revealed it was an isolate of TYLCV-Israel (TYLCV-IL[DO]) (3,5). In 2006, a study of the variability of TYLCV in DO revealed that TYLCV-IL[DO] was associated with all samples of tomato yellow leaf curl (TYLC) tested and, thus, that the virus had been genetically stable for >15 years (2). However, in 2010 and 2011, 2 of 10 and 11 of 18 samples of TYLC, respectively, were negative for TYLCV infection based upon PCR with the TYLCV-specific primer pair, 2560v (5'-GAGAACAATTGGGATATG-3')/1480c (5'-AATCATGGATTCACGCAC-3'), which directs the amplification of a ~1.7 kb fragment. In 2011, two such samples from the Azua Valley were tested by PCR with the 1470v (5'-AGTGATGAGTTCCCCTGTGC-3')/UPC2 primer pair (1), and sequence analysis of the ~0.4 kb fragment amplified from both samples revealed infection with the mild strain of TYLCV (TYLCV-Mld). A primer specific for TYLCV-Mld was designed (2070v, 5'-AAACGGAGAAATATATAAGGAGCC-3'), and PCR with the 2070v/1480c primer pair directed the amplification of the expected ~2.1 kb fragment from all 11 TYLC samples collected in 2011 that were PCR-negative for TYLCV-IL[DO] infection. Sequence analyses confirmed these were TYLCV-Mld fragments. The complete TYLCV-Mld genome was amplified from two samples from the Azua Valley with Templiphi, the amplified DNA products digested with Sal I, and the resulting ~2.8 kb fragments ligated into Sal I-digested pGEM-11. The complete sequences of these isolates were 2,791 nt and 99% identical to each other and 98% identical to sequences of TYLCV-Mld isolates. The TYLCV-Mld isolates from the DO were designated TYLCV-Mld:DO:TY5:01:2011 (KJ913682) and TYLCV-Mld:DO:TY5:02:2011 (KJ913683). A multimeric clone of TYLCV-Mld:DO:TY5:01:2011 was generated in the binary vector pCAMBIA1300 by cloning a 2.2 kb Sal I-EcoRI fragment containing the intergenic region to generate a 0.8-mer (pCTYMld0.8), and then the full-length Sal I fragment was cloned into the Sal I site of pCTYMld0.8 to generate a 1.8-mer (pCTYMldDO-01-1.8). Tomato plants agroinoculated with Agrobacterium tumefaciens carrying pCTYMldDO-01-1.8 developed severe TYLC disease symptoms 10 to 14 days after inoculation, whereas plants inoculated with a strain carrying the empty vector did not develop symptoms. Samples of processing tomatoes with TYLC were collected in 2012 to 2014 in the DO and tested for TYLCV-IL[DO] and TYLCV-Mld by PCR with the 2560v/1480c and 2070v/1480c primers pairs, respectively; these samples had infections of 93% (13/14), 86% (18/21), and 61% (11/18) with TYLCV-Mld; 29% (4/14), 19% (4/21), and 56% (10/18) with TYLCV-IL[DO]; and 21% (3/14), 5% (1/21), and 28% (5/18) with both viruses, respectively. These results reveal that there has been a striking population shift in the begomovirus causing TYLC in the DO, with TYLCV-Mld becoming predominant. This may reflect selection pressure(s) favoring a small pre-existing population of TYLCV-Mld, such as new tomato varieties, or a recent introduction event, such as that described in Venezuela (4). References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (2) R. L. Gilbertson et al. Page 279 in: Tomato yellow leaf curl virus disease. Springer, 2007. (3) M. K. Nahkla et al. Plant Dis. 78:926, 1994. (4) G. Romay et al. Australasian Plant Dis. Notes, in press, 2014. (5) R. Salati et al. Phytopathology 92:487, 2002.

First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic.

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.

Genetic diversity in curtoviruses: a highly divergent strain of Beet mild curly top virus associated with an outbreak of curly top disease in pepper in Mexico.

A full-length curtovirus genome was PCR-amplified and cloned from peppers in Mexico with symptoms of curly top disease. The cloned DNA of this isolate, MX-P24, replicated in Nicotiana tabacum protoplasts and was infectious in N. benthamiana plants. Sequence analysis revealed that the MX-P24 isolate had a typical curtovirus genome organization and was most similar to beet mild curly top virus (BMCTV). However, sequence identities were at the threshold value for establishment of a new curtovirus species. To further investigate the biological properties of MX-P24, an agroinoculation system was generated. Agroinoculated shepherd's purse plants developed typical curly top symptoms, and virus from these plants was transmissible by the beet leafhopper (Circulifer tenellus). The host range of MX-P24 was similar to that of BMCTV, with curly top symptoms induced in common bean, pepper, pumpkin, shepherd's purse and tomato plants and mild or no symptoms induced in sugar beet plants. Together, these results indicate that MX-P24 is a highly divergent strain of BMCTV associated with an outbreak of curly top disease in peppers in Mexico.

Tomato chocolate spot virus, a member of a new torradovirus species that causes a necrosis-associated disease of tomato in Guatemala.

Tomatoes in Guatemala have been affected by a new disease, locally known as "mancha de chocolate" (chocolate spot). The disease is characterized by distinct necrotic spots on leaves, stems and petioles that eventually expand and cause a dieback of apical tissues. Samples from symptomatic plants tested negative for infection by tomato spotted wilt virus, tobacco streak virus, tobacco etch virus and other known tomato-infecting viruses. A virus-like agent was sap-transmitted from diseased tissue to Nicotiana benthamiana and, when graft-transmitted to tomato, this agent induced chocolate spot symptoms. This virus-like agent also was sap-transmitted to Datura stramonium and Nicotiana glutinosa, but not to a range of non-solanaceous indicator plants. Icosahedral virions approximately 28-30 nm in diameter were purified from symptomatic N. benthamiana plants. When rub-inoculated onto leaves of N. benthamiana plants, these virions induced symptoms indistinguishable from those in N. benthamiana plants infected with the sap-transmissible virus associated with chocolate spot disease. Tomatoes inoculated with sap or grafted with shoots from N. benthamiana plants infected with purified virions developed typical chocolate spot symptoms, consistent with this virus being the causal agent of the disease. Analysis of nucleic acids associated with purified virions of the chocolate-spot-associated virus, revealed a genome composed of two single-stranded RNAs of approximately 7.5 and approximately 5.1 kb. Sequence analysis of these RNAs revealed a genome organization similar to recently described torradoviruses, a new group of picorna-like viruses causing necrosis-associated diseases of tomatoes in Europe [tomato torrado virus (ToTV)] and Mexico [tomato apex necrosis virus (ToANV) and tomato marchitez virus (ToMarV)]. Thus, the approximately 7.5 kb and approximately 5.1 kb RNAs of the chocolate-spot-associated virus corresponded to the torradovirus RNA1 and RNA2, respectively; however, sequence comparisons revealed 64-83% identities with RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV. Together, these results indicate that the chocolate-spot-associated virus is a member of a distinct torradovirus species and, thus, another member of the recently established genus Torradovirus in the family Secoviridae. The name tomato chocolate spot virus is proposed.

First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala.

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Bean golden yellow mosaic virus from Chiapas, Mexico: Characterization, Pseudorecombination with Other Bean-Infecting Geminiviruses and Germ Plasm Screening.

ABSTRACT The complete nucleotide (nt) sequences of the cloned DNA-A (2644 nts) and DNA-B (2609 nts) components of Bean golden yellow mosaic virus (BGYMV-MX) from Chiapas, Mexico were determined. The genome organization of BGYMV-MX is similar to that of other Western Hemisphere bipartite geminiviruses (genus Begomovirus). Infectivity of the cloned BGYMV-MX DNA components in common bean (Phaseolus vulgaris) plants was demonstrated by particle bombardment and agroinoculation. BGYMV-MX was identified as a BGYMV (previously type II BGMV) isolate based on sequence analyses, sap-transmissibility, and pseudorecombination experiments with other bean-infecting begomoviruses. On the basis of differences in the DNA-B hypervariable region, symptom phenotype, and properties of infectious pseudorecombinants, BGYMV-MX may represent a distinct strain of BGYMV. Pseudorecombination experiments further established that BGYMV symptom determinants mapped to DNA-B, and that BGYMV-MX was most closely related to BGYMV from Guatemala. A Tomato leaf crumple virus (TLCrV) DNA-A/BGYMV-MX DNA-B pseudorecombinant was infectious in bean, establishing that a viable reassortant can be formed between begomovirus species from different phylogenetic clusters. Bean germ plasm representing the two major gene pools (Andean and Mesoamerican) was screened for response to BGYMV-MX with three methods of inoculation: sap-inoculation, particle bombardment, and agroinoculation. Andean germ plasm was very susceptible and similar results were obtained with all three methods, whereas Mesoamerican germ plasm showed resistance to BGYMV-MX, particularly with agroinoculation.

Widespread Occurrence of Tomato Geminiviruses in Brazil, Associated with the New Biotype of the Whitefly Vector.

Although tomato golden mosaic virus (TGMV) was reported in Brazil more than 20 years ago (3), tomato-infecting geminiviruses have not been of economic significance in the country until recently. However, a sharp increase in the incidence of geminivirus-like symptoms in tomatoes has been reported in several areas of Brazil since 1994. This has coincided with the appearance of the B biotype of Bemisia tabaci, which, as opposed to the A biotype, readily colonizes solanaceous plants (2). We have isolated geminiviruses from symptomatic tomato plants in the Federal District, in two different areas of the state of Minas Gerais, and in the state of Pernambuco. Tomato plants in these areas showed a variety of symptoms, including yellow mosaic, severe leaf distortion, down-cupping, and epinasty. Whitefly infestation was high in all fields sampled, and in some fields, particularly in Pernambuco, incidence of virus-like symptoms was close to 100%, and no tomatoes of commercial value were harvested (1). Using primer pairs PAL1v1978/PAR1c496 and PCRc1/PBL1v2040 (4), DNA-A and -B fragments were polymerase chain reaction (PCR)-amplified from total DNA extracted from diseased plants, cloned, and sequenced. Sequence comparisons of the PCR fragments indicated the existence of at least six different geminiviruses. The nucleotide sequence homologies for DNA-A fragments ranged from 67 to 80% for the 5' end of the cp gene, and from 44 to 80% for the 5' end of the rep gene. Data base comparisons indicated the viruses are most closely related to TGMV, bean golden mosaic virus from Brazil (BGMV-Br), and tomato yellow vein streak virus (ToYVSV), although homologies were less than 80% for the fragments compared. A similar lack of a close relationship with each other and other geminiviruses was obtained with two DNA-B component PCR products compared, corresponding to the 5' end of the BC1 open reading frame. Infectious, full-length genomic clones from the tomato viruses are being generated for biological and molecular characterization. References: (1) I. C. Bezerra et al. Fitopatol. Bras. 22:331, 1997. (2) F. H. França et al., Ann. Soc. Entomol. Bras. 25:369, 1996. (3) J. C. Matyis et al. Summa Phytopathol. 1:267, 1975. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato Mottle Geminivirus Infecting Tomatoes in Yucatan, Mexico.

Whitefly-transmitted geminiviruses are a major constraint on tomato production in Mexico (3). In the Yucatan State, these viruses can cause serious losses in late season plantings. As part of an effort to characterize these viruses, leaf samples from four tomato plants showing symptoms of geminivirus infection, such as stunted growth and leaf mottling and deformation, were collected from a single field in the Yucatan State in February, 1996. Geminivirus nucleic acids were detected in leaf samples from all four plants by squash blot hybridization analysis with a general DNA probe for Western Hemisphere whitefly-transmitted geminiviruses (2). Nicotiana benthamiana plants inoculated with sap prepared with leaf tissue from one plant developed stunted growth and leaf mottling and deformation. When graft-transmitted from N. benthamiana to tomato, the geminivirus(es) induced leaf mottling and deformation, which were similar to symptoms in the field-collected tomato plants. The presence of geminivirus DNA in the sap- and graft-inoculated plants was confirmed with the polymerase chain reaction (PCR) and degenerate primers for the DNA-A (PAL1v1978 and PAR1c496) or DNA-B (PBL1v2040 and PCRc1) components of whitefly-transmitted geminiviruses (4). Using PCR and these degenerate primers, approximately 1.1-kb DNA-A and approximately 0.6-kb DNA-B fragments were amplified from DNA extracts prepared from leaves of each of the four Yucatan tomato plants. No DNA fragments were amplified from these extracts with primers for pepper huasteco geminivirus (pAL1c2329 and pAL1v1471, or pBR1c840 and pBL1v1830). To determine the identity of the geminivirus(es) infecting these tomato plants, the PCR-amplified DNA-A and DNA-B fragments from one of the samples were cloned and sequenced. Comparisons made with these sequences revealed two distinct types of DNA-A and DNA-B clones, indicating a mixed infection of at least two bipartite geminiviruses. DNA-A and DNA-B sequences of one set of clones were >97% identical to sequences of tomato mottle geminivirus (ToMoV) from Florida (1). The presence of ToMoV in all four tomato leaf samples was demonstrated by the PCR-mediated amplification of a 0.9-kb DNA-A fragment with ToMoV-specific primers (pAL1v2295 and pAR1c580). The identity of this 0.9-kb DNA fragment was further confirmed based upon its hybridization with a full-length clone of ToMoV DNA-A under high stringency conditions (2). A data base search made with the sequence of the other type of DNA-A clone revealed sequence identities of <70% with various bipartite geminiviruses (e.g., identities of 70% with tomato mottle, 69% with Sida golden mosaic, 67% with bean dwarf mosaic, and 66% with taino tomato mottle and with potato yellow mosaic), which confirmed that a second geminivirus was present in a mixed infection with ToMoV in this tomato leaf sample. To confirm the bipartite nature of this geminivirus, a DNA-B fragment that contained the common region (CR) sequence was amplified from the same sample with PCR and primers PBL1v2040 and PBR1c970 (a degenerate primer that anneals within the BV1 open reading frame; F. M. Zerbini and R. L. Gil-bertson, unpublished data), cloned, and sequenced. The CR sequence of this DNA-B fragment was 96% identical to that of the DNA-A fragment, which establishes the presence of another bipartite geminivirus in this sample. This is the first report of ToMoV in Mexico. These results also suggest that at least two bipartite geminiviruses may infect tomatoes in the Yucatan Peninsula. References: (1) A. M. Abouzid et al. J. Gen. Virol. 73:3225, 1992. (2) R. L. Gilbertson et al. Plant Dis. 75:336, 1991. (3) J. E. Polston and P. K. Anderson. Plant Dis. 81:1358, 1997. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Partial Characterization of Two Whitefly-Transmitted Geminiviruses Infecting Tomatoes in Venezuela.

Whitefly-transmitted geminiviruses can cause significant yield losses on tomatoes (Lycopersicon esculentum Mill.) in Venezuela. To identify the geminivirus(es) infecting tomatoes in Venezuela, 20 tomato samples from commercial tomato fields in four states and one weed (Euphorbia heterophylla L.) sample were examined for geminivirus infection. All samples showed symptoms generally associated with geminivirus infection, including golden or yellow mosaic, mottling, crumpling and/or distortion of leaves, and, in some cases, stunted and distorted growth. Through the use of squash blot hybridization analysis and a general probe for Western Hemisphere whitefly-transmitted geminiviruses (4), geminivirus nucleic acids were detected in 19 of 20 tomato samples and the weed sample. No samples were infected with tomato yellow leaf curl virus (TYLCV), based on squash blot hybridization analysis with a TYLCV-specific probe. With polymerase chain reaction (PCR) and degenerate primers for whitefly-transmitted geminiviruses (PAL1v1978 and PAR1c496) (4), an approximately 1.2-kb DNA-A fragment was amplified from the 19 squash blot-positive tomato samples and from the weed sample. No DNA fragment was amplified from any samples when TYLCV-specific primers (PTYC1v2406 and PTYIRc287) (3) were used. PCR-amplified DNA-A fragments from four samples representing four different states [Monagas (5L), Guarico (3M), Aragua (3R), and Portuguesa (2U)] were cloned and sequenced. Partial AC1, AV1, and complete common region (CR) sequences of the 5L, 3M, and 2U DNA-A fragments were 92 to 93, 93, and 95 to 97% identical, respectively, indicating that these were DNA-A clones of the same virus. Furthermore, these sequences were 91 to 92, 92 to 95, and 93 to 95% identical, respectively, to sequences of homologous regions of potato yellow mosaic virus (PYMV), indicating that these tomato-infecting geminiviruses are isolates or strains of PYMV. The partial AC1, AV1, and complete CR sequences of the 3R DNA-A fragment were 79, 95, and 77% identical to those of 5L, 3M, and 2U clones, respectively, suggesting that this is a different geminivirus. These sequences were 75 to 87, 82 to 88, and 73 to 81% identical, respectively, to sequences of homologous regions of other tomato geminiviruses, including tomato golden mosaic from Brazil, tomato mottle from Florida, and tomato leaf crumple from Mexico. The bipartite nature of the geminiviruses that were present in the 5L, 3M, 3R, and 2U samples was suggested by the amplification of a DNA-B fragment with degenerate DNA-B primers (PBL1v2040 and PCRc1) (4). These results suggest at least two distinct bipartite Western Hemisphere whitefly-transmitted geminiviruses are associated with tomato virus diseases in Venezuela, and that one of these (sample 3R) may be an undescribed geminivirus. The sequence of the DNA-A fragment from the weed sample was not closely related to the tomato-infecting geminiviruses and, therefore, this weed was not an alternate host of these viruses. Furthermore, because PYMV has been shown to infect tomatoes and cause yellow mosaic symptoms (1), it would be of interest to determine the relationship of PYMV and tomato yellow mosaic geminivirus (ToYMV), which has been reported infecting tomatoes in Venezuela (2), but has not been characterized on the molecular level. References: (1) A. K. Buragohain et al. J. Gen. Virol. 75:2857, 1994. (2) R. C. de Uzcátegui and R. Lastra. Phytopathology 68:985, 1978. (3) M. K. Nakhla et al. Phy-topathol. Mediterr. 32:163, 1993. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Use of the asymmetric polymerase chain reaction and DNA sequencing to determine genetic variability of bean golden mosaic geminivirus in the Dominican Republic.

A combination of the polymerase chain reaction (PCR), asymmetric PCR (A-PCR) and DNA sequencing was used to determine the nucleotide sequence of a hypervariable region of the bipartite genome of bean golden mosaic geminivirus (BGMV). This region, which was part of the intergenic region of the DNA-B component, was amplified using primers designed from the nucleotide sequence of a DNA-B component clone (pDRB1) of an isolate of BGMV from the Dominican Republic (BGMV-DR). pDRB1 is infectious on beans when coinoculated with the DNA-A component of BGMV-DR (pDRA1), and typical bean golden mosaic symptoms are observed on infected plants. Bean leaf tissue infected with BGMV was collected at five separate field locations in the Dominican Republic and the hypervariable region was amplified by PCR, ssDNA was produced using A-PCR, and partial nucleotide sequences were determined. The sequences of the hypervariable region from the field-collected samples ranged from 95% (one sample) to 98% (four samples) identical to the sequence of pDRB1. This contrasts with sequence identities of 86, 75 and 46% between the pDRB1 hypervariable region and the hypervariable regions of BGMV isolates from Guatemala, Puerto Rico and Brazil respectively, and 42% with bean dwarf mosaic geminivirus. These results indicate that Dominican Republic isolates of BGMV are very similar and should be considered isolates of the same virus (BGMV-DR), and that the infectious clones of BGMV-DR are representative of BGMV isolates in the Dominican Republic. The procedures described for DNA extraction from leaf tissue and for production of high quality ssDNA using PCR and A-PCR are rapid and efficient and could be applied to studies of variability and epidemiology of other viruses.