ABSTRACT
Clinical records from individuals followed for 5 years, 2000 to 2005, were reviewed. They were distributed in 3 cohorts of ages ranging from 51 to 60, 61 to 70, and 71 to 80 years, respectively. Each cohort included 2 groups of patients with diabetes type 2, one group treated with Metformin 850 mg/day, and the other one without pharmacological treatment. In all groups, for each individual, the mean variation of glycosylated hemoglobin, ferritin, lymphocyte count, total and subpopulations, was determined in blood using the measurement at the beginning and at the end of the 5-year follow-up. The number of all living individuals and cancer cases were also recorded in all groups at the end of the 5-year period. The results were consistent with the reported significance as biomarkers of aging of: the increase of glycosylated hemoglobin and ferritin, the decrease of the number of total lymphocytes and CD8+T, and the increase of T-Regulators. In this preliminary observation, the protection of Metformin on the variations of aging biomarkers was associated with survival and decline of malignancy incidence.
Subject(s)
Aging/drug effects , Metformin/pharmacology , Neoplasms/prevention & control , Aged , Aged, 80 and over , Aging/blood , Biomarkers/blood , Cohort Studies , Diabetes Mellitus, Type 2/drug therapy , Diabetes Mellitus, Type 2/therapy , Glycated Hemoglobin/metabolism , Humans , Hypoglycemic Agents/pharmacology , Hypoglycemic Agents/therapeutic use , Lymphocyte Count , Metformin/therapeutic use , Middle AgedABSTRACT
The syndrome of recurrent vitreous hemorrhages in young men was described for the first time by Henry Eales in 1880. The association with a clinical manifestation of ocular inflammation was reported 5years later. Eales disease affects young adults who present with ischemic retinal vasculitis, with the peripheral retina most commonly affected. Most cases have been reported in South Asia. Although the etiology of this abnormality is unknown, it may be related to an immune sensitivity to Mycobacterium tuberculosis antigens. Its pathogenesis is related to extensive ischemia that affects the retina, secondary to an obliterative retinal vasculopathy with release of angiogenic factors of the VEGF type. Involvement of the retina is the hallmark of the disease, which manifests as follows: periphlebitis, retinal capillary ischemia most often affecting the periphery with secondary proliferative retinopathy and retinal and/or papillary neovascularization, recurrent vitreous hemorrhages and tractional retinal detachment. These complications are potentially blinding. The natural history of Eales disease varies, with temporary or permanent remission in some cases and continuous progression in others. Progression is often bilateral, which necessitates regular follow-up. The treatment of Eales disease depends on the stage of the disease and is not well defined. Observation only, pars plana vitrectomy surgery and/or intravitreal injections of anti-VEGF are recommended in cases of vitreous hemorrhage, associated with corticosteroids when retinal vasculitis is present. Laser pan-retinal photocoagulation is necessary when neovascularization is present.
Subject(s)
Neovascularization, Pathologic , Retinal Vasculitis , Adult , Humans , Laser Coagulation , Male , Neovascularization, Pathologic/diagnosis , Neovascularization, Pathologic/epidemiology , Neovascularization, Pathologic/etiology , Neovascularization, Pathologic/therapy , Retinal Vasculitis/diagnosis , Retinal Vasculitis/epidemiology , Retinal Vasculitis/etiology , Retinal Vasculitis/therapy , Tuberculosis, Ocular/complications , Tuberculosis, Ocular/epidemiology , Tuberculosis, Ocular/therapy , Vitrectomy , Young AdultABSTRACT
Due to the need for treatment guidelines for endophthalmitis in impoverished areas, we have formulated an approach which takes into account pharmacokinetic data, keeping in mind that, whether oral or intramuscular, antibiotics must achieve therapeutic intraocular levels, antibiotic susceptibility of the most common pathogens in endophthalmitis, and routine availability of bioequivalent generics in the areas in question. In this work, we present the basic guidelines for the management of postoperative endophthalmitis by ophthalmology services in impoverished areas.
Subject(s)
Anti-Infective Agents/therapeutic use , Endophthalmitis/drug therapy , Postoperative Complications/drug therapy , Anti-Infective Agents/economics , Anti-Infective Agents/pharmacokinetics , Developing Countries , Endophthalmitis/economics , Endophthalmitis/surgery , France , Humans , Multicenter Studies as Topic , Ophthalmologic Surgical Procedures , Postoperative Complications/economics , Postoperative Complications/surgery , Poverty , Practice Guidelines as Topic , Randomized Controlled Trials as Topic , Therapeutic Equivalency , VitrectomyABSTRACT
PURPOSE: We examined, retrospectively, the efficacy of voriconazole in Fusarium eye infections. METHODS: Voriconazole-treated patients with proven or probable keratitis or endophthalmitis from the voriconazole database (9 patients) and six French ophthalmology departments (15 patients) were included. Sociodemographic features, predisposing factors, history of corneal trauma, associated ocular conditions, other diseases and prior therapies were analysed. Investigator-determined success was defined as infection resolution with medical treatment. Failure was no response or persistent infection and required surgery. RESULTS: Most patients were Caucasian (83 %) and male (71 %). The infection was keratitis (63 %) or endophthalmitis (37 %) and proven in 23 (96 %). Prior therapy included topical and/or systemic amphotericin (46 %), fluconazole (17 %) or others (33 %), often in combination. Causative fungi were Fusarium solani (14, 58 %), Fusarium moniliforme (1), Fusarium oxysporum (1) and Fusarium spp. (8). Voriconazole was administered systemically, topically and/or by intraocular injection, and 16 patients (67 %) received salvage and eight primary therapy. The overall response was 67 % (73 % keratitis and 56 % endophthalmitis) but seven patients required adjunctive surgery. However, response was 63 % for eight primary therapy patients and 69 % for 16 salvage therapy patients. Response by species was Fusarium solani 64 % (9/14) and all others 80 % (8/10). In 13 patients (77 %), voriconazole was used in combination (response 69 vs. 64 % alone) with topical [amphotericin B 10/24 (42 %), caspofungin 5 (21 %), natamycin 1 (4 %)] and systemic agents [caspofungin 3 (13 %), amphotericin 2 (8 %)]. CONCLUSIONS: Topical and systemic voriconazole appears to be effective alone or in combination with other agents for treating severe Fusarium keratitis or endophthalmitis.
Subject(s)
Antifungal Agents/therapeutic use , Eye Infections, Fungal/drug therapy , Fusariosis/drug therapy , Pyrimidines/therapeutic use , Triazoles/therapeutic use , Adult , Aged , Aged, 80 and over , Eye Infections, Fungal/pathology , Fusarium , Humans , Male , Middle Aged , Retrospective Studies , Treatment Outcome , VoriconazoleABSTRACT
PURPOSE: The objective of this study was to assess the factors associated with anatomical and visual outcomes in patients presenting with Acanthamoeba keratitis (AK). METHODS: This is a retrospective noncomparative interventional case series study comprising 44 eyes from 42 patients presenting with AK, treated with topical hexamidine diisethionate and topical polyhexamethylene biguanide, monitored between 2004 and 2008. AK was confirmed by polymerase chain reaction or direct microscopic examination. Correlation between clinical presentation and prognosis was assessed. Anatomical outcome was assessed according to the percentage of eyes requiring at least 1 surgical procedure in addition to topical treatment. Visual outcome was assessed by the best-corrected visual acuity at the end of follow-up. RESULTS: Polymerase chain reaction results were positive for Acanthamoeba in 40 of the 44 eyes (91%) and in 16 of the 44 eyes (36%) by direct microscopic examination. Confocal microscopy suggested the presence of Acanthamoeba in 12 of 19 eyes (63%). Amniotic membrane transplantation was performed in 8 eyes, penetrating keratoplasty in 4 eyes, and evisceration in 2 eyes. The average follow-up time was 10 months. Surgical treatment was significantly associated (P < 0.05) with time from symptom onset to diagnosis of >30 days, an initial visual acuity of ≤20/200, an infiltrate size of >3 mm, preperforating infiltrates, and corneal neovascularization. The average final visual acuity was 20/48 in eyes that did not require surgical treatment (n = 34) and 20/1702 in eyes that required at least 1 surgical procedure (n = 10; P < 0.0001). CONCLUSIONS: Late diagnosis, low initial visual acuity, corneal neovascularization, large infiltrates, and preperforated infiltrates were associated with surgical treatment in patients presenting with AK. Surgical intervention was associated with worse visual outcome.
Subject(s)
Acanthamoeba Keratitis/diagnosis , Acanthamoeba Keratitis/surgery , Acanthamoeba/genetics , Acanthamoeba/isolation & purification , Acanthamoeba Keratitis/drug therapy , Administration, Topical , Adolescent , Adult , Aged , Aged, 80 and over , Anti-Infective Agents/therapeutic use , Benzamidines/therapeutic use , Biguanides/therapeutic use , Biological Dressings , Cornea/parasitology , DNA, Protozoan/analysis , Disinfectants/therapeutic use , Drug Therapy, Combination , Eye Evisceration , Female , Humans , Keratoplasty, Penetrating , Male , Microscopy, Confocal , Middle Aged , Polymerase Chain Reaction , Prognosis , Retrospective Studies , Risk Factors , Visual Acuity , Young AdultABSTRACT
We report a case of a 67-year-old woman with no significant past ocular history, who was referred for management of an unresponsive microbial keratitis resulting from trauma with a piece of clothing fabric 1 month previously in Portugal and worsening despite topical fortified antibiotics. On examination, visual acuity was limited to "light perception". Slit lamp examination revealed an 11×11mm full-thickness corneal infiltrate. Confocal images showed branching hyphae suggestive of a fungal infection. Fungal cultures of corneal scrapings revealed growth of Cylindrocarpon lichenicola, a saprophytic, filamentous fungus, which is an unusual cause of keratitis. Despite aggressive antifungal therapy with voriconazole and amphotericin B, she required penetrating keratoplasty for impending corneal perforation. Follow-up was uneventful, with no recurrence at 1 year. Fungal infections must be suspected in all corneal ulcers of traumatic etiology. Specific cultures and confocal microscopy must be performed early, so as to enable early treatment modification.
Subject(s)
Eye Infections, Fungal/microbiology , Keratitis/microbiology , Aged , Antifungal Agents/therapeutic use , Eye Infections, Fungal/therapy , Female , Humans , Keratitis/therapy , Keratoplasty, PenetratingSubject(s)
Endophthalmitis/microbiology , Gram-Negative Bacterial Infections/microbiology , Methylobacterium/isolation & purification , Retinal Artery Occlusion/etiology , Adult , Diagnosis, Differential , Endophthalmitis/complications , Endophthalmitis/diagnosis , Equipment Contamination , False Positive Reactions , Gram-Negative Bacterial Infections/complications , Gram-Negative Bacterial Infections/diagnosis , Humans , Male , Methylobacterium/pathogenicity , Sarcoidosis/diagnosis , Serologic Tests/methods , Toxoplasmosis, Ocular/diagnosis , Tuberculosis, Ocular/diagnosisABSTRACT
PURPOSE: To analyze risk factors and prognosis factors of severe bacterial keratitis. METHODS: Retrospective study of 111 eyes from 105 patients hospitalized from 2005 to 2006 for bacterial keratitis proven by microbiological assessment or suspected (favorable outcome after antibiotic treatment). RESULTS: The main risk factors were contact lens wear (39.6%), ocular surface diseases (36.9%), a history of ocular surgery (27.9%), and ocular trauma (11.7%). Gram-positive cocci were found in 46.8% of cases, Gram-negative bacilli in 19.8%, Gram-positive bacilli in 7.2%, Gram-negative cocci in 2.7%, and Gram-negative coccobacilli in 0.9%. No infectious agents were found in 22.5% of the cases. Two or more bacteria were found in 25.6%. The mean follow-up time was 6.5 months. Resolution of infection was obtained in 77.5% with only medical treatment and in 99.1% with further surgical treatment. Amniotic membrane transplantation was performed in 16.2% and emergency keratoplasty in 8.1%. The mean LogMAR visual acuity was 1.43 initially and 0.84 at the last examination. The final visual acuity was 1.03 for Gram-positive and 0.35 for Gram-negative organisms (p=0.03). CONCLUSION: Bacterial keratitis is a sight-threatening infection. Gram-positive keratitis is more frequent, except for contact lens wearers, and is also more severe.
Subject(s)
Eye Infections, Bacterial/epidemiology , Keratitis/microbiology , Adolescent , Adult , Aged , Aged, 80 and over , Amnion/transplantation , Anti-Bacterial Agents/therapeutic use , Child , Contact Lenses/statistics & numerical data , Corneal Transplantation/statistics & numerical data , Eye Injuries/epidemiology , Female , Follow-Up Studies , Humans , Keratitis/epidemiology , Male , Middle Aged , Ophthalmologic Surgical Procedures/statistics & numerical data , Paris/epidemiology , Prognosis , Pseudomonas Infections/epidemiology , Retrospective Studies , Risk Factors , Serratia Infections/epidemiology , Staphylococcal Infections/epidemiology , Streptococcal Infections/epidemiology , Visual Acuity/physiology , Young AdultABSTRACT
PURPOSE: To study the kinetics of growth and the phenotype of cells cultured from human limbal explants in a cholera toxin-free medium with no feeder cell layer. METHODS: Human organ-cultured corneas were used to prepare limbal explants (full-thickness and superficial limbal explants) and corneal stromal explants. Cell growth kinetics and phenotypes were assessed by cultivating explants in cholera toxin-free Green medium. Epithelial and progenitor cell markers were assessed by immunocytochemistry, flow cytometry, and Reverse Transcription and Polymerase Chain Reaction (RT-PCR). RESULTS: The successful epithelial cell growth rates from full thickness limbal explant and superficial limbal explant tissues were 41 and 86%, respectively (p=0.0001). The mean cell area and the percentage of small cells in superficial and full-thickness explant cultures were, respectively, 317 µm(2) and 429 µm(2), and 8.9% and 1.7% (p<0.001). The percentage of positive cells in superficial and full-thickness limbal explant cultures as assessed by immunocytochemistry were the following: broad spectrum cytokeratins (cytokeratins 4, 5, 6, 8, 10, 13, and 18 [MNF116]), 82%/37% (p=0.01); cytokeratin 3 (CK3), 74%/25% (p=0.009); cytokeratin 19 (CK19), 46%/25% (p=0.19); vimentin, 56%/53% (p=0.48); delta N p63α, 54%/0% (p<0.001); and ABCG2, 5%/0% (p=0.1). Flow cytometry showed a higher percentage of small cells, a higher percentage of MNF116+ cells, and stronger expression of progenitor-associated markers in superficial than in full-thickness explant cultures. For superficial limbal explant cultures, analysis of the expression profiles for various mRNAs at the end of 21 days of culture showed high levels of expression of the mRNAs encoding CK3, vimentin, and CK19. The expression of mRNA of delta N p63α and ABCG2 was weaker. Cultures obtained from full-thickness limbal explants featured no expression of mRNA of CK19, delta N p63α, and ABCG2, whereas mRNAs encoding CK3 and vimentin were detected. Human corneal stromal explants cultured with the same medium featured late cell growth, large mean cell area (2,529 µm(2)), no expression of cytokeratins, delta N p63α, and ABCG2, and high expression of vimentin. CONCLUSIONS: Superficial limbal explants appear to be superior to full-thickness limbal explants for growing human limbal epithelial cells. Preparation of explants using surgical facilities (i.e., operating microscope and microsurgical blades) led to a dramatic increase in the percentage of successful cultures, higher epithelial cell growth, decreased fibroblast contamination, and better preservation of limbal epithelial progenitors.
Subject(s)
Cornea/pathology , Epithelial Cells/cytology , Limbus Corneae/pathology , Adult , Aged , Aged, 80 and over , Cells, Cultured , Cholera Toxin/chemistry , Cornea/metabolism , Corneal Transplantation , Flow Cytometry/methods , Humans , Immunohistochemistry/methods , Kinetics , Limbus Corneae/metabolism , Microscopy, Confocal/methods , Middle Aged , Phenotype , Reverse Transcriptase Polymerase Chain Reaction , Stem Cells/cytologyABSTRACT
A 68-year-old woman presented with a painless inflammation of the right superior eyelid that had started several weeks before. The clinical diagnosis concluded in canaliculitis and the solid concretions were surgically extracted from the superior canalicula. The anaerobic bacteria Fusobacterium nucleatum sp. nucleatum was isolated. Signs dramatically regressed two weeks after surgery followed by one course of oral amoxicillin and clavulanic acid associated with topical tobramycin. The clinical signs had disappeared two months later.
Subject(s)
Fusobacterium Infections/microbiology , Fusobacterium nucleatum/isolation & purification , Lacrimal Apparatus Diseases/microbiology , Aged , Amoxicillin-Potassium Clavulanate Combination/administration & dosage , Amoxicillin-Potassium Clavulanate Combination/therapeutic use , Anti-Bacterial Agents/administration & dosage , Anti-Bacterial Agents/therapeutic use , Canaliculitis , Combined Modality Therapy , Corneal Ulcer/microbiology , Dacryocystitis , Dacryocystorhinostomy , Drug Therapy, Combination , Emergencies , Female , Fusobacterium Infections/complications , Fusobacterium Infections/drug therapy , Fusobacterium Infections/surgery , Humans , Lacrimal Apparatus Diseases/complications , Lacrimal Apparatus Diseases/drug therapy , Lacrimal Apparatus Diseases/surgery , Lacrimal Duct Obstruction/etiology , Tobramycin/administration & dosage , Tobramycin/therapeutic useABSTRACT
INTRODUCTION: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. METHODS: The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. RESULTS: The frt PCR detects 0,01 CFU/µl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. DISCUSSION: The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. CONCLUSION: Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.
Subject(s)
Bacteria/isolation & purification , Real-Time Polymerase Chain Reaction/methods , Bacteria/classification , Bacteria/genetics , DNA, Bacterial/analysis , Humans , Time FactorsABSTRACT
PURPOSE: To assess limbal epithelial cell growth kinetics in vitro using tissue retrieved from organ-cultured donor corneas. PATIENTS AND METHODS: Twenty-one limbal explants were retrieved from corneoscleral rims of donor corneal grafts preserved for 18-24 days in organ culture. The explants were cultured at 37°C for 10, 13, or 18 days. The epithelial cell sheet area was measured during culture by means of morphometry. At the end of culture, the dissociated cells were counted and analyzed by immunocytochemistry. RESULTS: The curve of the epithelial cell sheet area (S) in relation to culture time (t) was best fitted by a polynomial model (S=0.024t(3) - 0.038t(2) - 0.044t + 0.092). The average duration of the cell cycle was 24h. Cell growth decreased as donor tissue retrieval postmortem time increased. Cultured cells featured various expressions of cytokeratin-3 ranging from absent (few cells) to strong. More than 50% of cells expressed vimentin. CONCLUSION: Limbal tissue retrieved from donor tissue that was organ-cultured for 3 weeks maintains a potential for cell renewal and growth compatible with clinical use for limbal allograft transplantation or cultured stem cell transplantation. However, cell growth potential is impaired by donor postmortem ischemia, which implies that tissue must be retrieved as soon as possible after donor death.
Subject(s)
Cell Proliferation , Limbus Corneae/cytology , Cells, Cultured , Epithelial Cells , HumansABSTRACT
AIMS: An epidemiological study carried out in 2006 indicated a high prevalence of blinding trachoma in the Kolofata Health District, Far North Region, Republic of Cameroon. As a result, the national blindness control programme of Cameroon instituted a trachoma elimination programme using the SAFE strategy. METHODS: A campaign to treat the entire district population with azithromycin 1.5% eye drops was undertaken in February 2008. To measure the effectiveness of treatment on the prevalence of active trachoma, two epidemiological studies were conducted on a representative sample of children aged between 1 and 10 years. The first study was performed just prior to the treatment campaign and the second study was performed 1 year later. RESULTS: The prevalence of active forms of trachoma (trachomatous inflammation--follicular (TF) + TF/trachomatous inflammation--intense (TI)) dropped from 31.5 (95% CI 26.4 to 37.5)% before treatment to 6.3 (95% CI 4.1 to 9.6)% 1 year after treatment-a reduction of nearly 80%. There were no reports of serious or systemic side effects. Tolerance was excellent and no treatment was interrupted. CONCLUSION: Mass treatment with azithromycin 1.5% eye drops is feasible, well tolerated and effective.
Subject(s)
Anti-Bacterial Agents/administration & dosage , Azithromycin/administration & dosage , Trachoma/drug therapy , Age Distribution , Anti-Bacterial Agents/adverse effects , Azithromycin/adverse effects , Blindness/microbiology , Blindness/prevention & control , Cameroon/epidemiology , Child , Child, Preschool , Epidemiologic Methods , Female , Humans , Infant , Male , National Health Programs/organization & administration , Ophthalmic Solutions , Program Evaluation , Sex Distribution , Trachoma/complications , Trachoma/epidemiology , Treatment OutcomeABSTRACT
BACKGROUND: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. METHODS: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. RESULTS: The f-d-real-t PCR detects 0.1 cyst/microl or less of the 10 referenced strains (sensitivity slightly lower for A astronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. CONCLUSION: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.
Subject(s)
Acanthamoeba Keratitis/diagnosis , Acanthamoeba/isolation & purification , Acanthamoeba/classification , Acanthamoeba/genetics , Acanthamoeba Keratitis/parasitology , Animals , DNA Primers , DNA, Protozoan/analysis , Genotype , Humans , Parasitology/methods , Polymerase Chain Reaction/methods , Sensitivity and SpecificityABSTRACT
BACKGROUND: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. METHODS: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. RESULTS: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. CONCLUSION: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.
Subject(s)
Endophthalmitis/diagnosis , Aqueous Humor/microbiology , Bacterial Typing Techniques/methods , DNA, Bacterial/analysis , Endophthalmitis/microbiology , Humans , Polymerase Chain Reaction/methods , Sensitivity and Specificity , Vitreous Body/microbiologyABSTRACT
BACKGROUND: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). MATERIAL AND METHODS: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.
Subject(s)
Eye Infections, Bacterial/diagnosis , Gram-Positive Bacterial Infections/diagnosis , Propionibacterium acnes/isolation & purification , Aqueous Humor/microbiology , Colony Count, Microbial , DNA, Bacterial/analysis , Eye Infections, Bacterial/microbiology , Gram-Positive Bacterial Infections/microbiology , Humans , Polymerase Chain Reaction/methods , Propionibacterium acnes/genetics , Vitreous Body/microbiologyABSTRACT
PURPOSE: Antibacterial efficacy of topically applied azithromycin 1.5% was compared with tobramycin 0.3% in a multicenter, randomized, investigator-masked study for the treatment of purulent bacterial conjunctivitis. METHODS: A total of 1043 adults and children received either azithromycin twice daily for 3 days (n=524) or tobramycin every 2 hours while awake for 2 days, then four times daily for 5 days (n=519). Conjunctival swabbing was taken at days 0, 3, and 9, using alginate swabs resuspended in a dissolution-transport medium, providing rapid and reproducible results. Cagle's criteria were used to define the pathogenicity level for each isolated bacterium. RESULTS: In the per-protocol set, the rate of bacteriologic resolution was 85.2% for azithromycin versus 83.8% for tobramycin on day 3, and 92.8% for azithromycin versus 94.6% for tobramycin on day 9. Azithromycin was demonstrated to be noninferior to tobramycin according to the 10% noninferiority margin. Although some bacteria were categorized as resistant to tested antibiotics, eradication was observed (for azithromycin: Acinetobacter, Enterobacteriaceae, Pseudomonas), highlighting the specific pharmacokinetics/pharmacodynamics of the ocular route. CONCLUSIONS: In total, topical therapy with azithromycin 1.5% administered only twice daily for 3 days effectively eradicates most pathogenic bacteria associated with bacterial conjunctivitis. These microbiologic results are in accordance with the observed clinical outcome. This new anti-infective product has the advantage of a short treatment course which could lead to an improvement in patient compliance.
Subject(s)
Anti-Bacterial Agents/administration & dosage , Azithromycin/administration & dosage , Conjunctivitis, Bacterial/drug therapy , Tobramycin/administration & dosage , Administration, Topical , Adolescent , Adult , Aged , Aged, 80 and over , Anti-Bacterial Agents/therapeutic use , Azithromycin/therapeutic use , Bacteria/drug effects , Bacteria/isolation & purification , Child , Child, Preschool , Conjunctiva/microbiology , Conjunctivitis, Bacterial/microbiology , Double-Blind Method , Drug Resistance, Bacterial , Female , Humans , Infant , Infant, Newborn , Male , Microbial Sensitivity Tests , Middle Aged , Ophthalmic Solutions/administration & dosage , Ophthalmic Solutions/therapeutic use , Time Factors , Tobramycin/therapeutic use , Young AdultABSTRACT
Basic life support (BLS) refers to maintaining airway patency and supporting breathing and the circulation, without the use of equipment other than infection protection measures. The scientific advisory committee of the American Heart Association (AHA) published recommendations (online-first) on March 31 2008, which promote a call to action for bystanders who are not or not sufficiently trained in cardiopulmonary resuscitation (CPR) and witness an adult out-of-hospital sudden collapse probably of cardiac origin. These bystanders should provide chest compression without ventilation (so-called compression-only CPR). If bystanders were previously trained and thus confident with CPR, they should decide between conventional CPR (chest compression plus ventilation at a ratio of 30:2) and chest compression alone. However, considering current evidence-based medicine and latest scientific data both the European Resuscitation Council (ERC) and the German Resuscitation Council (GRC) do not at present intend to change or supplement the current resuscitation guidelines "Basic life support for adults". Both organisations do not see any need for change or amendments in central European practice and continue to recommend that only those lay rescuers that are not willing or unable to give mouth-to-mouth ventilation should provide CPR solely by uninterrupted chest compressions until professional help arrives. It is also stressed that the training of young people especially teenagers as lay rescuers should be promoted and the establishment of training programs through emergency medical organizations and in schools should be encouraged.
Subject(s)
Cardiopulmonary Resuscitation/standards , Thorax/physiology , American Heart Association , Emergency Medical Services , Humans , Pressure , Respiration, Artificial , United StatesABSTRACT
PURPOSE: To evaluate azithromycin tear concentrations after one drop of T1225 0.5%, 1.0%, and 1.5% eyedrops. METHODS: In this randomized, double-masked study, 91 healthy volunteers received one drop into each eye of T1225 0.5% (n=23), T1225 1.0% (n=38), or T1225 1.5% (n=38). Azithromycin tear concentrations were measured by HPLC-MS at seven time points for 24 hours. Tolerability was evaluated. RESULTS: T1225 1.0% and 1.5% had similar pharmacokinetic profiles. After a post-instillation peak (167 to 178 mg/L after 10 minutes), mean concentrations remained above 7 mg/L for 24 hours (except for T1225 1% at H24). A delayed increase of the azithromycin mean tear concentration might be explained by the known late azithromycin release from tissues after storage in cells. Areas under inhibitory curve (AUICs) of T1225 1.0% and 1.5% were higher than AUICs of T1225 0.5% and ranged between 47 and 90. The three T1225 concentrations were safe for the ocular surface. CONCLUSIONS: Once daily instillation of T1225 1.0% and 1.5% was shown to reach an AUIC markedly above the required threshold for an antibacterial activity against Gram-positive bacteria (25-35). These results suggest that a BID instillation is more likely to ensure antimicrobial activity against Gram-negative bacteria (threshold >100).
Subject(s)
Anti-Bacterial Agents/pharmacokinetics , Azithromycin/pharmacokinetics , Tears/metabolism , Administration, Topical , Adolescent , Adult , Anti-Bacterial Agents/administration & dosage , Area Under Curve , Azithromycin/administration & dosage , Biological Availability , Chromatography, High Pressure Liquid , Double-Blind Method , Female , Humans , Male , Mass Spectrometry , Microbial Sensitivity Tests , Middle Aged , Ophthalmic Solutions/administration & dosage , Ophthalmic Solutions/pharmacokineticsABSTRACT
AIMS: Sensitive diagnosis of Acanthamoeba infections may prevent the clinical condition from becoming worse. In order to improve the diagnosis tool performances, we studied the implication of the DNA extraction procedures on the detection of Acanthamoeba by real-time PCR. METHODS: Acanthamoeba cysts mixed with a tag virus were processed according to different DNA preparation procedures: heat, Proteinase K (ProtK), alkali lysis, QIAmp kit, MagNA Pure (DNA Mini kit, MagNA Pure Nucleic Acid isolation kit), ProtK+QIAmp and ProtK+MagNA Pure. Parasite-DNA loads were assessed by real-time PCR. RESULTS: The results show that the structures of Acanthamoeba cysts are resistant to reagents releasing the DNA from other cells and viruses. Heat, NaOH or ProtK did not allow the DNA extraction yields to be assessed or the inhibitors to be eliminated The QIAmp and the MagNA Pure partially improved the sensitivity of the PCR and eliminated the inhibitors. A significant increase in positive results was obtained with a ProtK treatment before commercial extraction kits. ProtK+MagNA Pure yielded the highest rates of positivity. CONCLUSION: To minimise false negative results, the nucleic-acid based Acanthamoeba diagnosis requires, first, the efficient lysis of cysts (without affecting the DNA) to make the DNA available for extraction and amplification, and, second, the elimination of PCR inhibitors. A significant increase in the detection rates is obtained by adding a ProtK treatment (10 min at 56 degrees C) before the commercial procedures. ProtK+MagNA Pure yielded the best results in 30 min, followed by ProtK+QIAmp (150 min).