ABSTRACT
The authors present diagnosis and treatment of two children with postoperative intussusception. A 6-month baby with retroperitoneal teratoma developed clinical signs of intestinal obstruction in 2 days after surgery. The child underwent redo laparotomy, and ileocecal intussusception was found. In the second case, a 6-month baby with choledochal cyst underwent laparotomy, cyst excision and Roux-en-Y-hepaticojejunostomy. Six days later, clinical deterioration with signs of bowel obstruction appeared. Redo laparotomy was performed for early adhesive ileus, and ileoileal intussusception was observed. In both cases, postoperative intussusception was diagnosed during relaparatomy that confirms the complexity of diagnosis.
Subject(s)
Biliary Tract Surgical Procedures , Choledochal Cyst , Intussusception , Humans , Child , Infant , Intussusception/diagnosis , Intussusception/etiology , Intussusception/surgery , Choledochal Cyst/surgery , Postoperative Period , Liver/surgeryABSTRACT
Treatment of 3 children with rare abdominal diseases are presented in the article: acute gangrenous cholecystitis in newborn, gallbladder torsion, vermiform appendix torsion. The authors recall the existence of such rare diseases, especially in those cases when clinical symptoms of acute surgical abdominal pathology do not fit into the well-known canons. Diagnosis was established intraoperatively in all children that confirms difficult diagnosis of these diseases.
Subject(s)
Appendix/surgery , Cecal Diseases/surgery , Cholecystitis, Acute/surgery , Gallbladder Diseases/surgery , Torsion Abnormality/surgery , Child , Cholecystitis, Acute/pathology , Emergencies , Gangrene , Humans , Infant, Newborn , Rare Diseases/surgeryABSTRACT
AIM: To define the the role of small bowel length in development of SBS. MATERIAL AND METHODS: Seventeen patients with SBS after small bowel resection in neonatal period were included into the study. Total small bowel length ranged from 5 to 55 cm (11.8±5.59% from normal length for certain age). RESULTS: Described small bowel length has high risk of SBS/IF development irrespective to other factors (specific segment of small bowel that was resected, preserved intestinal segment state, absence of colon and/or ileocecal valve). CONCLUSION: It is required to perform further studies with greater amount of patients to discover exact small bowel length which is associated with SBS and other factors affecting small bowel state.
Subject(s)
Digestive System Surgical Procedures/adverse effects , Dissection/adverse effects , Gastrointestinal Diseases/surgery , Intestine, Small , Short Bowel Syndrome , Digestive System Surgical Procedures/methods , Female , Gastrointestinal Diseases/classification , Gestational Age , Humans , Infant, Newborn , Intestine, Small/pathology , Intestine, Small/physiopathology , Intestine, Small/surgery , Male , Organ Size , Outcome and Process Assessment, Health Care , Prognosis , Risk Assessment , Risk Factors , Russia , Short Bowel Syndrome/diagnosis , Short Bowel Syndrome/etiology , Short Bowel Syndrome/physiopathologyABSTRACT
This investigation was undertaken to study the associations of the polymorphic variants of the HLA-DRBI and HLA-DQB1 loci with the development of cystic echinococcosis in children. The material for the investigation was collected from 57 children admitted for surgery to the clinic of the Department of Pediatric Surgery, Orthopedics, and Anesthesiology, Bashkir State Medical University (Ufa). The PROTRANS kit (Germany) was used to isolate DNA samples from peripheral venous blood served as an object of the investigations. HLA specificities were typed by polymerase chain reaction. Molecular genetic studies established the association of DRB1*07, DQB1*0.9, DQB1*02 specificities with the increased risk of cystic echinococcosis in children. The echinococcosis cyst suppuration-complicated course of the disease was found to be more frequently encountered in DQB1*02 and DRB1*03 allele carriers.
Subject(s)
Echinococcosis/genetics , Echinococcus/immunology , Epitopes/genetics , HLA-DQ beta-Chains/genetics , HLA-DRB1 Chains/genetics , Alleles , Animals , Antigenic Variation/genetics , Antigenic Variation/immunology , Bashkiria , Case-Control Studies , Child , Child, Preschool , Cysts , Echinococcosis/blood , Echinococcosis/immunology , Epitopes/immunology , Female , Gene Frequency , Genetic Predisposition to Disease , HLA-DQ beta-Chains/blood , HLA-DQ beta-Chains/immunology , HLA-DRB1 Chains/blood , HLA-DRB1 Chains/immunology , Haplotypes , Heterozygote , Humans , Immunophenotyping , Male , Polymerase Chain Reaction , SuppurationABSTRACT
This study was undertaken to analyze the nucleotide sequences of a marker fragment in the mitochondrial cox1 gene in polymorphic variants of G1 strain from the nucleotide sequence bank "Genbank" and to choose conditions for a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate the G1 genotype in E.granulosus isolates. The analysis indicated that G1 genotype polymorphism was due to impact nucleotide replacements and to the varying length of the marker fragment of the coxl gene (by the presence of absence of the 5' GTGGCT 3' site with the coordinates 10275-10280). The procedure of PCR-RFLP was modified to identify the G1 variants due to the varying coxl length. New primers annealed to the variable coxl site of the following structure: 5' TGTGTTGATTTT-GCCTGG 3' (direct); 5' GCCACCACAAACCAAGTATC 3' (inverse) were chosen. Then the localizations of restriction sites were determined for the endonucleases R.Fok 1, R.Sfa NI, and R.Mael and the restriction fragment length was calculated for the RFLP analysis.
Subject(s)
Cyclooxygenase 1/genetics , Echinococcus granulosus/genetics , Helminth Proteins/genetics , Mitochondria/genetics , Polymerase Chain Reaction/methods , Polymorphism, Restriction Fragment Length , Animals , Base Sequence , DNA Primers , DNA, Mitochondrial/genetics , Echinococcosis/parasitology , Echinococcus granulosus/classification , Echinococcus granulosus/isolation & purification , Humans , Mitochondria/enzymology , Sequence Analysis, DNAABSTRACT
Results of the immune-enzyme assay (IEA) of children with liver and lung echinococcosis before and after the operation were analyzed. The IEA accuracy was 91% for liver echinococcosis and 57% for lung echinococcosis. Sensitivity was 86% and 55, respectively. IEA was a reliable method of disease recurrence detection postoperatively. Conservative treatment of hydatid disease consisted of Antiparasitic and auxiliary therapy and was successfully applied in 7 patients with liver echinococcosis and 3 kids with combined affection. Preventive chemotherapy was carried out in 115 patients. During the 5 years follow-up period no recurrences was registered.
Subject(s)
Anticestodal Agents/therapeutic use , Echinococcosis, Hepatic/therapy , Echinococcosis, Pulmonary/therapy , Laparoscopy/methods , Thoracic Surgery, Video-Assisted/methods , Adolescent , Animals , Antibodies, Helminth/analysis , Child , Child, Preschool , Echinococcosis, Hepatic/diagnosis , Echinococcosis, Pulmonary/diagnosis , Echinococcus/immunology , Echinococcus/isolation & purification , Female , Follow-Up Studies , Humans , Immunoenzyme Techniques , Male , Retrospective Studies , Tomography, X-Ray Computed , Treatment OutcomeABSTRACT
Results of treatment carried out during 1989-2000 years were analyzed in 164 children with pleural empyema. Economic analysis proves that videothoracoscopic pleural cavity sanation is more beneficial in acute period in 1.7 times and in long-term period--in 1.9 times, compared with traditional method (puncture and drainage). "Cost-efficacy" analysis shows that videothoracoscopic pleural cavity sanation allows increasing of clinical efficacy in 3.6 times in comparison with traditional treatment mode. "Cost-value" analysis shows improvement of life quality in 1.2 times after application of videothoracoscopic pleural cavity sanation compared with traditional method. Cost effectiveness of videothoracoscopic pleural cavity sanation for better life quality achievement is higher in 2.3 times compared with traditional method.
Subject(s)
Empyema, Pleural/surgery , Thoracic Surgery, Video-Assisted/economics , Adolescent , Bashkiria , Child , Child, Preschool , Cost-Benefit Analysis , Empyema, Pleural/economics , Humans , Retrospective Studies , Thoracic Surgery, Video-Assisted/methodsABSTRACT
174 children of all ages with acute destructive pneumonia complicated with pleural empyema were treated during 10 ten years using videothoracoscopic method; among them 74 children were of younger age (43%). General principles of modern diagnostics and videothoracoscopic pleural cavity sanations were formulated. Ultrasonography and computer tomography of the chest carried out in younger children give possibilities for clear differential diagnostics with other diseases. Advantages of endosurgical treatment are proved. Indications for planned recurrent pleural cavity sanations were worked out.
Subject(s)
Empyema, Pleural/diagnosis , Thoracic Surgery, Video-Assisted/methods , Adolescent , Child, Preschool , Diagnosis, Differential , Empyema, Pleural/surgery , Humans , Infant , Infant, Newborn , Tomography, X-Ray Computed , Treatment OutcomeABSTRACT
DNA samples isolated from peripheral venous blood lymphocytes in 73 children with hydatid disease were studied. The polymorphism of exon 7 (A4889G) of the CYP1A1 gene was analyzed by polymerase chain reaction, followed by hydrolysis with restriction endonuclease HincII. The material for E. granulosus genotypes to be studied was obtained from the germinal layer of larvocysts. The fragment of the mitochondrial gene encoding for the first subunit of cytochome-C-oxidase was as a DNA marker. The amplified E. granulosus DNA fragments underwent direct sequencing and a genotype was identified. The findings have led to the conclusion that carriage of polymorphic allele Val of exon 7 (A4889G) of the CYP1A1 gene in those infested with E. granulosus genotype G1 (common, sheep strain) is a risk factor of the development of the clinical form of echinococcosis granulosus.
Subject(s)
Cytochrome P-450 CYP1A1/genetics , Echinococcosis/genetics , Echinococcus granulosus , Genetic Predisposition to Disease , Adolescent , Alleles , Animals , Child , Child, Preschool , Echinococcus granulosus/classification , Echinococcus granulosus/genetics , Echinococcus granulosus/isolation & purification , Exons/genetics , Female , Genotype , Heterozygote , Humans , Leukocytes, Mononuclear , Male , Risk FactorsABSTRACT
Analysis of surgical treatment of children with multiple hepatic hydatid cysts is presented. The age of patients was from 4 till 14 years. Desensibilization, hemodynamic adjustment and treatment with hepatoprotectors were used on purpose of preoperative preparation. The general anesthesia was carried out on the basis of sevofluran and propofol. Anesthesia with sevofluran has advantage. It was proved by definition of level of stress hormones. One-stage surgical management is more preferable. In case of combination with hydatid disease of lung term between the operations has made 2-3 weeks. Treatment with hepatoprotectors, enzymes, antiparasitic therapy with albendozol, physiotherapy were used in postoperative period. Postoperative complications, lethal outcomes were not observed. Relapse has been revealed at 1 (2%) patient.
Subject(s)
Echinococcosis, Hepatic/surgery , Laparoscopy/methods , Adolescent , Animals , Antibodies, Helminth/analysis , Child , Child, Preschool , Echinococcus/immunology , Echinococcus/isolation & purification , Female , Follow-Up Studies , Humans , Immunoenzyme Techniques , Liver/diagnostic imaging , Liver/parasitology , Male , Retrospective Studies , Tomography, X-Ray Computed , Treatment Outcome , UltrasonographyABSTRACT
Results of traditional and video-laparoscopic relaparotomy at children with appendicular general peritonitis are analyzed. Design--one-center, retrospective, case-control study. It is demonstrated that variant of relaparotomy does not correlate with survival and intensive care content. Long-term results are more favorable after laparoscopic surgery.
Subject(s)
Elective Surgical Procedures/instrumentation , Laparoscopy/methods , Peritonitis/diagnostic imaging , Peritonitis/surgery , Video-Assisted Surgery/methods , Adolescent , Child , Child, Preschool , Female , Humans , Infant , Male , RadiographyABSTRACT
An experience with the diagnosis and surgical treatment of hydatid disease of the liver included 191 patients aged from 2 through 15 years, 26 of them had a combined involvement of the liver and lung, in 7 patients there were combined lesions with other organs. Complicated echinococcosis was noted in 25 children. Ultrasonography was given the main role in the diagnosis. Videolaparoscopic hydatidectomy of the liver was performed in 62 patients. Solitary cysts of small and medium sizes located superficially were considered as indications to operation. In patients with large and gigantic cysts of special significance was capitonnage of the residual cavity. Use of albendazole as an antiparasitic agent for the recurrent disease and a prophylactic agent after operation for multiple and combined hydatid disease of the liver was found to be sufficiently effective.
Subject(s)
Echinococcosis, Hepatic/diagnostic imaging , Echinococcosis, Hepatic/surgery , Endoscopy/methods , Adolescent , Child , Child, Preschool , Echinococcosis, Hepatic/parasitology , Female , Humans , Male , UltrasonographyABSTRACT
A 15-year-old patient living in Bashkortostan was admitted as having a diagnosis of hydatid cyst of the left hepatic lobe for surgical treatment. He had the following concomitant diseases: neurodermatitis, bronchial asthma, and acute respiratory disease. After surgery (laparoscopic echinococcectomy), a portion was taken from the parent vesicle wall for a histological study. The parasite was detected on the inner membrane surface. It is suggested that this is a Pentastoma sp. (Arthropoda, Maxillopoda, Pentastomida, and Cephalobaenida). Thus, the observed patient has a combined hepatic invasion with Echinococcus and Pentastoma).
Subject(s)
Arthropods , Echinococcosis, Hepatic/complications , Parasitic Diseases/complications , Parasitic Diseases/parasitology , Adolescent , Animals , Arthropods/anatomy & histology , Arthropods/classification , Humans , Liver/parasitology , MaleABSTRACT
The topicality of the problem associated with echinococcosis granulosus in the South Urals is determined by its wide spread and a considerable economic damage made to this region by this invasion. The study was undertaken to reveal the intraspecific affiliation of Echinococcus granulosus that induces hydatid disease in the population of the South Urals. Samples for studies were taken from the fertile larval cysts obtained during intraoperative intervention in patients with hydatid disease. As morphological criteria for differentiation, the authors examined the proboscis uncuses of protoscolexes. For E. granulosus genomic typing, polymerase chain reaction (PCR) of DNA synthesis was used, as described by Gasser (1998). As a DNA marker, the authors used a fragment of the mitochondrial gene encoding for the first subunit of cytochome-C-oxidase. The DNA fragments obtained by PCR from 9 isolated underwent the direct enzyme dideoxy-sequencing test (Senger, 1977). As a result, the causative agent of echinococcosis granulosis was first identified in the patient of the South Urals. In children and adults, the clinical form of the disease is caused by E. granulosus with the genotype G - common, that of domestic sheep. Comparative analysis of molecular data revealed the presence of genotype G1 variations circulating in the South Urals homologous to the sequences recorded in the GenBank under numbers U50464 and DQ109036.
Subject(s)
Echinococcosis/parasitology , Echinococcus granulosus/classification , Adolescent , Adult , Animals , Child , Child, Preschool , DNA, Helminth/genetics , DNA, Mitochondrial/genetics , Echinococcus granulosus/anatomy & histology , Echinococcus granulosus/genetics , Electron Transport Complex IV/genetics , Humans , Larva/anatomy & histology , Larva/classification , Larva/genetics , Polymerase Chain Reaction , Russia , Species SpecificityABSTRACT
Quantitative assessment of the severity of clinical status was carried out and prognostic values of PRISM III, PRISM, SOFA, APACHE II scores and scores proposed by A. Castellanos et al. and K. L. Goitein was evaluated in 105 children (2 months-14 years) with sepsis. Clinical status evaluated in score during the first day of intensive care was correlated to the disease outcome. Sensitivity, specificity, expected values of positive and negative results were evaluated for each score and their discrimination capacity was assessed by ROC analysis. Use of quantitative scores (PRISM, PRISM III, SOFA, APACHE II, and A. Castellanos') is permissible for prospective evaluation of the efficiency of intensive care in children with sepsis, PRISM being the most informative.
Subject(s)
Sepsis/diagnosis , Severity of Illness Index , APACHE , Adolescent , Age Factors , Child , Child, Preschool , Critical Care , Data Interpretation, Statistical , Humans , Infant , ROC Curve , Sensitivity and Specificity , Sepsis/therapyABSTRACT
Videothoracoscopic operations were carried out in 54 patients aged 6 months to 14 years. Two variants of general anesthesia were used: bolus injection of fentanyl in combination with calypsol and infusion of fentanyl in combination with subnarcotic doses of fluothane. One-lung ventilation was carried out in all children. Hemodynamic status, gaseous composition of the blood, and cerebral bloodflow were monitored during general anesthesia.
Subject(s)
Anesthesia, General , Thoracic Surgery, Video-Assisted , Adolescent , Age Factors , Anesthesia, General/methods , Anesthetics, Combined/administration & dosage , Anesthetics, Dissociative/administration & dosage , Anesthetics, Inhalation/administration & dosage , Anesthetics, Intravenous/administration & dosage , Cerebrovascular Circulation , Child , Child, Preschool , Female , Fentanyl/administration & dosage , Halothane/administration & dosage , Hemodynamics , Humans , Infant , Ketamine/administration & dosage , Male , Models, Theoretical , Monitoring, PhysiologicABSTRACT
The results of the study of hemiluminescence of native blood, plasma and urine in 56 children with diffuse purulent peritonitis demonstrate that changes of light-sum of the luminescence of the investigated media could reflect aggravation of endogenous intoxication connected with development of organic insufficiency. The usage of blood and urine hemiluminescence for definition of the gravity of endogenous intoxication in diffuse forms of appendicular peritonitis in children is suggested.
Subject(s)
Appendicitis/complications , Peritonitis/blood , Peritonitis/urine , Adolescent , Appendicitis/blood , Appendicitis/urine , Child , Child, Preschool , Follow-Up Studies , Humans , Indicators and Reagents , Infant , Lipid Peroxidation , Luminescent Measurements , Neutrophils/metabolism , Neutrophils/pathology , Nitroblue Tetrazolium , Peritonitis/etiology , Phagocytosis , Rupture, Spontaneous , Suppuration/blood , Suppuration/etiology , Suppuration/urineSubject(s)
Duodenal Diseases/etiology , Intestinal Perforation/etiology , Pericarditis/etiology , Pneumothorax/etiology , Vitamin K Deficiency Bleeding/complications , Digestive System Surgical Procedures , Duodenal Diseases/diagnosis , Duodenal Diseases/surgery , Female , Follow-Up Studies , Humans , Infant, Newborn , Intestinal Perforation/diagnosis , Intestinal Perforation/surgery , Pericardial Effusion/diagnosis , Pericardial Effusion/etiology , Pericardial Effusion/surgery , Pericarditis/diagnosis , Pericarditis/surgery , Pneumothorax/diagnosis , Pneumothorax/surgery , Punctures , Rupture, Spontaneous , SuctionABSTRACT
The authors used echography in order to reveal typical echographic signs of high and low bowel obstruction in 51 newborns. Although the use of echography often fails to establish the real cause of the bowel obstruction, it allows the determination of its level and in general promotes making the proper diagnosis.
