ABSTRACT
Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic 'Apache' blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5' GATCTGTCCTGGGATTGTTC 3') and INSVR (5' GTCTCCTTCTGGTTCTATAATCAT 3') that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.
