Exploiting lung adaptation and phage steering to clear pan-resistant Pseudomonas aeruginosa infections in vivo.

Pseudomonas aeruginosa is a major nosocomial pathogen that causes severe disease including sepsis. Carbapenem-resistant P. aeruginosa is recognised by the World Health Organisation as a priority 1 pathogen, with urgent need for new therapeutics. As such, there is renewed interest in using bacteriophages as a therapeutic. However, the dynamics of treating pan-resistant P. aeruginosa with phage in vivo are poorly understood. Using a pan-resistant P. aeruginosa in vivo infection model, phage therapy displays strong therapeutic potential, clearing infection from the blood, kidneys, and spleen. Remaining bacteria in the lungs and liver displays phage resistance due to limiting phage adsorption. Yet, resistance to phage results in re-sensitisation to a wide range of antibiotics. In this work, we use phage steering in vivo, pre-exposing a pan resistant P. aeruginosa infection with a phage cocktail to re-sensitise bacteria to antibiotics, clearing the infection from all organs.

Correction: Plasmids manipulate bacterial behaviour through translational regulatory crosstalk.

[This corrects the article DOI: 10.1371/journal.pbio.3001988.].

IMG/PR: a database of plasmids from genomes and metagenomes with rich annotations and metadata.

Plasmids are mobile genetic elements found in many clades of Archaea and Bacteria. They drive horizontal gene transfer, impacting ecological and evolutionary processes within microbial communities, and hold substantial importance in human health and biotechnology. To support plasmid research and provide scientists with data of an unprecedented diversity of plasmid sequences, we introduce the IMG/PR database, a new resource encompassing 699 973 plasmid sequences derived from genomes, metagenomes and metatranscriptomes. IMG/PR is the first database to provide data of plasmid that were systematically identified from diverse microbiome samples. IMG/PR plasmids are associated with rich metadata that includes geographical and ecosystem information, host taxonomy, similarity to other plasmids, functional annotation, presence of genes involved in conjugation and antibiotic resistance. The database offers diverse methods for exploring its extensive plasmid collection, enabling users to navigate plasmids through metadata-centric queries, plasmid comparisons and BLAST searches. The web interface for IMG/PR is accessible at https://img.jgi.doe.gov/pr. Plasmid metadata and sequences can be downloaded from https://genome.jgi.doe.gov/portal/IMG_PR.

Increasing the π-Expansive Ligands in Ruthenium(II) Polypyridyl Complexes: Synthesis, Characterization, and Biological Evaluation for Photodynamic Therapy Applications.

Lack of selectivity is one of the main issues with currently used chemotherapies, causing damage not only to altered cells but also to healthy cells. Over the last decades, photodynamic therapy (PDT) has increased as a promising therapeutic tool due to its potential to treat diseases like cancer or bacterial infections with a high spatiotemporal control. Ruthenium(II) polypyridyl compounds are gaining attention for their application as photosensitizers (PSs) since they are generally nontoxic in dark conditions, while they show remarkable toxicity after light irradiation. In this work, four Ru(II) polypyridyl compounds with sterically expansive ligands were studied as PDT agents. The Ru(II) complexes were synthesized using an alternative route to those described in the literature, which resulted in an improvement of the synthesis yields. Solid-state structures of compounds [Ru(DIP)2phen]Cl2 and [Ru(dppz)2phen](PF6)2 have also been obtained. It is well-known that compound [Ru(dppz)(phen)2]Cl2 binds to DNA by intercalation. Therefore, we used [Ru(dppz)2phen]Cl2 as a model for DNA interaction studies, showing that it stabilized two different sequences of duplex DNA. Most of the synthesized Ru(II) derivatives showed very promising singlet oxygen quantum yields, together with noteworthy photocytotoxic properties against two different cancer cell lines, with IC50 in the micro- or even nanomolar range (0.06-7 µM). Confocal microscopy studies showed that [Ru(DIP)2phen]Cl2 and [Ru(DIP)2TAP]Cl2 accumulate preferentially in mitochondria, while no mitochondrial internalization was observed for the other compounds. Although [Ru(dppn)2phen](PF6)2 did not accumulate in mitochondria, it interestingly triggered an impairment in mitochondrial respiration after light irradiation. Among others, [Ru(dppn)2phen](PF6)2 stands out for its very good IC50 values, correlated with a very high singlet oxygen quantum yield and mitochondrial respiration disruption.

Compensatory mutations reducing the fitness cost of plasmid carriage occur in plant rhizosphere communities.

Plasmids drive bacterial evolutionary innovation by transferring ecologically important functions between lineages, but acquiring a plasmid often comes at a fitness cost to the host cell. Compensatory mutations, which ameliorate the cost of plasmid carriage, promote plasmid maintenance in simplified laboratory media across diverse plasmid-host associations. Whether such compensatory evolution can occur in more complex communities inhabiting natural environmental niches where evolutionary paths may be more constrained is, however, unclear. Here, we show a substantial fitness cost of carrying the large conjugative plasmid pQBR103 in Pseudomonas fluorescens SBW25 in the plant rhizosphere. This plasmid fitness cost could be ameliorated by compensatory mutations affecting the chromosomal global regulatory system gacA/gacS, which arose rapidly in plant rhizosphere communities and were exclusive to plasmid carriers. These findings expand our understanding of the importance of compensatory evolution in plasmid dynamics beyond simplified lab media. Compensatory mutations contribute to plasmid survival in bacterial populations living within complex microbial communities in their environmental niche.

Plasmids manipulate bacterial behaviour through translational regulatory crosstalk.

Beyond their role in horizontal gene transfer, conjugative plasmids commonly encode homologues of bacterial regulators. Known plasmid regulator homologues have highly targeted effects upon the transcription of specific bacterial traits. Here, we characterise a plasmid translational regulator, RsmQ, capable of taking global regulatory control in Pseudomonas fluorescens and causing a behavioural switch from motile to sessile lifestyle. RsmQ acts as a global regulator, controlling the host proteome through direct interaction with host mRNAs and interference with the host's translational regulatory network. This mRNA interference leads to large-scale proteomic changes in metabolic genes, key regulators, and genes involved in chemotaxis, thus controlling bacterial metabolism and motility. Moreover, comparative analyses found RsmQ to be encoded on a large number of divergent plasmids isolated from multiple bacterial host taxa, suggesting the widespread importance of RsmQ for manipulating bacterial behaviour across clinical, environmental, and agricultural niches. RsmQ is a widespread plasmid global translational regulator primarily evolved for host chromosomal control to manipulate bacterial behaviour and lifestyle.

Horizontal gene transfer and ecological interactions jointly control microbiome stability.

Genes encoding resistance to stressors, such as antibiotics or environmental pollutants, are widespread across microbiomes, often encoded on mobile genetic elements. Yet, despite their prevalence, the impact of resistance genes and their mobility upon the dynamics of microbial communities remains largely unknown. Here we develop eco-evolutionary theory to explore how resistance genes alter the stability of diverse microbiomes in response to stressors. We show that adding resistance genes to a microbiome typically increases its overall stability, particularly for genes on mobile genetic elements with high transfer rates that efficiently spread resistance throughout the community. However, the impact of resistance genes upon the stability of individual taxa varies dramatically depending upon the identity of individual taxa, the mobility of the resistance gene, and the network of ecological interactions within the community. Nonmobile resistance genes can benefit susceptible taxa in cooperative communities yet damage those in competitive communities. Moreover, while the transfer of mobile resistance genes generally increases the stability of previously susceptible recipient taxa to perturbation, it can decrease the stability of the originally resistant donor taxon. We confirmed key theoretical predictions experimentally using competitive soil microcosm communities. Here the stability of a susceptible microbial community to perturbation was increased by adding mobile resistance genes encoded on conjugative plasmids but was decreased when these same genes were encoded on the chromosome. Together, these findings highlight the importance of the interplay between ecological interactions and horizontal gene transfer in driving the eco-evolutionary dynamics of diverse microbiomes.

Three's a crowd - stabilisation, structure, and applications of DNA triplexes.

DNA is a strikingly flexible molecule and can form a variety of secondary structures, including the triple helix, which is the subject of this review. The DNA triplex may be formed naturally, during homologous recombination, or can be formed by the introduction of a synthetic triplex forming oligonucleotide (TFO) to a DNA duplex. As the TFO will bind to the duplex with sequence specificity, there is significant interest in developing TFOs with potential therapeutic applications, including using TFOs as a delivery mechanism for compounds able to modify or damage DNA. However, to combine triplexes with functionalised compounds, a full understanding of triplex structure and chemical modification strategies, which may increase triplex stability or in vivo degradation, is essential - these areas will be discussed in this review. Ruthenium polypyridyl complexes, which are able to photooxidise DNA and act as luminescent DNA probes, may serve as a suitable photophysical payload for a TFO system and the developments in this area in the context of DNA triplexes will also be reviewed.

A tale of two plasmids: contributions of plasmid associated phenotypes to epidemiological success among Shigella.

Dissemination of antimicrobial resistance (AMR) genes by horizontal gene transfer (HGT) mediated through plasmids is a major global concern. Genomic epidemiology studies have shown varying success of different AMR plasmids during outbreaks, but the underlying reasons for these differences are unclear. Here, we investigated two Shigella plasmids (pKSR100 and pAPR100) that circulated in the same transmission network but had starkly contrasting epidemiological outcomes to identify plasmid features that may have contributed to the differences. We used plasmid comparative genomics to reveal divergence between the two plasmids in genes encoding AMR, SOS response alleviation and conjugation. Experimental analyses revealed that these genomic differences corresponded with reduced conjugation efficiencies for the epidemiologically successful pKSR100, but more extensive AMR, reduced fitness costs, and a reduced SOS response in the presence of antimicrobials, compared with the less successful pAPR100. The discrepant phenotypes between the two plasmids are consistent with the hypothesis that plasmid-associated phenotypes contribute to determining the epidemiological outcome of AMR HGT and suggest that phenotypes relevant in responding to antimicrobial pressure and fitness impact may be more important than those around conjugation in this setting. Plasmid phenotypes could thus be valuable tools in conjunction with genomic epidemiology for predicting AMR dissemination.

An LNA-amide modification that enhances the cell uptake and activity of phosphorothioate exon-skipping oligonucleotides.

Oligonucleotides that target mRNA have great promise as therapeutic agents for life-threatening conditions but suffer from poor bioavailability, hence high cost. As currently untreatable diseases come within the reach of oligonucleotide therapies, new analogues are urgently needed to address this. With this in mind we describe reduced-charge oligonucleotides containing artificial LNA-amide linkages with improved gymnotic cell uptake, RNA affinity, stability and potency. To construct such oligonucleotides, five LNA-amide monomers (A, T, C, 5mC and G), where the 3'-OH is replaced by an ethanoic acid group, are synthesised in good yield and used in solid-phase oligonucleotide synthesis to form amide linkages with high efficiency. The artificial backbone causes minimal structural deviation to the DNA:RNA duplex. These studies indicate that splice-switching oligonucleotides containing LNA-amide linkages and phosphorothioates display improved activity relative to oligonucleotides lacking amides, highlighting the therapeutic potential of this technology.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

What makes a megaplasmid?

Naturally occurring plasmids come in different sizes. The smallest are less than a kilobase of DNA, while the largest can be over three orders of magnitude larger. Historically, research has tended to focus on smaller plasmids that are usually easier to isolate, manipulate and sequence, but with improved genome assemblies made possible by long-read sequencing, there is increased appreciation that very large plasmids-known as megaplasmids-are widespread, diverse, complex, and often encode key traits in the biology of their host microorganisms. Why are megaplasmids so big? What other features come with large plasmid size that could affect bacterial ecology and evolution? Are megaplasmids 'just' big plasmids, or do they have distinct characteristics? In this perspective, we reflect on the distribution, diversity, biology, and gene content of megaplasmids, providing an overview to these large, yet often overlooked, mobile genetic elements. This article is part of the theme issue 'The secret lives of microbial mobile genetic elements'.

Plasmid fitness costs are caused by specific genetic conflicts enabling resolution by compensatory mutation.

Plasmids play an important role in bacterial genome evolution by transferring genes between lineages. Fitness costs associated with plasmid carriage are expected to be a barrier to gene exchange, but the causes of plasmid fitness costs are poorly understood. Single compensatory mutations are often sufficient to completely ameliorate plasmid fitness costs, suggesting that such costs are caused by specific genetic conflicts rather than generic properties of plasmids, such as their size, metabolic burden, or gene expression level. By combining the results of experimental evolution with genetics and transcriptomics, we show here that fitness costs of 2 divergent large plasmids in Pseudomonas fluorescens are caused by inducing maladaptive expression of a chromosomal tailocin toxin operon. Mutations in single genes unrelated to the toxin operon, and located on either the chromosome or the plasmid, ameliorated the disruption associated with plasmid carriage. We identify one of these compensatory loci, the chromosomal gene PFLU4242, as the key mediator of the fitness costs of both plasmids, with the other compensatory loci either reducing expression of this gene or mitigating its deleterious effects by up-regulating a putative plasmid-borne ParAB operon. The chromosomal mobile genetic element Tn6291, which uses plasmids for transmission, remained up-regulated even in compensated strains, suggesting that mobile genetic elements communicate through pathways independent of general physiological disruption. Plasmid fitness costs caused by specific genetic conflicts are unlikely to act as a long-term barrier to horizontal gene transfer (HGT) due to their propensity for amelioration by single compensatory mutations, helping to explain why plasmids are so common in bacterial genomes.

The dilution effect limits plasmid horizontal transmission in multispecies bacterial communities.

By transferring ecologically important traits between species, plasmids drive genomic divergence and evolutionary innovation in their bacterial hosts. Bacterial communities are often diverse and contain multiple coexisting plasmids, but the dynamics of plasmids in multi-species communities are poorly understood. Here, we show, using experimental multi-species communities containing two plasmids, that bacterial diversity limits the horizontal transmission of plasmids due to the 'dilution effect'; this is an epidemiological phenomenon whereby living alongside less proficient host species reduces the expected infection risk for a focal host species. In addition, plasmid horizontal transmission was also affected by plasmid diversity, such that the rate of plasmid conjugation was reduced from co-infected host cells carrying both plasmids. In diverse microbial communities, plasmid spread may be limited by the dilution effect and plasmid-plasmid interactions, reducing the rate of horizontal transmission.

Positive Selection Inhibits Plasmid Coexistence in Bacterial Genomes.

Plasmids play an important role in bacterial evolution by transferring niche-adaptive functional genes between lineages, thus driving genomic diversification. Bacterial genomes commonly contain multiple, coexisting plasmid replicons, which could fuel adaptation by increasing the range of gene functions available to selection and allowing their recombination. However, plasmid coexistence is difficult to explain because the acquisition of plasmids typically incurs high fitness costs for the host cell. Here, we show that plasmid coexistence was stably maintained without positive selection for plasmid-borne gene functions and was associated with compensatory evolution to reduce fitness costs. In contrast, with positive selection, plasmid coexistence was unstable despite compensatory evolution. Positive selection discriminated between differential fitness benefits of functionally redundant plasmid replicons, retaining only the more beneficial plasmid. These data suggest that while the efficiency of negative selection against plasmid fitness costs declines over time due to compensatory evolution, positive selection to maximize plasmid-derived fitness benefits remains efficient. Our findings help to explain the forces structuring bacterial genomes: coexistence of multiple plasmids in a genome is likely to require either rare positive selection in nature or nonredundancy of accessory gene functions among the coexisting plasmids.IMPORTANCE Bacterial genomes often contain multiple coexisting plasmids that provide important functions like antibiotic resistance. Using lab experiments, we show that such plasmid coexistence within a genome is stable only in environments where the function they encode is useless but is unstable if the function is useful and beneficial for bacterial fitness. Where competing plasmids perform the same useful function, only the most beneficial plasmid is kept by the cell, a process that is similar to competitive exclusion in ecological communities. This process helps explain how bacterial genomes are structured: bacterial genomes expand in size by acquiring multiple plasmids when selection is relaxed but subsequently contract during periods of strong selection for the useful plasmid-encoded function.

The proficiency of the original host species determines community-level plasmid dynamics.

Plasmids are common in natural bacterial communities, facilitating bacterial evolution via horizontal gene transfer. Bacterial species vary in their proficiency to host plasmids: whereas plasmids are stably maintained in some species regardless of selection for plasmid-encoded genes, in other species, even beneficial plasmids are rapidly lost. It is, however, unclear how this variation in host proficiency affects plasmid persistence in communities. Here, we test this using multispecies bacterial soil communities comprising species varying in their proficiency to host a large conjugative mercury resistance plasmid, pQBR103. The plasmid reached higher community-level abundance where beneficial and when introduced to the community in a more proficient host species. Proficient plasmid host species were also better able to disseminate the plasmid to a wider diversity of host species. These findings suggest that the dynamics of plasmids in natural bacterial communities depend not only upon the plasmid's attributes and the selective environment but also upon the proficiency of their host species.

The Impact of Mercury Selection and Conjugative Genetic Elements on Community Structure and Resistance Gene Transfer.

Carriage of resistance genes can underpin bacterial survival, and by spreading these genes between species, mobile genetic elements (MGEs) can potentially protect diversity within microbial communities. The spread of MGEs could be affected by environmental factors such as selection for resistance, and biological factors such as plasmid host range, with consequences for individual species and for community structure. Here we cultured a focal bacterial strain, Pseudomonas fluorescens SBW25, embedded within a soil microbial community, with and without mercury selection, and with and without mercury resistance plasmids (pQBR57 or pQBR103), to investigate the effects of selection and resistance gene introduction on (1) the focal species; (2) the community as a whole; (3) the spread of the introduced mer resistance operon. We found that P. fluorescens SBW25 only escaped competitive exclusion by other members of community under mercury selection, even when it did not begin with a mercury resistance plasmid, due to its propensity to acquire resistance from the community by horizontal gene transfer. Mercury pollution had a significant effect on community structure, decreasing alpha diversity within communities while increasing beta diversity between communities, a pattern that was not affected by the introduction of mercury resistance plasmids by P. fluorescens SBW25. Nevertheless, the introduced merA gene spread to a phylogenetically diverse set of recipients over the 5 weeks of the experiment, as assessed by epicPCR. Our data demonstrates how the effects of MGEs can be experimentally assessed for individual lineages, the wider community, and for the spread of adaptive traits.

The influence of loops on the binding of the [Ru(phen)2dppz]2+ light-switch compound to i-motif DNA structures revealed by time-resolved spectroscopy.

Ultrafast time resolved infrared (TRIR) is used to report on the binding site of the "light-switch" complex [Ru(phen)2(dppz)]2+1 to i-motif structures in solution. Detailed information is provided due to perturbation of the local base vibrations by a 'Stark-like' effect which is used to establish the contribution of thymine base loop interactions to the binding site of 1 in this increasingly relevant DNA structure.