ABSTRACT
Grafting watermelon (Citrullus lanatus var. lanatus) onto rootstocks of interspecific hybrid squash (Cucurbita moschata × C. maxima), bottle gourd (Lagenaria siceraria), or citron (Citrullus lanatus var. citroides) has been used in Asia and Israel to mange Fusarium wilt of watermelon caused by Fusarium oxysporum f. sp. niveum. The objectives of this study were to determine the frequency of infection of six rootstocks by F. oxysporum f. sp. niveum races 1 and 2 and the field performance of grafted rootstocks in Charleston, SC. Grafted and nongrafted watermelon and rootstock plants were inoculated in the greenhouse with race 1, race 2, or water (the control treatment). With both races, the frequency of recovery of F. oxysporum from scion and rootstock portions of inoculated watermelon plants grafted onto 'Ojakkyo' citron was greater than from watermelon plants grafted onto 'Shintosa Camel' and 'Strong Tosa' interspecific hybrid squash, and from plants grafted onto 'Emphasis', 'Macis', and 'WMXP 3945' bottlegourd. For nongrafted plants inoculated with race 1, percent recovery also was greater from Ojakkyo than from interspecific hybrid squash and bottlegourd. For nongrafted plants inoculated with race 2, F. oxysporum was recovered from the base of ≥79% of all inoculated plants. More than two-thirds (15) of 21 isolates recovered from the tops or scions of inoculated plants were pathogenic on watermelon. In spring 2010 and 2011, the six rootstocks were grafted with seedless watermelon 'Tri-X 313', which is susceptible to both races, and transplanted in a field infested with races 1 and 2 of F. oxysporum f. sp. niveum. Disease incidence for nongrafted and self-grafted Tri-X 313 (the control treatments) and Tri-X 313 grafted onto Ojakkyo citron did not differ significantly. Grafted watermelon plants produced greater weights and numbers of fruit than plants of the two control treatments. Nonpathogenic isolates of F. oxysporum and isolates of F. oxysporum f. sp. niveum colonized interspecific hybrid squash, bottlegourd, and grafted watermelon. The rootstocks evaluated, however, restricted movement of F. oxysporum f. sp. niveum into the watermelon scion, suppressed wilt symptoms, and increased fruit yields in an infested field.
ABSTRACT
Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5'GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5'GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.
