ABSTRACT
The precise features of lesions in non-ST-segment elevation myocardial infarction (NSTEMI) patients with total occlusion (TO) of the infarct-related artery (IRA) are still unclear. This study employs optical coherence tomography (OCT) to investigate pathological features in NSTEMI patients with or without IRA TO and explores the relationship between thrombus types and IRA occlusive status. This was a single-center retrospective study. A total of 202 patients diagnosed with NSTEMI were divided into two groups: those with Thrombolysis In Myocardial Infarction (TIMI) flow grade 0 before percutaneous coronary intervention (PCI) (referred to as the TO group, n = 100) and those TIMI flow grade 1-3 (referred to as the Non-TO group, n = 102). Baseline characteristics, coronary angiography findings, and OCT results were collected. Multivariate logistic analysis identified factors influencing TO in NSTEMI. The category of NSTEMI was further subdivided based on the type of electrocardiogram (ECG) into two subgroups: ST segment unoffset myocardial infarction (STUMI) and ST segment depression myocardial infarction (STDMI). This division allows for a more specific classification of NSTEMI cases. The TO group had a younger age, higher male representation, more smokers, lower hypertension and cerebrovascular disease incidence, lower left ventricular ejection fraction (LVEF), and higher creatine kinase myocardial band (CKMB) and creatine kinase (CK) peak levels. In the TO group, LCX served as the main IRA (52.0%), whereas in the Non-TO group, LAD was the predominant IRA (45.1%). Compared to the Non-TO group, OCT findings demonstrated that red thrombus/mixed thrombus was more common in the TO group, along with a lower occurrence of white thrombus (p < 0.001). The TO group exhibited a higher prevalence of STUMI (p = 0.001), whereas STDMI was more commonly observed in the Non-TO group (p = 0.001). NSTEMI presents as STUMI and STDMI distinct entities. Red thrombus/mixed thrombus in IRA often indicates occlusive lesions with STUMI on ECG. White thrombus suggests non-occlusive lesions with STDMI on ECG.
ABSTRACT
Metastasis is one of the key factors of treatment failure in late-stage colorectal cancer (CRC). Metastatic CRC frequently develops resistance to chemotherapeutic agents. This study aimed to identify the novel regulators from "hidden" proteins encoded by long noncoding RNAs (lncRNAs) involved in tumor metastasis and chemoresistance. Methods: CRISPR/Cas9 library functional screening was employed to identify the critical suppressor of cancer metastasis in highly invasive CRC models. Western blotting, immunofluorescence staining, invasion, migration, wound healing, WST-1, colony formation, gain- and loss-of-function experiments, in vivo experimental metastasis models, multiplex immunohistochemical staining, immunohistochemistry, qRT-PCR, and RT-PCR were used to assess the functional and clinical significance of FOXP3, PRDM16-DT, HNRNPA2B1, and L-CHEK2. RNA-sequencing, co-immunoprecipitation, qRT-PCR, RT-PCR, RNA affinity purification, RNA immunoprecipitation, MeRIP-quantitative PCR, fluorescence in situ hybridization, chromatin immunoprecipitation and luciferase reporter assay were performed to gain mechanistic insights into the role of PRDM16-DT in cancer metastasis and chemoresistance. An oxaliplatin-resistant CRC cell line was established by in vivo selection. WST-1, colony formation, invasion, migration, Biacore technology, gain- and loss-of-function experiments and an in vivo experimental metastasis model were used to determine the function and mechanism of cimicifugoside H-1 in CRC. Results: The novel protein PRDM16-DT, encoded by LINC00982, was identified as a cancer metastasis and chemoresistance suppressor. The down-regulated level of PRDM16-DT was positively associated with malignant phenotypes and poor prognosis of CRC patients. Transcriptionally regulated by FOXP3, PRDM16-DT directly interacted with HNRNPA2B1 and competitively decreased HNRNPA2B1 binding to exon 9 of CHEK2, resulting in the formation of long CHEK2 (L-CHEK2), subsequently promoting E-cadherin secretion. PRDM16-DT-induced E-cadherin secretion inhibited fibroblast activation, which in turn suppressed CRC metastasis by decreasing MMP9 secretion. Cimicifugoside H-1, a natural compound, can bind to LEU89, HIS91, and LEU92 of FOXP3 and significantly upregulated PRDM16-DT expression to repress CRC metastasis and reverse oxaliplatin resistance. Conclusions: lncRNA LINC00982 can express a new protein PRDM16-DT to function as a novel regulator in cancer metastasis and drug resistance of CRC. Cimicifugoside H-1 can act on the upstream of the PRDM16-DT signaling pathway to alleviate cancer chemoresistance.
Subject(s)
Colorectal Neoplasms , DNA-Binding Proteins , Drug Resistance, Neoplasm , Gene Expression Regulation, Neoplastic , Neoplasm Metastasis , RNA, Long Noncoding , Transcription Factors , Colorectal Neoplasms/pathology , Colorectal Neoplasms/genetics , Colorectal Neoplasms/drug therapy , Colorectal Neoplasms/metabolism , RNA, Long Noncoding/genetics , RNA, Long Noncoding/metabolism , Humans , Drug Resistance, Neoplasm/genetics , Animals , DNA-Binding Proteins/metabolism , DNA-Binding Proteins/genetics , Mice , Cell Line, Tumor , Transcription Factors/metabolism , Transcription Factors/genetics , Heterogeneous-Nuclear Ribonucleoprotein Group A-B/metabolism , Heterogeneous-Nuclear Ribonucleoprotein Group A-B/genetics , Oxaliplatin/pharmacology , Oxaliplatin/therapeutic use , RNA Splicing/genetics , Cell Movement/drug effects , Mice, Nude , Mice, Inbred BALB CABSTRACT
Objective: To explore the active substances and targets of Danbie Capsules in Endometriosis therapy. Methods: This study was conducted through TCMSP and published literature screened and obtained 183 active substances of Danbie Capsules, combined and intersected with Endometriosis target genes collected and screened in the GEO database, obtained 24 target genes for Endometriosis treatment, and mapped the target network map of Danbie Capsules active substances against Endometriosis. The network was analyzed with the aid of Cytoscape version 3.9.1. With the aid of the platform of the STRING data analysis, PPI network analysis was conducted on 24 anti-Endometriosis targets of the Danbie Capsules. Results: The research results obtained three critical active substances, namely, Quercetin, ß-sitosterol, and Luteolin. Seven critical targets were identified, and two representative genes (TP53 and AKT1) have been verified in Macromolecular docking and immunohistochemical verification. Conclusion: The active substances of Danbie Capsules in the treatment of Endometriosis are Quercetin, ß-sitosterol and Luteolin, and the main targets are TP53 and AKT1.
ABSTRACT
OBJECTIVE: Few studies have evaluated the performance of non-drug-adjusted primary aldosteronism (PA) screening. Therefore, we aimed to examine the consistency between PA screening results with and without drug adjustment and to explore the effectiveness of screening without drug adjustment. METHODS: This prospective study included 650 consecutive patients with a high risk of incidence PA. Patients who initially screened positive underwent rescreening with drug adjustments and confirmatory tests. Regarding the remaining patients, one of every three consecutive patients underwent rescreening with drug adjustments and confirmatory tests. The changes in aldosterone and renin concentrations were compared between patients with essential hypertension (EH) and those with PA before and after drug adjustment. Sensitivity and specificity were used to assess the diagnostic performance of screening without drug adjustment, using the confirmatory test results as the reference. RESULTS: We screened 650 patients with hypertension for PA. Forty-nine patients were diagnosed with PA and 195 with EH. Regarding drugs, 519 patients were taking angiotensin-converting enzyme inhibitors (ACEIs), angiotensin II receptor blockers (ARBs), calcium channel blockers (CCBs), or diuretics alone or in combination. Forty-one patients were taking beta-blockers. Ninety patients were taking beta-blockers in combination with other drugs. In patients treated with ACEIs, ARBs, CCBs, or diuretics alone, or in combination, or beta-blockers alone, PA positivity was determined using the criteria, aldosterone-to-renin ratio (ARR) >38 pg/mL/pg/mL and plasma aldosterone concentration (PAC) >100 pg/mL, and negativity, using the criteria, ARR <9 pg/mL/pg/mL; the sensitivity and specificity were 94.7% and 94.5%, respectively. After drug adjustment, the sensitivity and specificity of screening were 92.1% and 89%, respectively. CONCLUSIONS: In patients not treated with beta-blockers combined with others, when ARR >38 pg/mL/pg/mL and plasma aldosterone concentration (PAC) >100 pg/mL, or, ARR <9 pg/mL/pg/mL, non-drug-adjusted screening results were identical to with drug adjustment. Non-drug-adjusted screening could reduce the chance of medication adjustment, enable patients to continue their treatments and avoiding adverse effects, is of clinical importance.
Primary aldosteronism (PA) is the most common form of endocrine hypertension. The risk of stroke, myocardial infarction, heart failure, atrial fibrillation, and deterioration of kidney function is higher in PA than in essential hypertension (EH), even with the same blood pressure (BP) levels. However, many patients remain undiagnosed because most antihypertensive drugs substantially interfere with PA screening results, which makes drug adjustment necessary. This can be a time-consuming and unsafe process, requiring 46 weeks, and could lead to a hypertensive crisis and other complications. Some studies have suggested that certain antihypertensive drugs can be continued during PR screening. However, few studies have evaluated the performance of non-drug-adjusted PA screening. Therefore, in this prospective study, we aimed to compare patients with hypertension and a high risk of PA before and after drug adjustment and to use confirmatory test results as a reference to explore the diagnostic or exclusion effect. We found that non-drug-adjusted screening performs similarly to drug-adjusted screening in a particular group of patients. Our findings could aid in preventing unnecessary drug adjustment for PA screening, thereby reducing the risk in these patients.
Subject(s)
Aldosterone , Hyperaldosteronism , Humans , Hyperaldosteronism/diagnosis , Hyperaldosteronism/blood , Hyperaldosteronism/drug therapy , Female , Middle Aged , Male , Prospective Studies , Aldosterone/blood , Renin/blood , Adult , Calcium Channel Blockers/therapeutic use , Hypertension/drug therapy , Hypertension/blood , Hypertension/diagnosis , Antihypertensive Agents/therapeutic use , Angiotensin-Converting Enzyme Inhibitors/therapeutic use , Mass Screening/methods , Aged , Angiotensin Receptor Antagonists/therapeutic useABSTRACT
One of the critical technologies to ensure cyberspace security is network traffic anomaly detection, which detects malicious attacks by analyzing and identifying network traffic behavior. The rapid development of the network has led to explosive growth in network traffic, which seriously impacts the user's information security. Researchers have delved into intrusion detection as an active defense technology to address this challenge. However, traditional machine learning methods struggle to capture complex threats and attack patterns when dealing with large-scale network data. In contrast, deep learning methods have the advantages of automatically extracting features from network traffic data and strong generalization capabilities. Aiming to enhance the ability of network anomaly traffic detection, this paper proposes a network traffic anomaly detection based on Deep Residual Shrinkage Network (DRSN), namely "GSOOA-1DDRSN". This method uses an improved Osprey optimization algorithm to select the most relevant and essential features in network traffic, reducing the features' dimensionality. For better detection performance of network traffic anomalies, a one-dimensional deep residual shrinkage network (1DDRSN) is designed as a classifier. Validation is performed using the NSL-KDD and UNSW-NB15 datasets and compared with other methods. The experimental results show that GSOOA-1DDRSN has improved multi-classification accuracy, precision, recall, and F1 Score by approximately 2 % and 3 %, respectively, compared to the 1DDRSN model on two datasets. Additionally, it reduces the time computation costs by 20 % and 30 % on these datasets. Furthermore, compared to other models, GSOOA-1DDRSN offers superior classification accuracy and effectively reduces the number of features.
ABSTRACT
The Chromosome-Centric Human Proteome Project (C-HPP) aims to identify all proteins encoded by the human genome. Currently, the human proteome still contains approximately 2000 PE2-PE5 proteins, referring to annotated coding genes that lack sufficient protein-level evidence. During the past 10 years, it has been increasingly difficult to identify PE2-PE5 proteins in C-HPP approaches due to the limited occurrence. Therefore, we proposed that reanalyzing massive MS data sets in repository with newly developed algorithms may increase the occurrence of the peptides of these proteins. In this study, we downloaded 1000 MS data sets via the ProteomeXchange database. Using pFind software, we identified peptides referring to 1788 PE2-PE5 proteins. Among them, 11 PE2 and 16 PE5 proteins were identified with at least 2 peptides, and 12 of them were identified using 2 peptides in a single data set, following the criteria of the HPP guidelines. We found translation evidence for 16 of the 11 PE2 and 16 PE5 proteins in our RNC-seq data, supporting their existence. The properties of the PE2 and PE5 proteins were similar to those of the PE1 proteins. Our approach demonstrated that mining PE2 and PE5 proteins in massive data repository is still worthy, and multidata set peptide identifications may support the presence of PE2 and PE5 proteins or at least prompt additional studies for validation. Extremely high throughput could be a solution to finding more PE2 and PE5 proteins.
ABSTRACT
Humans have three different proliferating cell nuclear antigen (PCNA) clamp-loading complexes: RFC and CTF18-RFC load PCNA onto DNA, but ATAD5-RFC can only unload PCNA from DNA. The underlying structural basis of ATAD5-RFC unloading is unknown. We show here that ATAD5 has two unique locking loops that appear to tie the complex into a rigid structure, and together with a domain that plugs the DNA-binding chamber, prevent conformation changes required for DNA binding, likely explaining why ATAD5-RFC is exclusively a PCNA unloader. These features are conserved in the yeast PCNA unloader Elg1-RFC. We observe intermediates in which PCNA bound to ATAD5-RFC exists as a closed planar ring, a cracked spiral or a gapped spiral. Surprisingly, ATAD5-RFC can open a PCNA gap between PCNA protomers 2 and 3, different from the PCNA protomers 1 and 3 gap observed in all previously characterized clamp loaders.
ABSTRACT
DEAD-box helicase 17 (DDX17) is a typical member of the DEAD-box family with transcriptional cofactor activity. Although DDX17 is abundantly expressed in the myocardium, its role in heart is not fully understood. We generated cardiomyocyte-specific Ddx17-knockout mice (Ddx17-cKO), cardiomyocyte-specific Ddx17 transgenic mice (Ddx17-Tg), and various models of cardiomyocyte injury and heart failure (HF). DDX17 is downregulated in the myocardium of mouse models of heart failure and cardiomyocyte injury. Cardiomyocyte-specific knockout of Ddx17 promotes autophagic flux blockage and cardiomyocyte apoptosis, leading to progressive cardiac dysfunction, maladaptive remodeling and progression to heart failure. Restoration of DDX17 expression in cardiomyocytes protects cardiac function under pathological conditions. Further studies showed that DDX17 can bind to the transcriptional repressor B-cell lymphoma 6 (BCL6) and inhibit the expression of dynamin-related protein 1 (DRP1). When DDX17 expression is reduced, transcriptional repression of BCL6 is attenuated, leading to increased DRP1 expression and mitochondrial fission, which in turn leads to impaired mitochondrial homeostasis and heart failure. We also investigated the correlation of DDX17 expression with cardiac function and DRP1 expression in myocardial biopsy samples from patients with heart failure. These findings suggest that DDX17 protects cardiac function by promoting mitochondrial homeostasis through the BCL6-DRP1 pathway in heart failure.
Subject(s)
DEAD-box RNA Helicases , Heart Failure , Myocytes, Cardiac , Animals , Humans , Mice , Apoptosis/genetics , DEAD-box RNA Helicases/genetics , DEAD-box RNA Helicases/metabolism , Dynamins/genetics , Dynamins/metabolism , Heart Failure/genetics , Heart Failure/pathology , Heart Failure/metabolism , Homeostasis/genetics , Mice, Knockout , Mice, Transgenic , Mitochondria/genetics , Mitochondria/metabolism , Mitochondria/pathology , Mitochondrial Dynamics/genetics , Myocytes, Cardiac/metabolism , Myocytes, Cardiac/pathology , Proto-Oncogene Proteins c-bcl-6/genetics , Proto-Oncogene Proteins c-bcl-6/metabolismABSTRACT
OBJECTIVES: This study was designed to evaluate the association of four surrogate indexes of IR with NASH in patients with obesity. METHODS: A total of 270 patients who underwent bariatric surgery, were included in this cross-sectional study. NASH was diagnosed based on liver biopsies. Binary logistics regression analyses were performed to assess the associations of four surrogate indexes of IR (HOMA-IR, Matsuda index, TyG, and TG/HDL-C) with NASH in patients with obesity. The restricted cubic spline was used to assess the dose-response associations of surrogate indexes of IR with NASH after adjusting for confounding factors. RESULTS: NASH was diagnosed in 136 patients, with a prevalence of 50.37%. Compared with tertile 1, the fully adjusted ORs (95% CIs) of NASH for tertile 3 were 2.711(1.113-6.608) and 0.297 (0.152-0.579) for TyG and Matsuda index. Consistently, per SD increment of TyG were still significantly associated with 64% increased risks of NASH, and per SD increment of Matsuda index were still significantly associated with 38% decreased risks of NASH. In contrast, no significant associations were found between HOMA-IR and TG/HDL-C and the risk of NASH in patients with obesity (all P > 0.05). After adjusting covariates in restricted cubic splines, the risk of NASH decreased with the increment of Matsuda Index levels (P-nonlinear = 0.442, P-overall = 0.007) and with the decrement of TyG levels (P-nonlinear = 0.004, P-overall = 0.001). CONCLUSIONS: In patients with obesity, TyG and Matsuda index were independently related to the risk of NASH after adjustment for traditional risk factors. In addition, compared with HOMA-IR and TG/HDL-C, the Matsuda index and TyG may be more suitable for NASH prediction in patients with obesity.
ABSTRACT
INTRODUCTION: This study is to investigate the relation between serum dehydroepiandrosterone (DHEA) and its sulfate (DHEAS) levels and the risk of osteoporosis in patients with T2DM. MATERIALS AND METHODS: This cross-sectional study involved 938 hospitalized patients with T2DM. Linear regression models were used to explore the relationship between DHEA and DHEAS and the BMD at different skeletal sites. Multinominal logistic regression models and the restricted cubic spline (RCS) were used to evaluate the associations of DHEA and DHEAS with the risks of osteopenia and/or osteoporosis. RESULTS: In postmenopausal women with T2DM, after adjustment for confounders including testosterone and estradiol, DHEA showed a significant positive correlation with lumbar spine BMD (P = 0.013). Moreover, DHEAS exhibited significant positive correlations with BMD at three skeletal sites: including femoral neck, total hip, and lumbar spine (all P < 0.05). Low DHEA and DHEAS levels were associated with increased risk of osteopenia and/or osteoporosis (all P < 0.05) and the risk of osteoporosis gradually decreased with increasing DHEAS levels (P overall = 0.018, P-nonlinear = 0.559). However, DHEA and DHEAS levels in men over the age of 50 with T2DM were not associated with any of above outcomes. CONCLUSION: In patients with T2DM, independent of testosterone and estradiol, higher DHEA and DHEAS levels are associated with higher BMD and lower risk of osteopenia/osteoporosis in postmenopausal women but not men over the age of 50.
Subject(s)
Bone Density , Dehydroepiandrosterone , Diabetes Mellitus, Type 2 , Osteoporosis , Humans , Female , Diabetes Mellitus, Type 2/blood , Diabetes Mellitus, Type 2/complications , Osteoporosis/blood , Middle Aged , Male , Dehydroepiandrosterone/blood , Aged , Dehydroepiandrosterone Sulfate/blood , Cross-Sectional Studies , Sex Characteristics , Sulfates/bloodABSTRACT
As a natural low-calorie sweetener, Mogroside V (Mog-V) has gradually become one of the alternatives to sucrose with superior health attributes. However, Mog-V will bring unpleasant aftertastes when exceeding a threshold concentration. To investigate the possibility of soy protein isolates (SPIs), namely ß-conglycinin (7S), and glycinin (11S) as flavor-improving agents of Mog-V, the binding mechanism between Mog-V and SPIs was explored through multi-spectroscopy, particle size, zeta potential, and computational simulation. The results of the multi-spectroscopic experiments indicated that Mog-V enhanced the fluorescence of 7S/11S protein in a static mode. The binding affinity of 7S-Mog-V was greater compared with 11S-Mog-V. Particle size and zeta potential analysis revealed that the interaction could promote aggregation of 7S/11S protein with different stability. Furthermore, computational simulations further confirmed that Mog-V could interact with the 7S/11S protein in different ways. This research provides a theoretical foundation for the development and application of SPI to improve the flavor of Mog-V, opening a new avenue for further expanding the market demand for Mog-V.
Subject(s)
Soybean Proteins , Sweetening Agents , Soybean Proteins/chemistry , Soybean Proteins/metabolism , Sweetening Agents/chemistry , Sweetening Agents/metabolism , Globulins/chemistry , Globulins/metabolism , Protein Binding , Antigens, Plant/chemistry , Antigens, Plant/metabolism , Computer Simulation , Seed Storage Proteins/chemistry , Seed Storage Proteins/metabolism , Molecular Docking Simulation , TriterpenesABSTRACT
Solid electrolyte interphases (SEIs) are sought to protect high-capacity anodes, which suffer from severe volume changes and fast degradations. The previously proposed effective SEIs were of high strength yet abhesive, inducing a yolk-shell structure to decouple the rigid SEI from the anode for accommodating the volume change. Ambivalently, the interfacial void-evolved electro-chemo-mechanical vulnerabilities become inherent defects. Here, we establish a new rationale for SEIs that resilience and adhesivity are both requirements and pioneer a design of a resilient yet adhesive SEI (re-ad-SEI), integrated into a conjugated surface bilayer structure. The re-ad-SEI and its protected particles exhibit excellent stability almost free from the thickening of SEI and the particle pulverization during cycling. More promisingly, the dynamically bonded intact SEI-anode interfaces enable a high-efficiency ion transport and provide a unique mechanical confinement effect for structural integrity of anodes. The high Coulombic efficiency (>99.8%), excellent cycling stability (500 cycles), and superior rate performance have been demonstrated in microsized Si-based anodes.
ABSTRACT
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
ABSTRACT
Adverse perinatal factors can interfere with the normal development of the brain, potentially resulting in long-term effects on the comprehensive development of children. Presently, the understanding of cognitive and neurodevelopmental processes under conditions of adverse perinatal factors is substantially limited. There is a critical need for an open resource that integrates various perinatal factors with the development of the brain and mental health to facilitate a deeper understanding of these developmental trajectories. In this Data Descriptor, we introduce a multicenter database containing information on perinatal factors that can potentially influence children's brain-mind development, namely, periCBD, that combines neuroimaging and behavioural phenotypes with perinatal factors at county/region/central district hospitals. PeriCBD was designed to establish a platform for the investigation of individual differences in brain-mind development associated with perinatal factors among children aged 3-10 years. Ultimately, our goal is to help understand how different adverse perinatal factors specifically impact cognitive development and neurodevelopment. Herein, we provide a systematic overview of the data acquisition/cleaning/quality control/sharing, processes of periCBD.
Subject(s)
Brain , Child Development , Child , Child, Preschool , Humans , Brain/growth & development , Brain/diagnostic imaging , China , Cognition , Databases, Factual , NeuroimagingABSTRACT
This study aims to investigate the mechanism of platelet activation-induced thrombosis in patients with acute non-ST segment elevation myocardial infarction (NSTEMI) by detecting the expression of autophagy-associated proteins in platelets of patients with NSTEMI. A prospective study was conducted on 121 patients with NSTEMI who underwent emergency coronary angiography and optical coherence tomography. The participants were divided into two groups: the ST segment un-offset group (n = 64) and the ST segment depression group (n = 57). We selected a control group of 60 patients without AMI during the same period. The levels of autophagy-associated proteins and the expression of autophagy-associated proteins in platelets were measured using immunofluorescence staining and Western blot. In NSTEMI, the prevalence of red thrombus was higher in the ST segment un-offset myocardial infarction (STUMI) group, whereas white thrombus was more common in the ST segment depression myocardial infarction (STDMI) group. Furthermore, the platelet aggregation rate was significantly higher in the white thrombus group compared with the red thrombus group. Compared with the control group, the autophagy-related protein expression decreased, and the expression of αIIbß3 increased in NSTEMI. The overexpression of Beclin1 could activate platelet autophagy and inhibit the expression of αIIbß3. The results suggested that the increase in platelet aggregation rate in patients with NSTEMI may be potentially related to the change in autophagy. And the overexpression of Beclin1 could reduce the platelet aggregation rate by activating platelet autophagy. Our findings demonstrated that Beclin1 could be a potential therapeutic target for inhibiting platelet aggregation in NSTEMI.
Subject(s)
Autophagy , Beclin-1 , Blood Platelets , Non-ST Elevated Myocardial Infarction , Platelet Activation , Thrombosis , Humans , Beclin-1/metabolism , Male , Female , Non-ST Elevated Myocardial Infarction/blood , Middle Aged , Aged , Prospective Studies , Blood Platelets/metabolism , Thrombosis/blood , Thrombosis/metabolism , Coronary Angiography , Platelet Aggregation , Case-Control Studies , Tomography, Optical Coherence , Platelet Glycoprotein GPIIb-IIIa Complex/metabolismABSTRACT
Here we report a carbene-catalyzed enantio- and diastereoselective [4+2] cycloaddition reaction of cyclobutenones with isatins for the quick and efficient synthesis of spirocyclic δ-lactones bearing a chiral chlorine. A broad range of substrates with various substitution patterns proceed smoothly in this reaction, with the spirooxindole δ-lactone products afforded in generally good to excellent yields and optical purities under mild reaction conditions.
ABSTRACT
BACKGROUND: Paroxysmal kinesigenic dyskinesia (PKD) is the most prevalent kind type of paroxysmal Dyskinesia, characterized by recurrent and transient episodes of involuntary movements. Most PKD cases were attributed to the proline-rich transmembrane protein 2 (PRRT2) gene, in which the c.649 region is a hotspot for known mutations. Even though some patients with PKD have been genetically diagnosed using whole-exome sequencing (WES) and Sanger sequencing, there are still cases of missed diagnoses due to the limitations of sequencing technology and analytic methods on throughput. METHODS: Patients meeting the diagnosis criteria of PKD with negative results of PRRT2-Sanger sequencing and WES were included in this study. Mutation screening and targeted high-throughput sequencing were performed to analyze and verify the sequencing results of the potential mutations. RESULTS: Six patients with PKD with high mutation ratios of c.649dupC were screened using our targeted high-throughput sequencing from 26 PKD patients with negative results of PRRT2-Sanger sequencing and WES (frequency = 23.1%), which compensated for the comparatively shallow sequencing depth and statistical flaws in this region. Compared with the local normal population and other patients with PKD, the mutation ratios of c.649dupC of these six patients with PKD were much higher and also had truncated protein structures and differentially altered mRNA expression. CONCLUSION: Based on the above studies, we emphasize the routine targeted high-throughput sequencing of the c.649 site in the PRRT2 gene in so-called genetic-testing-negative patients with PKD, and manually calculate the deletion and duplication mutations depth and ratios to lower the rate of clinical misdiagnosis.
Subject(s)
Dystonia , Genetic Testing , Membrane Proteins , Nerve Tissue Proteins , Humans , Membrane Proteins/genetics , Nerve Tissue Proteins/genetics , Female , Male , Dystonia/genetics , Dystonia/diagnosis , Child , Adolescent , Genetic Testing/methods , Genetic Testing/standards , Adult , High-Throughput Nucleotide Sequencing/methods , Mutation , Child, Preschool , Exome Sequencing/methodsABSTRACT
In the original publication [...].
ABSTRACT
Nanoplastics, created by the fragmentation of larger plastic debris, are a serious pollutant posing substantial environmental and health risks. Here, we developed a polystyrene nanoparticle (PS-NP) exposure model during mice pregnancy to explore their effects on embryonic development. We found that exposure to 30 nm PS-NPs during pregnancy resulted in reduced mice placental weight and abnormal embryonic development. Subsequently, our transcriptomic dissection unveiled differential expression in 102 genes under PS-NP exposure and the p38 MAPK pathway emerged as being significantly altered in KEGG pathway mapping. Our findings also included a reduction in the thickness of the trophoblastic layer in the placenta, diminished cell invasion capabilities, and an over-abundance of immature red cells in the blood vessels of the mice. In addition, we validated our findings through the human trophoblastic cell line, HTR-8/SVneo (HTR). PS-NPs induced a drop in the vitality and migration capacities of HTR cells and suppressed the p38 MAPK signaling pathway. This research highlights the embryotoxic effects of nanoplastics on mice, while the verification results from the HTR cells suggest that there could also be certain impacts on the human trophoblast layer, indicating a need for further exploration in this area.
ABSTRACT
Contraction-expansion array (CEA) microchannel is a typical structure applied on particle/cell manipulation. The prediction of the particle focusing pattern in CEA microchannel is worthwhile to be investigate deeply. Here, we demonstrated a virtual boundary method by flow field analysis and theoretical derivation. The calculating method of the virtual boundary location, related to the Reynolds number (Re) and the structure parameter RW, was proposed. Combining the approximate Poiseuille flow pattern based on the virtual boundary method with the simulation results of Dean flow, the main line pattern and the main/lateral lines pattern were predicted and validated in experiments. The transformation from the main line pattern to the main/lateral lines pattern can be facilitated by increasing Re, decreasing RW , and decreasing α. An empirical formula was derived to characterize the critical condition of the transformation. The virtual boundary method can provide a guidance for asymmetric CEA channel design and contribute to the widespread application of microfluidic particle focusing.