An influenza A virus vaccine based on an M2e-modified alphavirus.

The 23-residue external domain of the influenza A virus M2 protein (M2e) has significant potential as a vaccine antigen. Here, we describe the construction and characterization of an M2e-modified Sindbis virus designated E2S1-M2e. E2S1-M2e virions contain M2e as an N-terminal extension of the E2 glycoprotein and therefore express 240 copies of the M2e peptide on their surface. The E2S1-M2e virus expressed M2e in an accessible and immunogenic form and induced M2e-specific antibodies when administered to mice. Mice that received an intranasal vaccination with E2S1-M2e were protected against a lethal challenge with a virulent, mouse-adapted strain of influenza A virus.

Enhancement of vaccine efficacy by expression of a TLR5 ligand in the defined live attenuated Francisella tularensis subsp. novicida strain U112ΔiglB::fljB.

Oral vaccination with the defined live attenuated Francisella novicida vaccine strain U112ΔiglB has been demonstrated to induce protective immunity against pulmonary challenge with the highly human virulent Francisella tularensis strain SCHU S4. However, this vaccination regimen requires a booster dose in mice and Exhibits 50% protective efficacy in the Fischer 344 rat model. To enhance the efficacy of this vaccine strain, we engineered U112ΔiglB to express the Salmonella typhimurium FljB flagellin D1 domain, a TLR5 agonist. The U112ΔiglB::fljB strain was highly attenuated for intracellular macrophage replication, and although the FljB protein was expressed within the cytosol, it exhibited TLR5 activation in a TLR5-expressing HEK cell line. Additionally, infection of splenocytes and lymphocytes with U112ΔiglB::fljB induced significantly greater TNF-α production than infection with U112ΔiglB. Oral vaccination with U112ΔiglB::fljB also induced significantly greater protection than U112ΔiglB against pulmonary SCHU S4 challenge in rats. The enhanced protection was accompanied by higher IgG2a production and serum-mediated reduction of Francisella infectivity. Thus, the U112ΔiglB::fljB strain may serve as a potential vaccine candidate against pneumonic tularemia.

An arthropod enzyme, Dfurin1, and a vertebrate furin homolog display distinct cleavage site sequence preferences for a shared viral proprotein substrate.

Alphaviruses replicate in vertebrate and arthropod cells and utilize a cellular enzyme called furin to process the PE2 glycoprotein precursor during virus replication in both cell types. Furin cleaves PE2 at a site immediately following a highly conserved four residue cleavage signal. Prior studies demonstrated that the amino acid immediately adjacent to the cleavage site influenced PE2 cleavage differently in vertebrate and mosquito cells (HW Heidner et al. 1996 . Journal of Virology 70: 2069-2073.). This finding was tentatively attributed to potential differences in the substrate specificities of the vertebrate and arthropod furin enzymes or to differences in the carbohydrate processing phenotypes of arthropod and vertebrate cells. To further address this issue, we evaluated Sindbis virus replication and PE2 cleavage in the Chinese hamster, Cricetulus griseus Milne-Edwards (Rodentia: Cricetidae) ovary cells (CHO-K1) and in a CHO-K1-derived furin-negative cell line (RPE.40) engineered to stably express the Dfurin1 enzyme of Drosophila melanogaster Meigen (Diptera: Drosophilidae). Expression of Dfurin1 enhanced Sindbis virus titers in RPE.40 cells by a factor of 10(2)-10(3), and this increase correlated with efficient cleavage of PE2. The PE2-cleavage phenotypes of viruses containing different amino acid substitutions adjacent to the furin cleavage site were compared in mosquito (C6/36), CHO-K1, and Dfurin1-expressing RPE.40 cells. This analysis confirmed that the substrate specificities of Dfurin1 and the putative mosquito furin homolog present in C6/36 cells are similar and suggested that the alternative PE2 cleavage phenotypes observed in vertebrate and arthropod cells were due to differences in substrate specificity between the arthropod and vertebrate furin enzymes and not to differences in host cell glycoprotein processing pathways.

Recombinant Sindbis virus vectors designed to express protective antigen of Bacillus anthracis protect animals from anthrax and display synergy with ciprofloxacin.

Recombinant Sindbis viruses were engineered to express alternative forms of the protective antigen (PA) of Bacillus anthracis. The recombinant viruses induced PA-specific immunoglobulin G and neutralizing antibodies in Swiss Webster mice. Vaccination with the recombinant viruses induced immunity that offered some protection from a lethal Ames strain spore challenge and synergized the protective effects of ciprofloxacin.

Development and characterization of an infectious cDNA clone of the virulent Bucyrus strain of Equine arteritis virus.

Strains of Equine arteritis virus (EAV) differ in the severity of the disease that they induce in horses. Infectious cDNA clones are potentially useful for identification of genetic determinants of EAV virulence; to date, two clones have been derived from a cell culture-adapted variant of the original (Bucyrus) isolate of EAV, and it has previously been shown that recombinant virus derived from one of these (rEAV030) is attenuated in horses. A complete cDNA copy of the genome of the virulent Bucyrus strain of EAV has now been assembled into a plasmid vector. In contrast to rEAV030, recombinant progeny virus derived from this clone caused severe disease in horses, characterized by pyrexia, oedema, leukopenia, high-titre viraemia and substantial nasal shedding of virus. The availability of infectious cDNA clones that produce recombinant viruses of different virulence to horses will facilitate characterization of the virulence determinants of EAV through reverse genetics.

Targeting Sindbis virus-based vectors to Fc receptor-positive cell types.

Some viruses display enhanced infection for Fc receptor (FcR)-positive cell types when complexed with virus-specific immunoglobulin (Ig). This process has been termed antibody-dependent enhancement of viral infection (ADE). We reasoned that the mechanism of ADE could be exploited and adapted to target alphavirus-based vectors to FcR-positive cell types. Towards this goal, recombinant Sindbis viruses were constructed that express 1 to 4 immunoglobulin-binding domains of protein L (PpL) as N-terminal extensions of the E2 glycoprotein. PpL is a bacterial protein that binds the variable region of antibody kappa light chains from a range of mammalian species. The recombinant viruses incorporated PpL/E2 fusion proteins into the virion structure and recapitulated the species-specific Ig-binding phenotypes of native PpL. Virions reacted with non-immune serum or purified IgG displayed enhanced binding and ADE for several species-matched FcR-positive murine and human cell lines. ADE required virus expression of a functional PpL Ig-binding domain, and appeared to be FcgammaR-mediated. Specifically, ADE did not occur with FcgammaR-negative cells, did not require active complement proteins, and did not occur on FcgammaR-positive murine cell lines when virions were bound by murine IgG-derived F(ab')2 fragments.

Characterization of the neutralization determinants of equine arteritis virus using recombinant chimeric viruses and site-specific mutagenesis of an infectious cDNA clone.

We have used an infectious cDNA clone of equine arteritis virus (EAV) and reverse genetics technology to further characterize the neutralization determinants in the GP5 envelope glycoprotein of the virus. We generated a panel of 20 recombinant viruses, including 10 chimeric viruses that each contained the ORF5 (which encodes GP5) of different laboratory, field, and vaccine strains of EAV, a chimeric virus containing the N-terminal ectodomain of GP5 of a European strain of porcine reproductive and respiratory syndrome virus, and 9 mutant viruses with site-specific substitutions in their GP5 proteins. The neutralization phenotype of each recombinant chimeric/mutant strain of EAV was determined with EAV-specific monoclonal antibodies and EAV strain-specific polyclonal equine antisera and compared to that of their parental viruses from which the substituted ORF5 was derived. The data unequivocally confirm that the GP5 ectodomain contains critical determinants of EAV neutralization. Furthermore, individual neutralization sites are conformationally interactive, and the interaction of GP5 with the unglycosylated membrane protein M is likely critical to expression of individual epitopes in neutralizing conformation. Substitution of individual amino acids within the GP5 ectodomain usually resulted in differences in neutralization phenotype of the recombinant viruses, analogous to differences in the neutralization phenotype of field strains of EAV and variants generated during persistent infection of EAV carrier stallions.

Palindromes in SARS and Other Coronaviruses.

With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Sindbis virus vectors designed to express a foreign protein as a cleavable component of the viral structural polyprotein.

Alphavirus-based expression vectors commonly use a duplicated 26S promoter to drive expression of a foreign gene. Here we describe an expression strategy in which the foreign sequences are linked to the gene encoding the 2A protease of foot-and-mouth disease virus and then inserted in frame between the capsid and E3 genes of Sindbis virus. During replication, the 2A fusion protein is synthesized as a component of the viral structural polyprotein that is then released by intramolecular cleavages mediated by the capsid and 2A proteases. Recombinant Sindbis viruses that expressed fusion proteins composed of 2A linked to the green fluorescent protein (GFP) and to the VP7 protein of bluetongue virus were constructed. Viruses engineered to express GFP and VP7 from a duplicate 26S promoter were also constructed. All four viruses expressed the transgene and grew to similar titers in cultured cells. However, the GFP/2A- and VP7/2A-expressing viruses displayed greater expression stability and were less attenuated in newborn mice than the cognate double-subgenomic promoter-based viruses. By combining the two expression strategies, we constructed bivalent viruses that incorporated and expressed both transgenes. The bivalent viruses grew to lower titers in cultured cells and were essentially avirulent in newborn mice. Groups of mice were vaccinated with each VP7- and VP7/2A-expressing virus, and antibody responses to native VP7 were measured in an indirect enzyme-linked immunosorbent assay. Despite their genetic and phenotypic differences, all viruses induced similarly high titers of VP7-specific antibodies. These results demonstrate that 2A fusion protein-expressing alphaviruses may be particularly well suited for applications that require enduring expression of a single protein or coexpression of two alternative proteins.

Alphavirus replicon particles expressing the two major envelope proteins of equine arteritis virus induce high level protection against challenge with virulent virus in vaccinated horses.

Replicon particles derived from a vaccine strain of Venezuelan equine encephalitis (VEE) virus were used as vectors for expression in vivo of the major envelope proteins (G(L) and M) of equine arteritis virus (EAV), both individually and in heterodimer form (G(L)/M). The immunogenicity of the different replicons was evaluated in horses, as was their ability to protectively immunize horses against intranasal and intrauterine challenge with a virulent strain of EAV (EAV KY84). Horses immunized with replicons that express both the G(L) and M proteins in heterodimer form developed neutralizing antibodies to EAV, shed little or no virus, and developed only mild or inapparent signs of equine viral arteritis (EVA) after challenge with EAV KY84. In contrast, unvaccinated horses and those immunized with replicons expressing individual EAV envelope proteins (M or G(L)) shed virus for 6-10 days in their nasal secretions and developed severe signs of EVA after challenge. These data confirm that replicons that co-express the G(L) and M envelope proteins effectively, induce EAV neutralizing antibodies and protective immunity in horses.