Compressive stress effect on the loss mechanism in a soft piezoelectric Pb(Zr,Ti)O3.

High power piezoelectric devices are often subjected to external mechanical biases, in applications such as underwater transducers. While the performance of these devices under external pressure has been rather extensively studied, there is a lack of study on the loss mechanism in terms of three dielectric, elastic, and piezoelectric losses. Thus, in this paper, we study the mechanical bias stress dependence of the loss mechanism in a soft piezoelectric Pb(Zr,Ti)O3 (PZT) from a scientific viewpoint, using an equivalent circuit methodology based on the fundamental longitudinal mode. In order to measure the loss behavior, a modified bolt-clamped Langevin transducer was designed and optimized using finite element analysis in order to facilitate the analysis easier. We present the preliminary experimental part of our project on the design of the proposed structure/methodology, material creep behavior, stress relaxation, and uniform stress distribution, in order to minimize the experimental errors. We also introduce a six terminal equivalent circuit analysis in order to determine three losses in the PZT specimen. The resonance/antiresonance frequencies and quality factors showed monotonous increase under compressive stress. Loss factors for one PZT composition are reported in this paper to show the feasibility of our methodology for measuring the uniaxial compressive stress dependence.

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Enhanced somatosensory information decreases postural sway in older people.

The somatosensory system plays an important role in balance control and age-related declines in somatosensory function have been implicated in falls incidence. Different types of insole devices have been developed to enhance somatosensory information and improve postural stability. However, they are often too complex and expensive to integrate into daily life and textured insole surfaces may provide an inexpensive and accessible means to enhance somatosensory input. This study investigated the effects of textured insole surfaces on postural sway in ten younger and seven older participants performing standing balance tests on a force plate under three insole surface conditions: (1) barefoot; (2) with hard; and (3), soft textured insole surfaces. With each insole surface, participants were tested under two vision conditions (eyes open, closed) on two standing surfaces (firm, foam). Four 30s trials were collected for different combinations of insole surface, standing surface and vision. Centre of pressure measurements included the range and standard deviation of anterior-posterior and medial-lateral displacement, path length and the 90% confidence elliptical area. Results revealed a significant Group*Surface*Insole interaction for five of the dependent variables. Compared to younger individuals, postural sway was greater in older people on both standing surfaces in the barefoot condition. However, both textured insole surfaces reduced postural sway for the older group especially in the eyes closed condition on a foam surface. These findings suggest that textured insole surfaces can reduce postural sway in older people, particularly during more challenging balance tasks. Textured insole surfaces may afford a low-cost means of decreasing postural sway, providing an important intervention in falls prevention.

Role of ankle mobility in foot rollover during gait in individuals with diabetic neuropathy.

BACKGROUND: The purpose of this study was to investigate the ankle range of motion during neuropathic gait and its influence on plantar pressure distribution in two phases during stance: at heel-strike and at push-off. METHODS: Thirty-one adults participated in this study (control group, n=16; diabetic neuropathic group, n=15). Dynamic ankle range of motion (electrogoniometer) and plantar pressures (PEDAR-X system) were acquired synchronously during walking. Plantar pressures were evaluated at rearfoot, midfoot and forefoot during the two phases of stance. General linear model repeated measures analysis of variance was applied to investigate relationships between groups, areas and stance phases. FINDINGS: Diabetic neuropathy patients walked using a smaller ankle range of motion in stance phase and smaller ankle flexion at heel-strike (P=0.0005). Peak pressure and pressure-time integral values were higher in the diabetic group in the midfoot at push-off phase when compared to heel-strike phase. On the other hand, the control group showed similar values of peak pressure in midfoot during both stance phases. INTERPRETATION: The ankle mobility reduction observed could be associated to altered plantar pressure distribution observed in neuropathic subjects. Results demonstrated that midfoot and forefoot play a different role in subjects with neuropathy by receiving higher loads at push-off phase that are probably due to smaller ankle flexion at stance phase. This may explain the higher loads in anterior areas of the foot observed in diabetic neuropathy subjects and confirm an inadequate foot rollover associated to the smaller ankle range of motion at the heel-strike phase.

Musculoskeletal disorders associated with obesity: a biomechanical perspective.

Despite the multifactorial nature of musculoskeletal disease, obesity consistently emerges as a key and potentially modifiable risk factor in the onset and progression of musculoskeletal conditions of the hip, knee, ankle, foot and shoulder. To date, the majority of research has focused on the impact of obesity on bone and joint disorders, such as the risk of fracture and osteoarthritis. However, emerging evidence indicates that obesity may also have a profound effect on soft-tissue structures, such as tendon, fascia and cartilage. Although the mechanism remains unclear, the functional and structural limitations imposed by the additional loading of the locomotor system in obesity have been almost universally accepted to produce aberrant mechanics during locomotor tasks, thereby unduly raising stress within connective-tissue structures and the potential for musculoskeletal injury. While such mechanical theories abound, there is surprisingly little scientific evidence directly linking musculoskeletal injury to altered biomechanics in the obese. For the most part, even the biomechanical effects of obesity on the locomotor system remain unknown. Given the global increase in obesity and the rapid rise in musculoskeletal disorders, there is a need to determine the physical consequences of continued repetitive loading of major structures of the locomotor system in the obese and to establish how obesity may interact with other factors to potentially increase the risk of musculoskeletal disease.

The impact of childhood obesity on musculoskeletal form.

Despite the greater prevalence of musculoskeletal disorders in obese adults, the consequences of childhood obesity on the development and function of the musculoskeletal system have received comparatively little attention within the literature. Of the limited number of studies performed to date, the majority have focused on the impact of childhood obesity on skeletal structure and alignment, and to a lesser extent its influence on clinical tests of motor performance including muscular strength, balance and locomotion. Although collectively these studies imply that the functional and structural limitations imposed by obesity may result in aberrant lower limb mechanics and the potential for musculoskeletal injury, empirical verification is currently lacking. The delineation of the effects of childhood obesity on musculoskeletal structure in terms of mass, adiposity, anthropometry, metabolic effects and physical inactivity, or their combination, has not been established. More specifically, there is a lack of research regarding the effect of childhood obesity on the properties of connective tissue structures, such as tendons and ligaments. Given the global increase in childhood obesity, there is a need to ascertain the consequences of persistent obesity on musculoskeletal structure and function. A better understanding of the implications of childhood obesity on the development and function of the musculoskeletal system would assist in the provision of more meaningful support in the prevention, treatment and management of the musculoskeletal consequences of the condition.

Editing of hnRNP K protein mRNA in colorectal adenocarcinoma and surrounding mucosa.

The heterogeneous nuclear ribonucleoprotein K (hnRNP K) protein is an RNA-binding protein involved in many processes that compose gene expression. K protein is upregulated in the malignant processes and has been shown to modulate the expression of genes involved in mitogenic responses and tumorigenesis. To explore the possibility that there are alternative isoforms of K protein expressed in colon cancer, we amplified and sequenced K protein mRNA that was isolated from colorectal cancers as well as from normal tissues surrounding the tumours. Sequencing revealed a single G-to-A base substitution at position 274 that was found in tumours and surrounding mucosa, but not in individuals that had no colorectal tumour. This substitution most likely reflects an RNA editing event because it was not found in the corresponding genomic DNAs. Sequencing of RNA from normal colonic mucosa of patients with prior resection of colorectal cancer revealed only the wild-type K protein transcript, indicating that G274A isoform is tumour related. To our knowledge, this is the first example of an RNA editing event in cancer and its surrounding tissue, a finding that may offer a new diagnostic and treatment marker.

The biomechanics of restricted movement in adult obesity.

In spite of significant advances in the knowledge and understanding of the multi-factorial nature of obesity, many questions regarding the specific consequences of the disease remain unanswered. In particular, there is a relative dearth of information pertaining to the functional limitations imposed by overweight and obesity. The limited number of studies to date have mainly focused on the effect of obesity on the temporospatial characteristics of walking, plantar foot pressures, muscular strength and, to a lesser extent, postural balance. Collectively, these studies have implied that the functional limitations imposed by the additional loading of the locomotor system in obesity result in aberrant mechanics and the potential for musculoskeletal injury. Despite the greater prevalence of musculoskeletal disorders in the obese, there has been surprisingly little empirical investigation pertaining to the biomechanics of activities of daily living or into the mechanical and neuromuscular factors that may predispose the obese to injury. A better appreciation of the implications of increased levels of body adiposity on the movement capabilities of the obese would afford a greater opportunity to provide meaningful support in preventing, treating and managing the condition and its sequelae. Moreover, there is an urgent need to establish the physical consequences of continued repetitive loading of major structures of the body, particularly of the lower limbs in the obese, during the diverse range of activities of daily living.

[Experiences and difficulties in implementing immunization registries in Saxony-Anhalt]. / Erfahrungen und Schwierigkeiten bei der Implementierung von Impfregistern in Sachsen-Anhalt.

In the German Federal State of Saxony-Anhalt, the Health Department must be notified of vaccines administered to children <7 years of age including their names. The goal of this mandatory notification is to improve and stabilize the age-appropriate vaccination coverage. However, difficulties have been encountered in implementing mandatory notification. Therefore, the Health Departments of Magdeburg and Halle have launched a model project focusing on analysing and eliminating these problems. Mandatory notification requires parents' approval, endorsement of vaccantors, and availability of human and technicely resources in the Health Department. An enquiry among paediatricians and family doctors in private practice revealed widespread reservations about mandatory notification because of privacy issues related to data and legal protection. Furthermore, family doctors believed that parents disapproved of notification by name. However, a survey among young mothers revealed this not to be the case. Winning young mothers' approval depends largely on the positive attitude of the vaccinators. To implement the mandatory notification of vaccinations to the Health Department, it is necessary to dispel physicians' concerns and to inform young parents about the practical benefits. However, this places high demands on the Health Departments for maintaining immunization registries, communicating with physicians and notifying parents when immunisations are due or late.

FISH for BCR-ABL on interphases of peripheral blood neutrophils but not of unselected white cells correlates with bone marrow cytogenetics in CML patients treated with imatinib.

Interphase fluorescence in situ hybridization (I-FISH) for the BCR-ABL translocation performed on peripheral blood (PB) white cells has been suggested as a surrogate for conventional bone marrow (BM) cytogenetics for monitoring patients with chronic myeloid leukemia (CML). I-FISH is faster, less costly, and does not require BM aspiration. For patients treated with interferon-alpha (IFN), a good correlation between the two methods has been demonstrated in several though not all studies. However, imatinib mesylate (STI571) has largely replaced IFN as the standard drug treatment for CML, raising the question if the results obtained in IFN-treated patients are applicable to patients on imatinib. We therefore compared the two methods in patients on imatinib and patients on other therapies, mainly IFN (collectively referred to as nonimatinib therapies). Our results demonstrate that the correlation between I-FISH and cytogenetics is much weaker in patients on imatinib than in patients on nonimatinib therapies. Correction of the I-FISH values for the proportion of lymphocytes barely improved the correlation, probably as a result of unpredictable proportions of Philadelphia-positive B cells. By contrast, I-FISH of PB neutrophils was much better correlated with BM cytogenetics. We conclude that I-FISH on unselected PB white cells is not suitable for monitoring patients on imatinib.

The biomechanics of adiposity--structural and functional limitations of obesity and implications for movement.

Obesity is a significant health problem and the incidence of the condition is increasing at an alarming rate worldwide. Despite significant advances in the knowledge and understanding of the multifactorial nature of the condition, many questions regarding the specific consequences of the disease remain unanswered. For example, there is a dearth of information pertaining to the structural and functional limitations imposed by overweight and obesity. A limited number of studies to date have considered plantar pressures under the feet of obese vs. non-obese, the influence of foot structure on performance, gait characteristics of obese children and adults, and relationships between obesity and osteoarthritis. A better appreciation of the implications of increased levels of body weight and/or body fat on movement capabilities of the obese would provide an enhanced opportunity to offer more meaningful support in the prevention, treatment and management of the condition.

Plantar pressure differences between obese and non-obese adults: a biomechanical analysis.

OBJECTIVE: To investigate plantar pressure differences between obese and non-obese adults during standing and walking protocols using a pressure distribution platform. SUBJECTS: Thirty-five males (age 42.4+/-10.8 y; 67-179 kg) and 35 females (age 40.0+/-12.6 y; 46-150 kg) divided into obese (body mass index (BMI) 38.75+/-5.97 kg/m2) and non-obese (BMI 24.28+/-3.00 kg/m2) sub-groups, respectively. MEASUREMENTS: Data collection was performed with a capacitive pressure distribution platform with a resolution of 2 sensors/cm2 (Emed F01, Novel GmbH, München). The measurement protocol included half and full body weight standing on the left, right and both feet, respectively, and walking across the platform, striking with the right foot. Pressures were evaluated for eight anatomical sites under the feet. RESULTS: For both men and women, the mean pressure values of the obese were higher under all anatomical landmarks during half body weight standing. Significant increases in pressure were found under the heel, mid-foot and metatarsal heads II and IV for men and III and IV for women. Foot width during standing was also significantly increased in obese subjects. For walking, significantly higher peak pressures were also found in both obese males and females. CONCLUSION: Compared to a non-obese group, obese subjects showed increased forefoot width and higher plantar pressures during standing and walking. The greatest effect of body weight on higher peak pressures in the obese was found under the longitudinal arch of the foot and under the metatarsal heads. The higher pressures for obese women compared to obese men during static weight bearing (standing) may be the result of reduced strength of the ligaments of the foot.

RACK1 protein interacts with Helicobacter pylori VacA cytotoxin: the yeast two-hybrid approach.

The VacA toxin is the major virulence factor of Helicobacter pylori. The studies on VacA intracellular expression suggest that it interacts with cytosolic proteins and that this interaction contributes significantly to vacuolization. The aim of this study was to identify the host protein(s) that interacts with the VacA protein. We used the fragments of VacA protein fused with GAL4-BD as the baits in the yeast two-hybrid approach. The yeast transformed with plasmids encoding bait proteins were screened with human gastric mucosa cDNA library, encoded C-terminal fusion proteins with GAL4-AD. Three independent His-beta-Gal-positive clones were identified in VacA-b1 screen; they matched two different lengths of cDNA encoding RACK1 protein. The specific activity of beta-galactosidase found in the yeast expressing both VacA-b1 and RACK1 fusion proteins was 12-19 times higher compared to all negative controls used. VacA is capable of binding the RACK1 in vitro as was confirmed by the pull-down assay with GST fusion VacA protein and [(35)S]Met-labeled RACK1 protein fragments.

Heel to toe motion characteristics in Parkinson patients during free walking.

OBJECTIVE: Plantar pressures of Parkinson patients in a mild or moderate stage of the disease were analyzed in order to determine characteristics of the heel to toe motion of the foot in Parkinson patients during free walking. DESIGN: Pressure sensitive insoles were used to quantify the in-shoe pressure distribution for 24 patients with Parkinson's disease and for 24 age-matched healthy adults. Peak plantar pressures, relative loads and the variability of relative loads were analyzed for 10 different anatomical foot areas. Inferential statistics and regression analyses were performed to compare subject groups and to relate pressure data to a clinical score (Webster). BACKGROUND: It is well-known that Parkinson patients experience disorders of balance, posture and gait. Recent studies revealed that Parkinson patients show abnormalities in foot strike during walking. However, only little is known about the heel to toe motion of the foot in Parkinson patients in compensating for instability during walking. RESULTS: Parkinson patients show significant changes in foot loading behavior. Parkinson patients have a reduced impact at heel strike. This mechanism was found to be related to the severity of the disease. Furthermore, Parkinson patients show a trend towards higher relative loads in the forefoot regions combined with a load shift towards medial foot areas. These mechanisms are highly stereotypical. CONCLUSION: Parkinson patients, even in a mild or moderate stage of the disease, show significant changes in heel to toe motion of the foot during free walking. The characteristics of Parkinsonian gait are probably caused by adaptive mechanisms of the patients to avoid unsteadiness during walking. RELEVANCE: The results of this study revealed that Parkinson patients have characteristic heel to toe motion pattern. The determination of the foot-loading pattern using plantar pressure measurement may be used as a valuable tool for diagnostic, treatment and rehabilitation purposes. Furthermore, the strategy of the forefoot control in gait of Parkinson patients should be considered in Parkinsonian research.

Mutations, methylation and expression of CDKN2a/p16 gene in colorectal cancer and normal colonic mucosa.

The status of CDKN2a gene, coding for p16 and p19ARF proteins, was examined in 55 colorectal cancers. Polymerase chain reaction (PCR), single stranded conformational polymorphism and sequencing revealed 1 case of CDKN2a mutation. Methylation-specific PCR detected p16 locus methylation in 37 (73%) of 51 normal samples and 29 (53%) of 55 cancers (P=0.035). p16 transcript absence (assessed by reverse transcription-polymerase chain reaction) was noted in 10 (45%) of 22 normal samples and four (14%) of 29 cancers (P=0.012) and correlated with gene methylation (P=0.036). The decreasing frequency of p16 silencing in cancer comparing to normal mucosa does not support the postulated role of p16 in colorectal carcinogenesis.

Pressure distribution measurements for evaluation of running shoe properties.

The loading of individual foot structures which may play an important role in the occurrence of overuse injuries can be determined by using pressure distribution devices. In-shoe pressure measurements are of special interest as they provide information about the changes in foot to ground interactions with footwear modifications. Several studies have investigated the magnitudes of plantar in-shoe pressures at different running velocities. The first ray of the foot, composed of first metatarsus and hallux, was identified as one of the main load bearing structures during the push-off phase. Low correlations were found for the relationships of plantar pressures to ground reaction force or shock related variables. Pressure measurements provide a unique insight into the interaction between the human body, footwear and the ground. Substantial differences can be found in the peak pressure and relative load patterns due to different shoe constructions. It was also shown that plantar pressure measurement can be employed to identify changes of footwear properties with use. Although in-shoe pressure data offer detailed information about the loading behavior of the foot in various activities, at present conclusions for medical implications are still speculative.

Measurements of rearfoot motion during running.

Excessive rearfoot motion is an important factor that has been linked to the development of injuries in running. Therefore, extensive research has been performed that to investigate the movement of the foot and factors that influence the degree of rearfoot motion. Several methodological procedures are available that indirectly determine the degree of rearfoot movement. High-speed film, high-speed video and opto-electric techniques have been used to analyse the posterior aspect of the heel counter of the shoe in the frontal plane to determine rearfoot motion at ground contact on a treadmill or during overground running. Recent studies used invasive pin methods to determine rearfoot motion during running under different conditions. Using a non-invasive approach, electrogoniometers have been used to quantify rearfoot motion. The purpose of this study was to explore the use of an in-shoe electrogoniometric method to investigate rearfoot motion during running in different running shoes. The results showed that rearfoot motion variables were lower using the in-shoe goniometer compared to a heel counter method. This confirms previous bone pin studies where significant lower eversion and eversion velocity values were revealed by the bone pins compared to the shoe counter markers. Thus, external measurements seem to overestimate rearfoot motion significantly. On the other hand, the in-shoe measurements revealed slightly lower GRF related values. As with any other shoe insert, an in-shoe device elevates the foot slightly and thus may influence the mechanical behaviour of the shoe.

Treatment of mice with EGF and orthovanadate activates cytoplasmic and nuclear MAPK, p70S6k, and p90rsk in the liver.

BACKGROUND/AIMS: Although signal transduction pathways activated by EGF have been extensively studied in cultured cells, few such studies have been done in whole animals. In this study, activation of hepatic kinases, phosphatases, and DNA-binding activity of AP-1 was examined after intraperitoneal injections of either EGF or sodium orthovanadate into mice. METHODS: Cytoplasmic and nuclear proteins, extracted from isolated hepatocytes or whole liver tissue, were immunoprecipitated with either anti-ERK1/2, anti-70S6k, or anti-p90rsk antibodies and kinase activities were measured using specific substrates. Kinase protein levels was evaluated by Western blot analysis. AP-1 DNA binding activity was measured by electrophoretic mobility shift assay. RESULTS: Systemic administration of EGF induced simultaneous increase in the activities of cytoplasmic and nuclear MAPK, p70S6k, and p90rsk. MAPK and p70S6k were more potently activated in the cytosol while p90rsk activation was more pronounced in the nucleus. Orthovanadate also activated these kinases but to a much lesser degree than EGF. In vitro phosphatase assays showed that neither EGF nor orthovanadate induced measurable changes in phosphatase activities. EGF, but not orthovanadate, activated nuclear AP-1 DNA-binding activity in intact liver, indicating that activation of MAPK, p70S6k, and p90rsk by orthovanadate is not sufficient to activate this transcription factor. CONCLUSION: These observations provide groundwork for future studies to examine the role of EGF-induced kinase cascades and transcription factors in liver regeneration and other growth factor-mediated hepatic processes.