Chromatin structure of the simian virus 40 late promoter: a deletional analysis.

The goal of this study was to determine the minimal sequence within the simian virus 40 (SV40) late promoter region, nucleotides (nt) 255 to 424, capable of phasing nucleosomes as measured by its ability to confer the greatest endonuclease sensitivity on adjacent DNA sequences. To identify the minimal sequence, a deletional analysis of the late region was performed by utilizing a SV40 recombinant reporter system. The reporter system consisted of a series of unique restriction sites introduced into SV40 at nt 2666. The unique restriction sites allowed the insertion of test sequences as well as measurement of conferred endonuclease sensitivity. The results of the deletional analysis demonstrated that constructs capable of conferring the greatest nuclease sensitivities consistently included nt 255 to 280. The activator protein 4 (AP-4) and GTIIC transcription factor binding sequences lie within this region and were analyzed individually. Their abilities to confer nuclease sensitivity upon the reporter nearly matched that of the entire late domain. These results suggest that transcription factors AP-4 and transcription-enhancing factor which binds the GTIIC sequence are able to confer significant levels of nuclease sensitivity and are likely involved in the formation of the SV40 nucleosome-free region.

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.

Sister chromatid exchange in children of Seventh-Day Adventists and matched controls.

The low risk of cancer in Seventh-Day Adventists (SDAs) has been suggested to be due to genetic selection. To investigate this claim we examined the sister chromatid exchange (SCE) frequency in peripheral blood lymphocytes in 16 SDA children in Tromsø, all aged 0.5-8 years and 16 controls matched for sex and age. In 12 of 16 pairs, the SDA children had a lower SCE frequency than the controls. The mean difference was 4.06 (95% confidence interval -17.02-8.89, P = 0.51). There was no sex difference, and no correlation between age and SCE frequency. The genetic starting point with regard to SCE frequency seems to be the same for SDA children and controls.

[Prescription of psychopharmaceuticals. A survey of drug treatment at 10 psychiatric hospitals]. / Forskrivning av psykofarmaka. En oversikt over medikamentell behandling i ti psykiatriske sykehus.

This study describes a survey of the drugs prescribed to long-term psychiatric patients and psychogeriatric patients in ten Norwegian psychiatric hospitals. Of 1,124 patients, 12% received no psychotropic drugs and 14% were given a combination of more than three psychotropic drugs. Of 872 patients given neuroleptics, 81% received antipsychotic medication with low-dose neuroleptics and 27% received depot-neuroleptics. Hypnotics and minor tranquillizers were commonly prescribed together with neuroleptics and antidepressants. Anti-parkinsonian drugs were prescribed for 37% of those receiving neuroleptics. Neuroleptics, minor tranquillizers and anti-parkinsonian drugs were commonly given three times a day. The prescription pattern differed between the hospitals. Guidelines are suggested for more rational use of psychotropic drugs.