First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tomato torrado virus Infecting Tomato in Hungary.

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5' GATGAAGCTGAACAACATTTC 3' and PepTGB-R: 5' GGAGCTGTATTRGGATTTGA 3'). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain.

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

First Report of Pea enation mosaic virus Infecting Pea and Broad Bean in Spain.

During the spring of 2007, pea plants (Pisum sativum L.) (cvs. Utrillo and Floreta) showing virus-like symptoms were observed in several commercial fields in the southern and eastern regions of Catalonia, Spain. Incidence of symptomatic plants ranged from 5 to 15% and was distributed in both small and large patches. Infected plants exhibited yellow mosaic leaf symptoms that later became translucent. Leaves gradually curled and in some cases developed enations near the veins on the abaxial surface. Plants were "bushy" and had shortened internodes. Infection prior to pod formation resulted in pods that were distorted and stunted (1). The infected leaves and pods were tested by indirect-ELISA with a potyvirus-specific antibody (Agdia, Elkhart, IN) and double-antibody sandwich (DAS)-ELISA with antibodies specific to Pea enation mosaic virus (PEMV), Broad bean wilt virus 1 (BBWV-1), Beet western yellow virus (BWYV), Bean yellow mosaic virus (BYMV), Alfalfa mosaic virus (AMV), and Tomato spotted wilt virus (TSWV) (Loewe Biochemica GmbH, Sauerlach, Germany). PEMV was detected in all 24 symptomatic samples that were collected from 10 locations between March 2007 and March 2008. Thirteen of these samples also tested positive for BWYV, but no differences in symptom expression were observed in plants infected with both viruses or PEMV alone. PEMV was also identified in seven broad bean plants (Vicia faba L.) from three additional locations. These plants expressed interveinal yellow mosaic on leaves and deformed pods. The genomic sequence of PEMV-1 (GenBank Accession No. L04573) was used to design primers to amplify a 451-nt segment of the polymerase gene by reverse transcription (RT)-PCR; PEMV-D (5'-TGACCATGAGTCCACTGAGG-3'), PEMV-R (5'-AGTATCTTCCAACAACCACAT-3'). One ELISA-positive sample was analyzed and the expected size amplicon was generated. Direct sequencing (GenBank Accession No. EU652339) revealed that PEMV-1 and our pea isolate have nucleotide sequence identities of 95%. To our knowledge, this is the first report of PEMV in Spain, which might cause important economical losses since PEMV is an important viral disease of pea and other legumes worldwide. Reference: (1) J. S. Skaf and G. A. Zoeten. No. 372 (No. 257 revised) in: Description of Plant Viruses. AAB, Kew, Surrey, England, 2000.

First Report of Tomato torrado virus on Weed Hosts in Spain.

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes "torrado disease" in tomatoes (4). Typical symptoms of "torrado disease" seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where "torrado disease" symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.